ID: 1125943769

View in Genome Browser
Species Human (GRCh38)
Location 15:43696836-43696858
Sequence GTTCAGAGGGAGACTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 496}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125943769 Original CRISPR GTTCAGAGGGAGACTGGGGA AGG Intronic
900400952 1:2472663-2472685 CTTCAGAGGGAGACACGGGTGGG + Intronic
900766596 1:4509979-4510001 GATCTGAGGAAGGCTGGGGAAGG - Intergenic
900779724 1:4610221-4610243 GCTGTGAGGGAGCCTGGGGAGGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901428331 1:9197691-9197713 GAGGAGAGGGAGACTGGAGAGGG - Intergenic
902384529 1:16068786-16068808 GATGGGAGGGAGCCTGGGGAAGG - Intronic
902466233 1:16620340-16620362 GTGCAGAGGGAAACAGGGCACGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903459712 1:23512084-23512106 GTTAATAGGGAGGCTGAGGAAGG + Intronic
903845877 1:26279831-26279853 GCTCAGTGTGAGACTGGGGAGGG - Exonic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904316504 1:29669624-29669646 GGTCAGGAGGAGAGTGGGGAGGG - Intergenic
904766258 1:32850330-32850352 TTTCAGTGGGAGGCAGGGGAGGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905356619 1:37389265-37389287 ATTCAGAGGGAGAGTGGGAAGGG - Intergenic
905404629 1:37724557-37724579 GAGCAGAGGGAAACTGGGGCAGG + Intronic
905897313 1:41557355-41557377 GTTCAGAGGGACACAGAGGTGGG + Intronic
906090659 1:43176778-43176800 GTAGATAGGGAGGCTGGGGAGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909679835 1:78279262-78279284 ATTCAGAGGGAAACTTTGGATGG + Intergenic
910554784 1:88519421-88519443 GTTCCAAGGGAAACTGGGTAGGG - Intergenic
910557420 1:88551166-88551188 GATCAAAGGGAGACTTGGCAGGG - Intergenic
910845589 1:91601904-91601926 GTTTGGAGGGAGAGTGGTGAGGG - Intergenic
911130404 1:94381852-94381874 GCTCAGAGGGAGACAGGTAAAGG + Intergenic
911218345 1:95219973-95219995 GTACAAAAGGAGAGTGGGGAAGG - Intronic
911358699 1:96850709-96850731 GTGCTGAGTGAGACTTGGGAAGG + Intergenic
912465851 1:109873328-109873350 GCTCAGCAGGAAACTGGGGAGGG - Intergenic
912481553 1:109985260-109985282 CTTCTGGGGGTGACTGGGGACGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913291840 1:117280744-117280766 TTTCAGAGGGAGGCTGAGGCAGG + Intergenic
914096275 1:144546797-144546819 GAGCAGAAGGAGACTGGGAAAGG - Intergenic
914302241 1:146387166-146387188 GAGCAGAAGGAGACTGGGAAAGG + Intergenic
914792098 1:150887158-150887180 GTTCAGCGTGGGAGTGGGGAAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914922583 1:151857567-151857589 GTCCAGAGGAAAACAGGGGAAGG + Intergenic
915274604 1:154779491-154779513 GTCCATGGGGAGAGTGGGGATGG - Intronic
915841336 1:159215881-159215903 GGGCAGAGGGAGCCTGGGAAAGG - Intergenic
915929317 1:160049267-160049289 GTTCAGAAGCAGACTGCGGAAGG - Intronic
916178429 1:162062645-162062667 GTTCAGAGCCAGAGTGGGGGTGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917731477 1:177879283-177879305 GTTTTGAGGAAGAATGGGGAGGG + Intergenic
920017667 1:202926903-202926925 GTTCAGGGGGAGAGTTGAGAGGG + Intronic
920245732 1:204585947-204585969 GTTCAGAGGGAGGGCGGGGGGGG + Intergenic
920345017 1:205300849-205300871 GTTGAAAGGGAGTTTGGGGACGG - Intergenic
920549142 1:206843817-206843839 GGTCACAGTGAGCCTGGGGAAGG - Intergenic
920854446 1:209651683-209651705 ATTCTGAAGGAGGCTGGGGAAGG + Intronic
921320208 1:213931288-213931310 GGACACAGGGAGACTAGGGAGGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922608192 1:226904296-226904318 GCTAGGAGGGATACTGGGGAAGG - Intronic
922801902 1:228368285-228368307 GTGGAGAGGGAGGCTGGGGCTGG + Intronic
922895758 1:229098843-229098865 ATTCAGAGTGAGAGTTGGGAGGG - Intergenic
923841027 1:237670295-237670317 GGGGAGAGGGAGACTGGAGAGGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063775807 10:9262550-9262572 GTTCAGATGGACACAGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065126850 10:22582163-22582185 GTTCTGAGGGAGAATTAGGAAGG - Intronic
1065422003 10:25555301-25555323 GTTAAGAGGAAGAATGGGAAAGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069070971 10:63990385-63990407 GGTCAGAAGGAGACAGGGGCAGG - Intergenic
1069562216 10:69438856-69438878 TTTCAGGGGAAGCCTGGGGAAGG + Intergenic
1069591385 10:69644341-69644363 GTTCTGAGGGACACTGGAGGAGG + Intergenic
1069738956 10:70675254-70675276 GTGCAGAGAGACACTGGGGTTGG + Intronic
1070350120 10:75583756-75583778 GTGCAATGTGAGACTGGGGAAGG - Intronic
1070360738 10:75686162-75686184 GGACAGAGGGCCACTGGGGATGG + Intronic
1070773977 10:79099343-79099365 TTTCAAAGGCAGCCTGGGGAAGG - Intronic
1070976583 10:80610241-80610263 GAGCTGAGGGACACTGGGGAAGG - Intronic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071565980 10:86671478-86671500 TTCAAGAGGGAGACTGGGAAAGG + Intronic
1072502217 10:96028988-96029010 GTTCAGAGGGAGGTGGGGAATGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073049087 10:100656321-100656343 GGACAGAGGGAGACTGGCGCGGG + Intergenic
1073339806 10:102735979-102736001 GTCCAGAAGGAGACAGGGAAGGG + Intronic
1073585336 10:104704531-104704553 GTGAGGAGGGAAACTGGGGATGG + Intronic
1073730064 10:106277476-106277498 GGTCTGAGAGAGACTGGTGACGG + Intergenic
1074146464 10:110721151-110721173 GTGCTGAGGAAGACTGAGGAAGG - Intronic
1074897711 10:117791464-117791486 GGTCAGAGGGAGACTGAAGAAGG - Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075745120 10:124721753-124721775 GTTCACAGGGAGAGTGAGTAAGG - Intronic
1075787091 10:125057397-125057419 GTTTAGAGGGAGGCGGGGGCTGG - Intronic
1076504750 10:130964258-130964280 CTGCAGAGTGAGACTGGGCAAGG + Intergenic
1076692476 10:132230823-132230845 GGGCAGAGGGAGCCTGGAGAGGG - Intronic
1076762725 10:132613321-132613343 GTTCAGTGGGGGACTCGGGAAGG - Intronic
1077485068 11:2834858-2834880 GTGGGGAGGGAGACTTGGGATGG - Intronic
1077864377 11:6210769-6210791 GGAATGAGGGAGACTGGGGAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079347619 11:19667004-19667026 GGTGGGAGGGAGGCTGGGGAGGG - Intronic
1079910482 11:26303540-26303562 ATTAAGAGGGAGACGGAGGAAGG + Intergenic
1080424526 11:32143901-32143923 GCTGAGAGGGAAACTGGAGAAGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083264711 11:61541390-61541412 GTCCAGAGAGATGCTGGGGAGGG + Intronic
1083880324 11:65545235-65545257 GTTCAGGGGCAGGCTGCGGAAGG - Intronic
1084224314 11:67706137-67706159 GTTCTGAGGGAGGCTGAGGTGGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085574397 11:77589659-77589681 GCCCTGAGGGAGACTGCGGAGGG + Exonic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087114911 11:94514346-94514368 GTTCTGAGGGAGGCTGAGGCAGG - Intergenic
1087202930 11:95364326-95364348 CTTCAGAGGGTGTCTGGGGAAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087600709 11:100311449-100311471 GTTAAGAGGAAGACTGGGGATGG + Intronic
1088834342 11:113565267-113565289 CTTCAGGGAGATACTGGGGAAGG + Intergenic
1088848560 11:113687706-113687728 GTGGAGAGGGAGAGTGGAGAGGG + Exonic
1088952642 11:114586955-114586977 GTTCACAGGGGGTGTGGGGAGGG - Intronic
1089437319 11:118481221-118481243 GTTGAGGGGGAAAGTGGGGATGG - Intronic
1089469083 11:118706520-118706542 GGCCAGAGGGAGACAGGAGAGGG - Intergenic
1089742773 11:120596456-120596478 CTTCAGAGAGAGACTGGAGAAGG + Intronic
1090050194 11:123371202-123371224 GTTGAGAGGGTGACTGAGAAAGG + Intergenic
1090187383 11:124747206-124747228 GTTCAGAGGGTGCCGGGGGAGGG + Exonic
1090490267 11:127154574-127154596 ATTCAGGGGCAGACTGTGGAAGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091024659 11:132131515-132131537 GGTCAGAGGGAGCCTTGTGAAGG + Intronic
1091027189 11:132152097-132152119 GTTCAGATTCAGAGTGGGGAGGG - Intronic
1091541034 12:1462836-1462858 GTTCAAAAGGAGACTGGAGGCGG - Intronic
1092278769 12:7083132-7083154 GTTGAGGGGGAGAATGGAGAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092479106 12:8844223-8844245 GTTGGGAGGGAGAGTGGGGAGGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092836444 12:12493490-12493512 GTTCAGAGGGAGTCATTGGAAGG - Intronic
1092954026 12:13532765-13532787 TTTCATAGGGAGAATGGGGAGGG + Intergenic
1093055830 12:14554797-14554819 GCACAGGAGGAGACTGGGGAGGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095905397 12:47372145-47372167 GTCCAGAAGGAGACTGGGAGAGG + Intergenic
1097293706 12:57941638-57941660 GGCCAGAGCGAGACTGGGAAAGG - Exonic
1098021702 12:66162842-66162864 GTTTGGAGGGAGTTTGGGGAAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099784222 12:87239391-87239413 GTTGGGAGGGAGAGTGGGGGTGG + Intergenic
1100392505 12:94156335-94156357 GTTAACAGGGAGACTAAGGAAGG - Intronic
1101239656 12:102825092-102825114 ATTCTGAGGCAAACTGGGGATGG + Intergenic
1101334752 12:103786466-103786488 CTTCAGAGGTGGGCTGGGGAAGG + Intronic
1101410673 12:104465346-104465368 GTTAAGAGTTAGAATGGGGAGGG + Intronic
1101674789 12:106907952-106907974 GCTCAGAGGGCCTCTGGGGAAGG + Intergenic
1104908493 12:132228277-132228299 GGTCAGAGGGACGCTGGGGAGGG - Intronic
1105546608 13:21355436-21355458 CTTCAGAGCTAGCCTGGGGAGGG + Intergenic
1106512758 13:30425424-30425446 GTTCGCAGGGAGATTGGGAATGG + Intergenic
1106679976 13:31999488-31999510 GGGGAGAGGGAGACTGGAGAGGG - Intergenic
1107797452 13:44067264-44067286 GTTAAGAGGGAGACTGAGGCCGG + Intergenic
1107990071 13:45811970-45811992 GTTCAGAGGGAGACTTCCCATGG - Intronic
1108078714 13:46710219-46710241 GTGCTCAGGGACACTGGGGAAGG + Intronic
1108977255 13:56462894-56462916 GTCCAGAGGGAGTCAGGGGAAGG + Intergenic
1110466352 13:75806609-75806631 TTTCAGGTGGAGACTGGGAAGGG + Intronic
1112020037 13:95363606-95363628 GTTCAGAAGGAAGCTGGGCAAGG + Intergenic
1113024095 13:105921464-105921486 TCTGAGAGAGAGACTGGGGAGGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116759569 14:48994644-48994666 ATTCAGAGAAAAACTGGGGAAGG - Intergenic
1117728661 14:58698880-58698902 CTTCAGAGGGAGACAGGTGGAGG + Intergenic
1117729837 14:58711295-58711317 ATTCATAGGGAGGCTGGGCACGG - Intergenic
1118624201 14:67642601-67642623 GTTCAGAGGTATACTAGGCAAGG + Intronic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1119324898 14:73753980-73754002 GGCCAGAGGGAGGCTGAGGAAGG + Intronic
1119526971 14:75330580-75330602 TTTCATATGGAGACTTGGGATGG + Intergenic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1121078787 14:91090809-91090831 GTGCACAGGGAGGGTGGGGATGG + Intronic
1121818257 14:96944522-96944544 GCTCAGAGGGAGACCTGGAACGG - Intergenic
1122347706 14:101070792-101070814 GACCAGAGGGGGACTGGGAATGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122825756 14:104369673-104369695 GAGCTGAGGGAGACTGGGGGTGG - Intergenic
1123059343 14:105587426-105587448 GTACAGAGGGAAACTGAGGCAGG - Intergenic
1123083675 14:105707657-105707679 GTACAGAGGGAAACTGAGGCAGG - Intergenic
1123910233 15:24958589-24958611 GGCCAGAGAGAGACTGAGGAGGG - Intronic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125832276 15:42725444-42725466 GTTCAGAGTGTGACTGCAGAGGG + Intronic
1125832654 15:42727775-42727797 GGGCAGAGGGAGAATGGGAAAGG + Intronic
1125930600 15:43597015-43597037 GTTCGGAGAGAGACTGGGGAAGG + Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127006591 15:54577566-54577588 GTCCAGAGGGAGCCTGGAGAAGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127644356 15:60945165-60945187 TTTCAGAGAGAGGGTGGGGAGGG - Intronic
1127903549 15:63359140-63359162 GCTCAGAGGAAAACTGGGCAGGG - Intronic
1128357252 15:66936771-66936793 GTGCAGAGGGACGCTGGGGAAGG - Intergenic
1128359653 15:66953102-66953124 GCTCAGAAGCAGCCTGGGGATGG - Intergenic
1128511013 15:68313930-68313952 GGTCTGAGGCAGACTGTGGAAGG + Intronic
1130306327 15:82714308-82714330 TTTCAGAGGGAGAGTCGGGGTGG - Intergenic
1130939460 15:88495614-88495636 GTGCAGAGGAAGACGGTGGAGGG - Intergenic
1131081713 15:89542097-89542119 GTTAAGAAGGAGATTGGGGTGGG + Intergenic
1132843244 16:1988683-1988705 GGTCAGAGGGAGAGAGAGGAGGG + Intergenic
1132959102 16:2612362-2612384 GTTCCGGGGGAGGGTGGGGAAGG + Intergenic
1132972162 16:2694337-2694359 GTTCCGGGGGAGGGTGGGGAAGG + Intronic
1133207990 16:4245516-4245538 GTTCAGAGCTAGAAAGGGGAAGG + Intergenic
1133608723 16:7413327-7413349 CTACAGAGGAAGACTGGGGAAGG - Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1135117877 16:19738993-19739015 CTGCAGAGGGAGCATGGGGAGGG - Intronic
1135412569 16:22246229-22246251 GTACAGAAGAAGACTGGGCATGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137447849 16:48543069-48543091 GTTCTGCTGGAGACTGGGGAGGG + Exonic
1139322159 16:66123614-66123636 GTTGAGAGGGAGGAAGGGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139789891 16:69424985-69425007 CCTCAGAGGGAAACTGGGGTGGG + Intronic
1139801017 16:69522840-69522862 GTTCAGAGAGTGAATGAGGAAGG - Intergenic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1141111282 16:81272940-81272962 GTTTAGAGACAGACTGGGGCAGG - Intronic
1142150001 16:88508540-88508562 GTTCAGAGTGAGCGTCGGGATGG - Intronic
1142279464 16:89140212-89140234 GCTCAGAGGGGCAGTGGGGAAGG - Intronic
1142312576 16:89322660-89322682 CTTGAGGGGGACACTGGGGAGGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143412829 17:6722271-6722293 GTTAGGAGAGAGGCTGGGGATGG - Intergenic
1144100888 17:11941331-11941353 GGACAGAGGGAGAGAGGGGAAGG - Intronic
1144590600 17:16520609-16520631 GTTGATAGGGAGGCTGGGGCAGG + Intergenic
1144855054 17:18262928-18262950 TTTCAGAGGGGCCCTGGGGAGGG + Intronic
1145787246 17:27602299-27602321 GTTCAGAGGGAGCCTCCGGGAGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146242040 17:31238827-31238849 GTTAACTGGGATACTGGGGAAGG - Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147264765 17:39227895-39227917 GTCCAGTGGGAGATGGGGGAAGG - Intergenic
1150649392 17:67000107-67000129 TTGCAGAGAGAGCCTGGGGAAGG - Intronic
1151458611 17:74241574-74241596 GCTCCGAGGGAGAGAGGGGAGGG - Intronic
1151559857 17:74864408-74864430 GGTCAGAGAGGGATTGGGGAAGG - Intronic
1151626270 17:75277796-75277818 GGGCAGGGGGAGGCTGGGGAGGG - Intronic
1151882885 17:76905444-76905466 GATCAGAGGGAGAGAGGGGTAGG + Intronic
1151966681 17:77435163-77435185 GCTCAGAGGGAGGCTTGGGCAGG - Intronic
1151995143 17:77603630-77603652 GTTCAGAGTGTGCCTGGGGCTGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152139625 17:78528838-78528860 GGTCAGGGGGACCCTGGGGAGGG - Intronic
1152784983 17:82243055-82243077 GTACAGAGGGAGGTTGGGGTGGG - Exonic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153205261 18:2692429-2692451 GTTGAGAGGAAGACAGGAGAAGG - Intronic
1153543777 18:6185431-6185453 GAGGAGAGGGAGGCTGGGGAAGG + Intronic
1154485926 18:14871217-14871239 GTTTAGAGGGAGGGTGGGGTGGG - Intergenic
1157736206 18:50051933-50051955 GTTCTGAAGGAGAGTGGTGATGG + Intronic
1159777853 18:72624269-72624291 GTTAAGAGGGAGGGTGGAGATGG - Intronic
1160143565 18:76347169-76347191 GTTCAGAGAGAAACTGGTGGCGG - Intergenic
1161251733 19:3284509-3284531 GTGGAGAGGGAGACGGGGCAGGG + Intronic
1161394620 19:4038481-4038503 GTACAGTGGGCGGCTGGGGAGGG + Exonic
1161483892 19:4524606-4524628 GTTCAGGGAGAGAATGTGGAGGG + Intronic
1161791462 19:6362374-6362396 GTTTTAAGGGAGGCTGGGGATGG - Intronic
1162417605 19:10547357-10547379 GGGCAGAGGGACACTGGGGAAGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163427216 19:17246112-17246134 GGGCAGAGGGAGGCGGGGGAGGG - Intronic
1163689507 19:18730884-18730906 GTCCAGAGGGAGCTTGGAGAGGG + Intronic
1163786170 19:19275966-19275988 CTGCAGAGGGAGGTTGGGGAGGG - Intergenic
1163823705 19:19511090-19511112 GTGCAGTGGGAGTCTAGGGAAGG + Intergenic
1164725885 19:30465342-30465364 CTTCAGGGGGTGACTGGGGAGGG - Intronic
1164743509 19:30594422-30594444 GAGCAGGGGGAGACTGAGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167014951 19:46835113-46835135 GTTCAGAGTGGGACTGGGGATGG - Intergenic
1167087578 19:47320718-47320740 GTTCCGGAGGAGGCTGGGGAGGG - Exonic
1167158985 19:47755542-47755564 GTTCTGGGAGAGGCTGGGGAGGG + Intronic
1167423120 19:49415346-49415368 GTTCTGAGGCTGGCTGGGGAGGG - Intronic
1167547939 19:50140418-50140440 GTGGAGAGGGAGACGGGAGACGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168349825 19:55669384-55669406 GAGCAGAGGGAGACTGGGTCTGG + Intronic
1168687469 19:58357475-58357497 GTTCCGAGGGAGGCAGGGGACGG - Exonic
1168692630 19:58386176-58386198 GTTCAGAGGCAGCTGGGGGAAGG + Intergenic
925185218 2:1842443-1842465 GTGAAGAGCGAGACAGGGGAAGG - Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926065789 2:9838762-9838784 GTTGAGAGTGGGAGTGGGGAGGG - Intergenic
926190351 2:10723016-10723038 GGTCAGGGGGAGACAGGAGAGGG + Intronic
926199611 2:10784947-10784969 GTTGAGAGAGAGCCTTGGGACGG - Exonic
926239705 2:11075590-11075612 GTTTTGAGGGAGGCTGGGGAAGG - Intergenic
926379035 2:12265842-12265864 ATTCAGAGGGACACAGAGGAGGG - Intergenic
927148933 2:20184858-20184880 GAACAGAGGGACACTGGAGACGG - Intergenic
927214190 2:20657526-20657548 GCTCAGATGGAGACTGGTGATGG + Intergenic
927515527 2:23669699-23669721 GCTCAGAGGCTGACTGGGGGTGG - Intronic
927598424 2:24418736-24418758 GCTGGGAGGGAGTCTGGGGAAGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928093875 2:28392544-28392566 GGTGAGCGGGGGACTGGGGAGGG + Intronic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929259967 2:39855116-39855138 GATCAGGGGAAGATTGGGGAAGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929832878 2:45362680-45362702 GTTCAGGGAGAGACTTGTGAGGG + Intergenic
930036451 2:47088476-47088498 GCTCAGTGGGAGCCTGGGCATGG + Intronic
932421203 2:71602522-71602544 GTGCAGAGGGACGCTGGGAAAGG - Intronic
932518109 2:72374557-72374579 GTTGAGAGGGAAGGTGGGGATGG + Intronic
933771707 2:85748834-85748856 GTGGAAAGGGAGAGTGGGGAGGG - Intergenic
933816022 2:86069461-86069483 GTCCAGAGGGACACGAGGGAAGG - Intronic
933978997 2:87535330-87535352 GTTCATGGAGAGACTGGGAATGG - Intergenic
934144785 2:89081153-89081175 GTTCAAAGGGAGACTCAGCATGG + Intergenic
934224472 2:90119398-90119420 GTTCAAAGGGAGACTCAGCATGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936373815 2:111924293-111924315 GCTCACAGGGAAAGTGGGGATGG - Intronic
937033535 2:118761827-118761849 GTTCTGTGGGAAGCTGGGGAGGG + Intergenic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940134643 2:150422618-150422640 GTTCAGTGGGAAATTTGGGAAGG + Intergenic
940321814 2:152385332-152385354 GTAGGGAGGGAGGCTGGGGATGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941295837 2:163736838-163736860 ATTCACAGGGAGGCGGGGGAGGG - Intergenic
941853585 2:170207948-170207970 GTTAAAAGGGAGTCTGGGGGTGG + Intronic
941870590 2:170381011-170381033 GTTGAGAGGCTGAGTGGGGAGGG + Intronic
941957018 2:171215229-171215251 GTTGAGAGAGAGAGTGGGCACGG - Intronic
943329823 2:186545692-186545714 GTGCAGAGGAAGACTGTGAATGG - Intergenic
943570582 2:189569292-189569314 GTTTAGAGGGTGAAAGGGGAGGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945110817 2:206357710-206357732 GTTCAGAGGGAGACTGGGAGAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945450859 2:209993595-209993617 GTACAGACAGGGACTGGGGAAGG - Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946145080 2:217724474-217724496 GTAAAGAGGGAGAATGGTGAGGG + Intronic
946163132 2:217848054-217848076 GAACTCAGGGAGACTGGGGATGG + Exonic
946623811 2:221589758-221589780 GTCCAGATGGAGAGAGGGGATGG + Intergenic
948220181 2:236263057-236263079 GTTGGGAGGGAGAATGGGGGTGG + Intronic
1169022497 20:2340330-2340352 GTTCTGATGGAGGCTGGGCAAGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169534293 20:6520963-6520985 GTTTAGCAGGAGACTGGGGATGG - Intergenic
1170080274 20:12467443-12467465 GGCCAAAGGGAGACTGGTGAAGG - Intergenic
1170830933 20:19839755-19839777 ATTCAGAGGGTGAGTGGGAAAGG - Intergenic
1171212266 20:23326155-23326177 GCTCAGAGGAATATTGGGGATGG - Intergenic
1172114044 20:32563221-32563243 GTGAGGAGGGAGAGTGGGGAGGG + Intronic
1172114061 20:32563263-32563285 GTGGGGAGGGAGACTCGGGAGGG + Intronic
1172884588 20:38222627-38222649 TTGCAGAGGGAGAGTGGGGATGG - Intronic
1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG + Intronic
1174282089 20:49446870-49446892 CTTCAGAGGGAGATGAGGGATGG - Intronic
1175239366 20:57535456-57535478 GGTCAGAGGGAGGCTGGAGAAGG + Intergenic
1175279077 20:57790732-57790754 GTTCAGAGGGAGACAGGATGGGG + Intergenic
1175486403 20:59349951-59349973 GTACAGAGAGAAACTGGAGAGGG + Intergenic
1175639846 20:60619744-60619766 CTTCAGAGGGAGAGTGGAGTTGG + Intergenic
1175756331 20:61532737-61532759 GTTCTAGGGGAGATTGGGGAAGG + Intronic
1176795378 21:13368161-13368183 GTTTAGAGGGAGGGTGGGGTGGG + Intergenic
1177784505 21:25656274-25656296 GTTTAGAAGGAGCCTGGGGGTGG - Intronic
1177948720 21:27506328-27506350 GTTCAAAGTGAGACTTGGGTGGG + Intergenic
1178000209 21:28153794-28153816 GATCAGAAGAAGACTGGGGGAGG - Intergenic
1179578883 21:42325670-42325692 GGTCAGAGAGAGACTTGGGAAGG - Intergenic
1180082396 21:45492951-45492973 GTCCAGAGTGAGGCTGGGGCCGG + Intronic
1180976848 22:19853449-19853471 GTTTGCAGAGAGACTGGGGAGGG - Intronic
1180993200 22:19951062-19951084 GTTCAGAAGAAGCCTGGGGCGGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182171127 22:28230632-28230654 ATACAGAGAGAGACTGGGGGAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182617247 22:31595686-31595708 GTGCTGAGGGAGACTGAGCATGG + Intronic
1183167201 22:36156702-36156724 GTGCTCAGGGAGCCTGGGGAGGG - Intronic
1183177943 22:36238028-36238050 GTGCTCAGGGAGCCTGGGGAGGG - Intronic
1183395632 22:37569283-37569305 GGTAAGAGGGAGGCTGGGGCGGG - Exonic
1183539148 22:38419551-38419573 GTTCAGAGGAAGAGAGGGGAGGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184259657 22:43307318-43307340 GTTCATCAGGAGGCTGGGGAAGG + Intronic
1184299037 22:43544080-43544102 GCTCAGGGGGAGGCTGGGGAGGG - Intronic
1185222426 22:49635851-49635873 TTCCGGAGGGAGCCTGGGGACGG + Intronic
1185372544 22:50467699-50467721 GGTCAGGGGGAGACGGGGGCAGG + Intronic
949459678 3:4276955-4276977 GTTCTGAGGGAAGATGGGGATGG + Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950856845 3:16113741-16113763 ATTCAGAAGGAGACAGGGTATGG - Intergenic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
952174284 3:30844471-30844493 ATTCAAAGGGACAGTGGGGAAGG + Intronic
953090332 3:39718487-39718509 GATCAGAATGAGAATGGGGAAGG + Intergenic
953797332 3:45995584-45995606 GGTCTGAGGGAGACCTGGGATGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954614114 3:51960789-51960811 GTTCAGAGAGAAAGTGGGGCAGG + Intronic
954633092 3:52057379-52057401 GTTGAGAGGGAGGCAGGGGAAGG - Intergenic
955055760 3:55454754-55454776 GTTCAGAGGTAGAGAAGGGAGGG - Intergenic
955292335 3:57703735-57703757 GTTCAGAGGCAGACTGTTGCTGG - Intergenic
956426922 3:69145329-69145351 CTGCAAAGGGAGCCTGGGGAGGG + Intergenic
957759679 3:84539076-84539098 GAGCAGAGGGACACTGGGCAAGG - Intergenic
958084555 3:88789731-88789753 GAGCAGAGGGACACAGGGGATGG - Intergenic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960662786 3:120079186-120079208 TCCCAGAGGGAGACTGAGGAGGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960974695 3:123162792-123162814 CTTTAAAGGGAGATTGGGGAGGG - Intronic
961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG + Intronic
961389880 3:126546157-126546179 GGTCAGAGGGAGACTGCGGGAGG - Intronic
961787028 3:129353467-129353489 TATCAGAGGGAAGCTGGGGATGG - Intergenic
961791691 3:129380982-129381004 TTTCAGAGGGAGAGTGGGGAGGG + Intergenic
961805713 3:129487933-129487955 TTCCAGAGGCAGAGTGGGGAGGG + Intronic
962869566 3:139476365-139476387 GGTAAGGAGGAGACTGGGGATGG - Exonic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965517948 3:169642234-169642256 GTGCAGATGGTGACTGGGGAAGG + Intronic
966478488 3:180377652-180377674 GCTGATAGGGTGACTGGGGAGGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966915157 3:184580630-184580652 GCTGGGAGGGAGACTGGGGGCGG + Intronic
967107006 3:186262206-186262228 GTTCAGGAGGAAACTGGGGCCGG - Intronic
967345014 3:188445488-188445510 GGGCAGTGGGAGACTAGGGAGGG + Intronic
968441492 4:626674-626696 GTCCAGGGTGGGACTGGGGAGGG + Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968628184 4:1637423-1637445 GGACAGAGGGAGCCTGGGGGAGG + Intronic
968702279 4:2062738-2062760 GTGCAGAGGGGCAATGGGGAGGG + Intronic
969113696 4:4858855-4858877 GTTCAGAGCGAGGGTGGGGGGGG + Intergenic
969278183 4:6151051-6151073 AGACAGTGGGAGACTGGGGAAGG - Intronic
969333407 4:6492963-6492985 GTGAGGAGGGAGACTGGGGAGGG - Intronic
969523548 4:7692690-7692712 GTCCAGAGGGACACAGGGTATGG + Intronic
969900695 4:10346450-10346472 TTTCTCAGGGAGTCTGGGGATGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970424284 4:15932033-15932055 CTTCGGAGAGAGGCTGGGGAAGG + Intergenic
970480415 4:16467267-16467289 GTTCAGGGGGTCTCTGGGGAAGG + Intergenic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
971097068 4:23418580-23418602 GATCCGAGGAAGACTGGAGAAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977296581 4:95216367-95216389 GTTCAGAGGGAGCCGTGGTAAGG - Intronic
977352286 4:95903885-95903907 GATGAGGAGGAGACTGGGGATGG + Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978577241 4:110199254-110199276 GAACAGAGGCAGAGTGGGGAAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979874624 4:125872401-125872423 TGTGAGAGGGAGACTTGGGAAGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
982217244 4:153093017-153093039 GTGGAGAGGGAGAATGGAGATGG - Intergenic
983010186 4:162537364-162537386 GTTGGGAGGGGGACTGAGGAAGG + Intergenic
983166422 4:164482351-164482373 AGTCAGAGGGAGGGTGGGGAGGG + Intergenic
984768000 4:183414171-183414193 GTTCAGGGGGAGGCCTGGGATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985519669 5:367670-367692 GTTAAAAGTGAGGCTGGGGAAGG - Intronic
985527829 5:415968-415990 GTTCACAGGGAGACTGGCCTTGG - Intronic
986990998 5:13553018-13553040 GTTCAGAGGTAGACTGTTGTAGG - Intergenic
989173209 5:38494120-38494142 TGGGAGAGGGAGACTGGGGAGGG + Intronic
989359038 5:40578511-40578533 GCTAAGAGGGAGCGTGGGGATGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989685475 5:44081582-44081604 GTTCAGAGAGCCAATGGGGATGG + Intergenic
989995576 5:50825465-50825487 TTTCAGAGTGAGCCTGGTGAGGG + Intronic
990543481 5:56798349-56798371 GTTCAGAGAGAGAATGTGAACGG + Intergenic
991362015 5:65830650-65830672 GTTCAGACAAAGACTGGGGCTGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992014452 5:72561332-72561354 GCTCAGAGAGATAATGGGGATGG - Intergenic
994148432 5:96420718-96420740 GTTCTGAGGGAGAATAAGGAAGG + Intronic
994526122 5:100906667-100906689 GTTGATAGGGAGACTGAGTATGG - Intergenic
998843006 5:146276259-146276281 TTTCAGTGGGTGTCTGGGGAAGG + Intronic
999266372 5:150269457-150269479 CTCAAGAGGGAGACTGAGGAGGG - Intronic
999404278 5:151293205-151293227 GTACAGAGTGAGATGGGGGATGG + Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000497073 5:161997604-161997626 GTTTAGAGGGAAAGTGGGGATGG + Intergenic
1001822425 5:174720742-174720764 TTGCAGAGTGAGAATGGGGAAGG - Intergenic
1002275956 5:178104606-178104628 GTTTAGAGGGAGGGTGGGGTGGG + Intergenic
1002430823 5:179202937-179202959 GCTACAAGGGAGACTGGGGAGGG + Intronic
1002724664 5:181286566-181286588 GTTTAGAGGGAGAGTGGGGTGGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003895455 6:10603477-10603499 GTCCAGATGCAGACAGGGGAGGG + Intronic
1004504672 6:16238471-16238493 GTTGAGAGGCAGACTGGTTAGGG - Intergenic
1006054067 6:31367530-31367552 GCTCAGAGGGAAGATGGGGAGGG + Intergenic
1006573563 6:35025883-35025905 GTTTAGTGGGGGACTGGGGCTGG - Intronic
1006934204 6:37705865-37705887 GTTCAGAGAGAGACGGGGGCGGG + Intergenic
1007069465 6:39025331-39025353 GTCCAGAGGGAGTGTGGGGGAGG - Intronic
1007177165 6:39904861-39904883 GTTTAAAGGCAGACTGGGTAGGG - Exonic
1007377122 6:41464519-41464541 GCCCAGAGAGAGACTTGGGAAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009941754 6:70298079-70298101 GTTGACAAGGAGACTAGGGATGG - Intronic
1009975406 6:70666508-70666530 ATTTAGATGGGGACTGGGGAGGG - Intergenic
1011160855 6:84388808-84388830 GTTAAGGGGAAGAGTGGGGATGG + Intergenic
1011626371 6:89286837-89286859 TTCCAGAGGGAAGCTGGGGAAGG + Intronic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1014057897 6:117037738-117037760 GGTCAGATGGTGACTGGGGTTGG - Intergenic
1015263556 6:131265520-131265542 TTTCACAGGGATACTGAGGAGGG + Intronic
1016834298 6:148461976-148461998 GTACAGGGGGAGGCAGGGGAAGG - Intronic
1018377376 6:163226186-163226208 GTTTAGCAGGAGCCTGGGGAAGG + Intronic
1019057833 6:169235898-169235920 GGACAGAGGGAGAGTGTGGATGG - Intronic
1019315080 7:380554-380576 GGACAGAGGGAGGCAGGGGAGGG + Intergenic
1019445445 7:1068634-1068656 GTTGGGGGGAAGACTGGGGATGG - Intronic
1019450933 7:1097582-1097604 TTTCAGAGGGAGACGGGGGCAGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020389424 7:7642399-7642421 TTTGGGAGGGAGACGGGGGAGGG - Intronic
1020415869 7:7945133-7945155 GGTCAGATGGAAACTGGGGCAGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023301407 7:38776044-38776066 CTTCAAAGGGAGACTGGGTGTGG + Intronic
1023797802 7:43808272-43808294 GTTCAGAGGGAGAAGGTGGCTGG - Intergenic
1023871229 7:44264034-44264056 GTTCAGGACGTGACTGGGGAGGG + Intronic
1024598490 7:50960064-50960086 GATCAGAGGAGGACTGTGGAGGG - Intergenic
1025057843 7:55779459-55779481 GTTCAGAGAGAGACTAGGTTTGG - Intergenic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026879636 7:73900453-73900475 GTCCTGGGGGAGAGTGGGGAGGG - Intergenic
1027459055 7:78429370-78429392 GGTCAGAGGTAGGCTGAGGAGGG + Intronic
1029321426 7:99764133-99764155 ATTCAGAGGTACACTGGGGGTGG + Intronic
1029441746 7:100590563-100590585 GTACAGAGGGAGACTTGGCAGGG - Intronic
1029442608 7:100595371-100595393 GTGCGGAGGGAGGCTGAGGAGGG + Intronic
1031297525 7:120021500-120021522 GTTGAAAGTGGGACTGGGGATGG - Intergenic
1032440964 7:131942892-131942914 GATAAGAGGGAGGGTGGGGAGGG + Intergenic
1033256577 7:139806742-139806764 GATGAGAGGGAGGATGGGGAGGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033734855 7:144212022-144212044 GGTCTGAGGAAAACTGGGGAGGG - Intergenic
1033748200 7:144338947-144338969 GGTCTGAGGAAAACTGGGGAGGG + Intergenic
1034477724 7:151296616-151296638 GTTCAGTGGTTGCCTGGGGATGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035062355 7:156079101-156079123 GCCCGAAGGGAGACTGGGGAGGG - Intergenic
1035185187 7:157120925-157120947 GTTCAGCGGGACACAGGGTAAGG + Intergenic
1035354227 7:158267348-158267370 GTTAGAAGGGACACTGGGGAGGG + Intronic
1035678641 8:1471569-1471591 GTTAGGAGGGAGGCTGGGGAGGG - Intergenic
1035818382 8:2564791-2564813 GTTGAAAGAGAGAGTGGGGATGG + Intergenic
1036961416 8:13248719-13248741 GTGGAGAGGGAGACATGGGATGG - Intronic
1037437553 8:18879293-18879315 GATAAGAGGGAGACAGGGCAAGG + Intronic
1037765518 8:21770091-21770113 GCTCAGAGGGAGTCTTGGGTGGG - Intronic
1037767390 8:21780557-21780579 GGTCTGAGCGAGACTGAGGAAGG - Intronic
1037952596 8:23028679-23028701 CTTCTCAGGGACACTGGGGAGGG - Intronic
1038493977 8:27988983-27989005 CTTCAGAGGGAGGGTGGGCAAGG + Intronic
1038531070 8:28318214-28318236 GTTCAGAGCGAGATTCGGGGAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039339163 8:36627986-36628008 ATTCAGAGGGAGAGTGCTGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040385762 8:46914115-46914137 ATTAGCAGGGAGACTGGGGAGGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042708503 8:71688266-71688288 GTCAAGAGGGAGGCTGGGGAAGG - Intergenic
1044523852 8:93229855-93229877 GTTCAGCGGGACACTGGGGCCGG - Intergenic
1045077022 8:98581299-98581321 GGTCAGAGGCAGTCTGGTGAAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045284883 8:100781900-100781922 GTTCAAAGGGTGCATGGGGAAGG - Intergenic
1045321147 8:101082060-101082082 GTTCAGAGGGAGGCTGCGATGGG + Intergenic
1045497106 8:102718104-102718126 GTGCAGGGGGAGAGTGGGAAGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046672724 8:117074584-117074606 GTCAAGGGGGAGACTGGGGTTGG - Intronic
1047772378 8:128039626-128039648 GCTCAGAGGGAGTCTTGGTAAGG + Intergenic
1047861828 8:128975699-128975721 GTTCAGGGGGAAACTGGCCAGGG + Intergenic
1048272034 8:133037159-133037181 TTTCAAAGGGATCCTGGGGAAGG - Intronic
1048646098 8:136421489-136421511 GTTCAAGGGAAGACTGTGGAAGG + Intergenic
1049188866 8:141274933-141274955 GTTCAGAGGGCCACTGCGGATGG + Intronic
1049432922 8:142573620-142573642 TTGCAGAGGGGGACTGGGGTAGG + Intergenic
1049585926 8:143432363-143432385 GTTGAGAGGGAGGCCCGGGAAGG + Intergenic
1049923550 9:387563-387585 GTCCAAAGGGAGACTTGGGGAGG - Intronic
1050144622 9:2553541-2553563 TTTCAGAGGGAGGCAGGAGATGG + Intergenic
1050184992 9:2963865-2963887 GTTCAGAGTGATACTGGGGCAGG - Intergenic
1050279431 9:4034856-4034878 CTTCAGAGGGTGAGTGGTGAGGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051679556 9:19593445-19593467 GGGCTGAGGGAGACAGGGGAGGG + Intronic
1052334335 9:27304239-27304261 ATTCCGAGGAAGAATGGGGAAGG + Intergenic
1053886840 9:42650038-42650060 GTTTAGAGGGAGGGTGGGGAGGG - Intergenic
1054225859 9:62457488-62457510 GTTTAGAGGGAGGGTGGGGAGGG - Intergenic
1054743821 9:68834386-68834408 GTGCTGAGGGAGGCTGGGGAGGG - Intronic
1054946894 9:70805206-70805228 GGTGAGAGAGAGACTGGGGTGGG + Intronic
1055989678 9:82092117-82092139 GTTCAGTGGGACACTGGTGAGGG + Intergenic
1056526356 9:87446461-87446483 GTGAAGAGAGAGACTTGGGAAGG - Intergenic
1059426378 9:114223340-114223362 GCTCAGAGGGAGGCTGGAGGAGG + Intronic
1059463669 9:114451669-114451691 GTTCTCAGGCAGACTGGGGGAGG - Intronic
1060750686 9:126166439-126166461 GGGGAGAGGGACACTGGGGAGGG + Intergenic
1061002475 9:127910179-127910201 GCTCTGGGGGAGGCTGGGGAGGG + Intronic
1061277393 9:129577221-129577243 GTCTAGGGGGAGGCTGGGGAAGG + Intergenic
1062394514 9:136347393-136347415 GTTCCCAGGAAGACTGGGTAAGG + Intronic
1062669436 9:137698531-137698553 GTTCAAAGGTAGAGTGGGCAGGG + Intronic
1185641912 X:1593034-1593056 GGGCAGAGAGACACTGGGGAAGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188634880 X:32417313-32417335 GCCCAGAGGGAGAGTAGGGATGG + Intronic
1189291034 X:39886309-39886331 GTGCTTAGGAAGACTGGGGACGG - Intergenic
1189508773 X:41639752-41639774 GATCAGTGGCTGACTGGGGATGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190743509 X:53306341-53306363 GTCCAGAGGGAGGCAGGGGCAGG + Intronic
1192170364 X:68851063-68851085 GATCAGAGGGACTCTGGGGCGGG + Intergenic
1192584530 X:72308739-72308761 TATCAGAGGGAGACTAGGCAGGG - Intergenic
1194398866 X:93419087-93419109 GTTGCAAGGGAGACAGGGGAAGG + Intergenic
1194902482 X:99530201-99530223 TGTCAGGGGGAGAGTGGGGAGGG + Intergenic
1195093978 X:101488722-101488744 GTTAAGATGGAGACTGTGGTTGG + Exonic
1195737885 X:108032566-108032588 GTGCATAGGGCAACTGGGGAAGG + Intergenic
1196596223 X:117548668-117548690 GTTCAGAGGGCCACTGCAGAAGG + Intergenic
1197631256 X:128862095-128862117 GTACAGAGGGAGCCAGGGGCTGG + Intergenic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1197866573 X:131025402-131025424 CTTCTGAGGTAGACTGGGGTGGG + Intergenic
1198580583 X:138060017-138060039 GTCCAAAGGGAAAATGGGGAGGG - Intergenic
1199755049 X:150855997-150856019 GGTCAGGGCCAGACTGGGGAGGG - Intronic
1200072633 X:153536662-153536684 CTATAGAGCGAGACTGGGGAGGG + Intronic
1200793389 Y:7318890-7318912 GGCCAAAGGAAGACTGGGGAGGG - Intergenic
1201146272 Y:11067047-11067069 GTACAGAGGGAGAGGGAGGAAGG + Intergenic
1201315820 Y:12644268-12644290 GTTAACAGGGCCACTGGGGAAGG - Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic