ID: 1125946014

View in Genome Browser
Species Human (GRCh38)
Location 15:43712322-43712344
Sequence CCAGCAGCAGGTCTGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125946014_1125946022 -1 Left 1125946014 15:43712322-43712344 CCTGGCCCCAGACCTGCTGCTGG No data
Right 1125946022 15:43712344-43712366 GCCAGCTATCCTCCAGGGCCTGG No data
1125946014_1125946021 -6 Left 1125946014 15:43712322-43712344 CCTGGCCCCAGACCTGCTGCTGG No data
Right 1125946021 15:43712339-43712361 TGCTGGCCAGCTATCCTCCAGGG No data
1125946014_1125946020 -7 Left 1125946014 15:43712322-43712344 CCTGGCCCCAGACCTGCTGCTGG No data
Right 1125946020 15:43712338-43712360 CTGCTGGCCAGCTATCCTCCAGG No data
1125946014_1125946025 10 Left 1125946014 15:43712322-43712344 CCTGGCCCCAGACCTGCTGCTGG No data
Right 1125946025 15:43712355-43712377 TCCAGGGCCTGGATCTGAGATGG No data
1125946014_1125946029 16 Left 1125946014 15:43712322-43712344 CCTGGCCCCAGACCTGCTGCTGG No data
Right 1125946029 15:43712361-43712383 GCCTGGATCTGAGATGGGGAAGG No data
1125946014_1125946031 30 Left 1125946014 15:43712322-43712344 CCTGGCCCCAGACCTGCTGCTGG No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946014_1125946027 11 Left 1125946014 15:43712322-43712344 CCTGGCCCCAGACCTGCTGCTGG No data
Right 1125946027 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG No data
1125946014_1125946028 12 Left 1125946014 15:43712322-43712344 CCTGGCCCCAGACCTGCTGCTGG No data
Right 1125946028 15:43712357-43712379 CAGGGCCTGGATCTGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125946014 Original CRISPR CCAGCAGCAGGTCTGGGGCC AGG (reversed) Intergenic