ID: 1125946016

View in Genome Browser
Species Human (GRCh38)
Location 15:43712327-43712349
Sequence GCTGGCCAGCAGCAGGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125946016_1125946033 27 Left 1125946016 15:43712327-43712349 CCCCAGACCTGCTGCTGGCCAGC No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946016_1125946025 5 Left 1125946016 15:43712327-43712349 CCCCAGACCTGCTGCTGGCCAGC No data
Right 1125946025 15:43712355-43712377 TCCAGGGCCTGGATCTGAGATGG No data
1125946016_1125946029 11 Left 1125946016 15:43712327-43712349 CCCCAGACCTGCTGCTGGCCAGC No data
Right 1125946029 15:43712361-43712383 GCCTGGATCTGAGATGGGGAAGG No data
1125946016_1125946028 7 Left 1125946016 15:43712327-43712349 CCCCAGACCTGCTGCTGGCCAGC No data
Right 1125946028 15:43712357-43712379 CAGGGCCTGGATCTGAGATGGGG No data
1125946016_1125946032 26 Left 1125946016 15:43712327-43712349 CCCCAGACCTGCTGCTGGCCAGC No data
Right 1125946032 15:43712376-43712398 GGGGAAGGTTAGCTCGCACTGGG No data
1125946016_1125946031 25 Left 1125946016 15:43712327-43712349 CCCCAGACCTGCTGCTGGCCAGC No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946016_1125946022 -6 Left 1125946016 15:43712327-43712349 CCCCAGACCTGCTGCTGGCCAGC No data
Right 1125946022 15:43712344-43712366 GCCAGCTATCCTCCAGGGCCTGG No data
1125946016_1125946027 6 Left 1125946016 15:43712327-43712349 CCCCAGACCTGCTGCTGGCCAGC No data
Right 1125946027 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125946016 Original CRISPR GCTGGCCAGCAGCAGGTCTG GGG (reversed) Intergenic