ID: 1125946018

View in Genome Browser
Species Human (GRCh38)
Location 15:43712329-43712351
Sequence TAGCTGGCCAGCAGCAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125946018_1125946031 23 Left 1125946018 15:43712329-43712351 CCAGACCTGCTGCTGGCCAGCTA No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946018_1125946033 25 Left 1125946018 15:43712329-43712351 CCAGACCTGCTGCTGGCCAGCTA No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946018_1125946032 24 Left 1125946018 15:43712329-43712351 CCAGACCTGCTGCTGGCCAGCTA No data
Right 1125946032 15:43712376-43712398 GGGGAAGGTTAGCTCGCACTGGG No data
1125946018_1125946025 3 Left 1125946018 15:43712329-43712351 CCAGACCTGCTGCTGGCCAGCTA No data
Right 1125946025 15:43712355-43712377 TCCAGGGCCTGGATCTGAGATGG No data
1125946018_1125946029 9 Left 1125946018 15:43712329-43712351 CCAGACCTGCTGCTGGCCAGCTA No data
Right 1125946029 15:43712361-43712383 GCCTGGATCTGAGATGGGGAAGG No data
1125946018_1125946028 5 Left 1125946018 15:43712329-43712351 CCAGACCTGCTGCTGGCCAGCTA No data
Right 1125946028 15:43712357-43712379 CAGGGCCTGGATCTGAGATGGGG No data
1125946018_1125946027 4 Left 1125946018 15:43712329-43712351 CCAGACCTGCTGCTGGCCAGCTA No data
Right 1125946027 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG No data
1125946018_1125946022 -8 Left 1125946018 15:43712329-43712351 CCAGACCTGCTGCTGGCCAGCTA No data
Right 1125946022 15:43712344-43712366 GCCAGCTATCCTCCAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125946018 Original CRISPR TAGCTGGCCAGCAGCAGGTC TGG (reversed) Intergenic