ID: 1125946023

View in Genome Browser
Species Human (GRCh38)
Location 15:43712345-43712367
Sequence TCCAGGCCCTGGAGGATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125946023_1125946029 -7 Left 1125946023 15:43712345-43712367 CCAGCTATCCTCCAGGGCCTGGA No data
Right 1125946029 15:43712361-43712383 GCCTGGATCTGAGATGGGGAAGG No data
1125946023_1125946033 9 Left 1125946023 15:43712345-43712367 CCAGCTATCCTCCAGGGCCTGGA No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946023_1125946034 19 Left 1125946023 15:43712345-43712367 CCAGCTATCCTCCAGGGCCTGGA No data
Right 1125946034 15:43712387-43712409 GCTCGCACTGGGGTCACTATAGG No data
1125946023_1125946035 20 Left 1125946023 15:43712345-43712367 CCAGCTATCCTCCAGGGCCTGGA No data
Right 1125946035 15:43712388-43712410 CTCGCACTGGGGTCACTATAGGG No data
1125946023_1125946036 30 Left 1125946023 15:43712345-43712367 CCAGCTATCCTCCAGGGCCTGGA No data
Right 1125946036 15:43712398-43712420 GGTCACTATAGGGTTCTTGCAGG No data
1125946023_1125946032 8 Left 1125946023 15:43712345-43712367 CCAGCTATCCTCCAGGGCCTGGA No data
Right 1125946032 15:43712376-43712398 GGGGAAGGTTAGCTCGCACTGGG No data
1125946023_1125946031 7 Left 1125946023 15:43712345-43712367 CCAGCTATCCTCCAGGGCCTGGA No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125946023 Original CRISPR TCCAGGCCCTGGAGGATAGC TGG (reversed) Intergenic