ID: 1125946026

View in Genome Browser
Species Human (GRCh38)
Location 15:43712356-43712378
Sequence CCCATCTCAGATCCAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 2, 1: 0, 2: 3, 3: 36, 4: 333}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125946026_1125946032 -3 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG 0: 2
1: 0
2: 3
3: 36
4: 333
Right 1125946032 15:43712376-43712398 GGGGAAGGTTAGCTCGCACTGGG No data
1125946026_1125946034 8 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG 0: 2
1: 0
2: 3
3: 36
4: 333
Right 1125946034 15:43712387-43712409 GCTCGCACTGGGGTCACTATAGG No data
1125946026_1125946038 23 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG 0: 2
1: 0
2: 3
3: 36
4: 333
Right 1125946038 15:43712402-43712424 ACTATAGGGTTCTTGCAGGGAGG No data
1125946026_1125946035 9 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG 0: 2
1: 0
2: 3
3: 36
4: 333
Right 1125946035 15:43712388-43712410 CTCGCACTGGGGTCACTATAGGG No data
1125946026_1125946033 -2 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG 0: 2
1: 0
2: 3
3: 36
4: 333
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946026_1125946039 24 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG 0: 2
1: 0
2: 3
3: 36
4: 333
Right 1125946039 15:43712403-43712425 CTATAGGGTTCTTGCAGGGAGGG No data
1125946026_1125946040 25 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG 0: 2
1: 0
2: 3
3: 36
4: 333
Right 1125946040 15:43712404-43712426 TATAGGGTTCTTGCAGGGAGGGG No data
1125946026_1125946036 19 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG 0: 2
1: 0
2: 3
3: 36
4: 333
Right 1125946036 15:43712398-43712420 GGTCACTATAGGGTTCTTGCAGG No data
1125946026_1125946037 20 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG 0: 2
1: 0
2: 3
3: 36
4: 333
Right 1125946037 15:43712399-43712421 GTCACTATAGGGTTCTTGCAGGG No data
1125946026_1125946031 -4 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG 0: 2
1: 0
2: 3
3: 36
4: 333
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125946026 Original CRISPR CCCATCTCAGATCCAGGCCC TGG (reversed) Intergenic