ID: 1125946030

View in Genome Browser
Species Human (GRCh38)
Location 15:43712362-43712384
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125946030_1125946035 3 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946035 15:43712388-43712410 CTCGCACTGGGGTCACTATAGGG No data
1125946030_1125946036 13 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946036 15:43712398-43712420 GGTCACTATAGGGTTCTTGCAGG No data
1125946030_1125946037 14 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946037 15:43712399-43712421 GTCACTATAGGGTTCTTGCAGGG No data
1125946030_1125946038 17 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946038 15:43712402-43712424 ACTATAGGGTTCTTGCAGGGAGG No data
1125946030_1125946040 19 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946040 15:43712404-43712426 TATAGGGTTCTTGCAGGGAGGGG No data
1125946030_1125946033 -8 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946030_1125946031 -10 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946030_1125946039 18 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946039 15:43712403-43712425 CTATAGGGTTCTTGCAGGGAGGG No data
1125946030_1125946034 2 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946034 15:43712387-43712409 GCTCGCACTGGGGTCACTATAGG No data
1125946030_1125946032 -9 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946032 15:43712376-43712398 GGGGAAGGTTAGCTCGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125946030 Original CRISPR ACCTTCCCCATCTCAGATCC AGG (reversed) Intergenic