ID: 1125946031

View in Genome Browser
Species Human (GRCh38)
Location 15:43712375-43712397
Sequence TGGGGAAGGTTAGCTCGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125946017_1125946031 24 Left 1125946017 15:43712328-43712350 CCCAGACCTGCTGCTGGCCAGCT No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946023_1125946031 7 Left 1125946023 15:43712345-43712367 CCAGCTATCCTCCAGGGCCTGGA No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946026_1125946031 -4 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946014_1125946031 30 Left 1125946014 15:43712322-43712344 CCTGGCCCCAGACCTGCTGCTGG No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946024_1125946031 -1 Left 1125946024 15:43712353-43712375 CCTCCAGGGCCTGGATCTGAGAT No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946030_1125946031 -10 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946016_1125946031 25 Left 1125946016 15:43712327-43712349 CCCCAGACCTGCTGCTGGCCAGC No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946019_1125946031 18 Left 1125946019 15:43712334-43712356 CCTGCTGCTGGCCAGCTATCCTC No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data
1125946018_1125946031 23 Left 1125946018 15:43712329-43712351 CCAGACCTGCTGCTGGCCAGCTA No data
Right 1125946031 15:43712375-43712397 TGGGGAAGGTTAGCTCGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125946031 Original CRISPR TGGGGAAGGTTAGCTCGCAC TGG Intergenic