ID: 1125946033

View in Genome Browser
Species Human (GRCh38)
Location 15:43712377-43712399
Sequence GGGAAGGTTAGCTCGCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125946016_1125946033 27 Left 1125946016 15:43712327-43712349 CCCCAGACCTGCTGCTGGCCAGC No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946024_1125946033 1 Left 1125946024 15:43712353-43712375 CCTCCAGGGCCTGGATCTGAGAT No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946026_1125946033 -2 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946017_1125946033 26 Left 1125946017 15:43712328-43712350 CCCAGACCTGCTGCTGGCCAGCT No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946030_1125946033 -8 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946019_1125946033 20 Left 1125946019 15:43712334-43712356 CCTGCTGCTGGCCAGCTATCCTC No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946018_1125946033 25 Left 1125946018 15:43712329-43712351 CCAGACCTGCTGCTGGCCAGCTA No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data
1125946023_1125946033 9 Left 1125946023 15:43712345-43712367 CCAGCTATCCTCCAGGGCCTGGA No data
Right 1125946033 15:43712377-43712399 GGGAAGGTTAGCTCGCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125946033 Original CRISPR GGGAAGGTTAGCTCGCACTG GGG Intergenic