ID: 1125946035 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:43712388-43712410 |
| Sequence | CTCGCACTGGGGTCACTATA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1125946026_1125946035 | 9 | Left | 1125946026 | 15:43712356-43712378 | CCAGGGCCTGGATCTGAGATGGG | 0: 2 1: 0 2: 3 3: 36 4: 333 |
||
| Right | 1125946035 | 15:43712388-43712410 | CTCGCACTGGGGTCACTATAGGG | No data | ||||
| 1125946023_1125946035 | 20 | Left | 1125946023 | 15:43712345-43712367 | CCAGCTATCCTCCAGGGCCTGGA | No data | ||
| Right | 1125946035 | 15:43712388-43712410 | CTCGCACTGGGGTCACTATAGGG | No data | ||||
| 1125946024_1125946035 | 12 | Left | 1125946024 | 15:43712353-43712375 | CCTCCAGGGCCTGGATCTGAGAT | No data | ||
| Right | 1125946035 | 15:43712388-43712410 | CTCGCACTGGGGTCACTATAGGG | No data | ||||
| 1125946030_1125946035 | 3 | Left | 1125946030 | 15:43712362-43712384 | CCTGGATCTGAGATGGGGAAGGT | No data | ||
| Right | 1125946035 | 15:43712388-43712410 | CTCGCACTGGGGTCACTATAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1125946035 | Original CRISPR | CTCGCACTGGGGTCACTATA GGG | Intergenic | ||