ID: 1125946035

View in Genome Browser
Species Human (GRCh38)
Location 15:43712388-43712410
Sequence CTCGCACTGGGGTCACTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125946030_1125946035 3 Left 1125946030 15:43712362-43712384 CCTGGATCTGAGATGGGGAAGGT No data
Right 1125946035 15:43712388-43712410 CTCGCACTGGGGTCACTATAGGG No data
1125946026_1125946035 9 Left 1125946026 15:43712356-43712378 CCAGGGCCTGGATCTGAGATGGG No data
Right 1125946035 15:43712388-43712410 CTCGCACTGGGGTCACTATAGGG No data
1125946023_1125946035 20 Left 1125946023 15:43712345-43712367 CCAGCTATCCTCCAGGGCCTGGA No data
Right 1125946035 15:43712388-43712410 CTCGCACTGGGGTCACTATAGGG No data
1125946024_1125946035 12 Left 1125946024 15:43712353-43712375 CCTCCAGGGCCTGGATCTGAGAT No data
Right 1125946035 15:43712388-43712410 CTCGCACTGGGGTCACTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125946035 Original CRISPR CTCGCACTGGGGTCACTATA GGG Intergenic