ID: 1125946037 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:43712399-43712421 |
Sequence | GTCACTATAGGGTTCTTGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1125946026_1125946037 | 20 | Left | 1125946026 | 15:43712356-43712378 | CCAGGGCCTGGATCTGAGATGGG | 0: 2 1: 0 2: 3 3: 36 4: 333 |
||
Right | 1125946037 | 15:43712399-43712421 | GTCACTATAGGGTTCTTGCAGGG | No data | ||||
1125946030_1125946037 | 14 | Left | 1125946030 | 15:43712362-43712384 | CCTGGATCTGAGATGGGGAAGGT | No data | ||
Right | 1125946037 | 15:43712399-43712421 | GTCACTATAGGGTTCTTGCAGGG | No data | ||||
1125946024_1125946037 | 23 | Left | 1125946024 | 15:43712353-43712375 | CCTCCAGGGCCTGGATCTGAGAT | No data | ||
Right | 1125946037 | 15:43712399-43712421 | GTCACTATAGGGTTCTTGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1125946037 | Original CRISPR | GTCACTATAGGGTTCTTGCA GGG | Intergenic | ||