ID: 1125946975

View in Genome Browser
Species Human (GRCh38)
Location 15:43717675-43717697
Sequence AGGAAGAAGAAATGTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125946966_1125946975 2 Left 1125946966 15:43717650-43717672 CCTTCCCCCATTCTCCCAGGCTC No data
Right 1125946975 15:43717675-43717697 AGGAAGAAGAAATGTTGGCCAGG No data
1125946970_1125946975 -4 Left 1125946970 15:43717656-43717678 CCCATTCTCCCAGGCTCAAAGGA No data
Right 1125946975 15:43717675-43717697 AGGAAGAAGAAATGTTGGCCAGG No data
1125946968_1125946975 -3 Left 1125946968 15:43717655-43717677 CCCCATTCTCCCAGGCTCAAAGG No data
Right 1125946975 15:43717675-43717697 AGGAAGAAGAAATGTTGGCCAGG No data
1125946964_1125946975 11 Left 1125946964 15:43717641-43717663 CCTACTGGTCCTTCCCCCATTCT No data
Right 1125946975 15:43717675-43717697 AGGAAGAAGAAATGTTGGCCAGG No data
1125946967_1125946975 -2 Left 1125946967 15:43717654-43717676 CCCCCATTCTCCCAGGCTCAAAG No data
Right 1125946975 15:43717675-43717697 AGGAAGAAGAAATGTTGGCCAGG No data
1125946971_1125946975 -5 Left 1125946971 15:43717657-43717679 CCATTCTCCCAGGCTCAAAGGAA No data
Right 1125946975 15:43717675-43717697 AGGAAGAAGAAATGTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125946975 Original CRISPR AGGAAGAAGAAATGTTGGCC AGG Intergenic
No off target data available for this crispr