ID: 1125947106

View in Genome Browser
Species Human (GRCh38)
Location 15:43718463-43718485
Sequence TAGGAGCCAGTGATGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125947101_1125947106 9 Left 1125947101 15:43718431-43718453 CCCTCAGAGAAACCCAAGGAGAT No data
Right 1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG No data
1125947104_1125947106 -4 Left 1125947104 15:43718444-43718466 CCAAGGAGATTGCTTGAGTTAGG No data
Right 1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG No data
1125947102_1125947106 8 Left 1125947102 15:43718432-43718454 CCTCAGAGAAACCCAAGGAGATT No data
Right 1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG No data
1125947098_1125947106 17 Left 1125947098 15:43718423-43718445 CCAGGGGCCCCTCAGAGAAACCC No data
Right 1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG No data
1125947100_1125947106 10 Left 1125947100 15:43718430-43718452 CCCCTCAGAGAAACCCAAGGAGA No data
Right 1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG No data
1125947103_1125947106 -3 Left 1125947103 15:43718443-43718465 CCCAAGGAGATTGCTTGAGTTAG No data
Right 1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG No data
1125947097_1125947106 18 Left 1125947097 15:43718422-43718444 CCCAGGGGCCCCTCAGAGAAACC No data
Right 1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125947106 Original CRISPR TAGGAGCCAGTGATGCAGAA AGG Intergenic
No off target data available for this crispr