ID: 1125949479

View in Genome Browser
Species Human (GRCh38)
Location 15:43739703-43739725
Sequence CTAGTCCTGCGGATCACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125949479_1125949483 -5 Left 1125949479 15:43739703-43739725 CCTCAAGTGATCCGCAGGACTAG No data
Right 1125949483 15:43739721-43739743 ACTAGGCCTCCCAAATTGCTGGG No data
1125949479_1125949482 -6 Left 1125949479 15:43739703-43739725 CCTCAAGTGATCCGCAGGACTAG No data
Right 1125949482 15:43739720-43739742 GACTAGGCCTCCCAAATTGCTGG No data
1125949479_1125949485 3 Left 1125949479 15:43739703-43739725 CCTCAAGTGATCCGCAGGACTAG No data
Right 1125949485 15:43739729-43739751 TCCCAAATTGCTGGGATTACAGG 0: 3416
1: 307926
2: 320568
3: 295094
4: 302739

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125949479 Original CRISPR CTAGTCCTGCGGATCACTTG AGG (reversed) Intergenic
No off target data available for this crispr