ID: 1125952023

View in Genome Browser
Species Human (GRCh38)
Location 15:43760333-43760355
Sequence GTGAGCAATGATCATGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1133
Summary {0: 1, 1: 4, 2: 55, 3: 268, 4: 805}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125952022_1125952023 -3 Left 1125952022 15:43760313-43760335 CCTGGGAGGTCGAGGCTGCAGTG 0: 1481
1: 12235
2: 68564
3: 191636
4: 253953
Right 1125952023 15:43760333-43760355 GTGAGCAATGATCATGCCGCTGG 0: 1
1: 4
2: 55
3: 268
4: 805
1125952021_1125952023 -2 Left 1125952021 15:43760312-43760334 CCCTGGGAGGTCGAGGCTGCAGT 0: 45
1: 461
2: 1885
3: 3331
4: 4635
Right 1125952023 15:43760333-43760355 GTGAGCAATGATCATGCCGCTGG 0: 1
1: 4
2: 55
3: 268
4: 805

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125952023 Original CRISPR GTGAGCAATGATCATGCCGC TGG Intronic
900273418 1:1806916-1806938 GTGAGCCACAATCATGCCACTGG + Intronic
900976960 1:6023826-6023848 GTGAGTTATGATCATGCCACTGG - Intronic
901104698 1:6746072-6746094 GTGAGCTATGATCACGCAACTGG + Intergenic
901359928 1:8688670-8688692 GGGAGCTATGATCGTGCCACTGG + Intronic
901362636 1:8715845-8715867 GTGAGCCATGATCATGCCACTGG + Intronic
901596234 1:10387383-10387405 GTGAGCTATGATGGTGCCACTGG + Intergenic
901729922 1:11272234-11272256 GTGAGCCAAGATCATGCCAATGG - Intergenic
901739451 1:11332731-11332753 GTGAGCCATGATCAGGCCATTGG + Intergenic
901749889 1:11399597-11399619 GTGAGCCAAGATCATGCCACTGG - Intergenic
902174652 1:14639970-14639992 CTGAGCCACCATCATGCCGCAGG - Intronic
902387547 1:16084371-16084393 GTGAGCTATGATTGTGCCACTGG - Intergenic
902425045 1:16314007-16314029 GTGAGCCAAGATCACGCCACTGG - Intronic
902751618 1:18516480-18516502 GTGAGCCAAGATCATGCCAGTGG + Intergenic
903087627 1:20876922-20876944 GTGAGCTATGATCATGCTACTGG + Intronic
903104697 1:21066102-21066124 GTGAGCCATGATCATACCACTGG + Intronic
903114706 1:21169113-21169135 GTGAGCCATGACCATGCCCTGGG + Intronic
903385885 1:22926132-22926154 GTGAGCCAAGATCGTGCCGCTGG - Intergenic
903412485 1:23157274-23157296 GTGAGCTGTGATCATGCCACTGG + Intronic
903555810 1:24192459-24192481 GTGAGCCAAGATCATGCCACTGG + Intergenic
903752145 1:25631018-25631040 GTGAGCCAAGATCGTGCCACTGG - Intronic
903842880 1:26256984-26257006 GTGAGCCAAGATCATGCCACTGG - Intronic
904144089 1:28376365-28376387 GTGAGCCCTGATCATGTCACTGG - Intronic
904526606 1:31138435-31138457 GTGAGCCGCGATCATGCCACTGG - Intergenic
904649417 1:31993510-31993532 GTGAGCTATGATCATGCCACTGG - Intergenic
904832716 1:33315487-33315509 GTAAGCTATGATCATGCCACTGG + Intronic
904865595 1:33576533-33576555 GTGAGCTGAGATCATGCCACTGG + Intronic
904979592 1:34486509-34486531 GTGAGCCATGAACCTGCCACTGG - Intergenic
905000663 1:34666074-34666096 GTGAGCAGTGTTCATGCACCTGG + Intergenic
905147371 1:35897671-35897693 GTGAGCTGTGATTGTGCCGCTGG + Intronic
905364011 1:37439049-37439071 GTGAGCAATGAACAGGCCCCAGG + Intergenic
905552457 1:38854121-38854143 GTGAGCCAAGATCGTGCCACTGG - Intronic
905805590 1:40874651-40874673 GTGAGCCAAGATCATGCCACTGG + Intergenic
906108667 1:43309233-43309255 GTGAGCAATGGTCAGGCCAATGG - Intronic
906193792 1:43916061-43916083 GTGAGCTGAGATCATGCCACTGG + Intronic
906349425 1:45044943-45044965 GTGAGCCGAGATCATGCCACTGG + Intronic
906359789 1:45144478-45144500 GTGAGCTATGATCGTGCTACTGG + Intronic
906443563 1:45873247-45873269 GTGAGCCAAGATCATGCTACTGG - Intronic
907126241 1:52053606-52053628 GTGAGCCAAGATCATGCCACTGG + Intronic
907210899 1:52820643-52820665 GTGAGCCATGATCACACCACTGG + Intronic
908220856 1:62004809-62004831 GTCAGCAATGATCATATCGCTGG - Intronic
908462602 1:64359887-64359909 GTGAGCCAAGATCATGCCATTGG + Intergenic
908762655 1:67526279-67526301 GTGAGCTAAGATCATGCCACTGG + Intergenic
909646025 1:77918608-77918630 GTGAGCCAAGATCATGCCACTGG + Intronic
909783029 1:79573063-79573085 GTGAGCTATGATCACACCACTGG + Intergenic
910138863 1:84003647-84003669 GTGAGCCTTGATCACGCCACTGG + Intergenic
910578307 1:88792345-88792367 GTGAGCCAAGATCGTGCCACTGG + Intronic
911363070 1:96903391-96903413 GTGAGCCAAGATCATGCTACTGG - Intergenic
911397842 1:97334422-97334444 TTGAACAATGACCATGCAGCAGG - Intronic
911484165 1:98484707-98484729 GTGAGCCCAGATCATGCCACTGG - Intergenic
911948904 1:104147238-104147260 GTGAGCGGAGATCATGCCACTGG + Intergenic
912205119 1:107500288-107500310 GTCAGCTATGATCATGCCACTGG + Intergenic
912388803 1:109287351-109287373 GTGAGCCAAGATCGTGCCACTGG - Intergenic
912830214 1:112945933-112945955 GTGAGCCAAGATCATGCCATTGG + Intronic
912918494 1:113842152-113842174 GTGAGCCATGATGGTGCCACTGG + Intronic
912924491 1:113902093-113902115 GTGAGCTATGATCGGGCCACTGG - Intronic
913500722 1:119470393-119470415 GTGAGCAGAGATCATGCCTCTGG - Intergenic
914352361 1:146851693-146851715 GTGAGCTGAGATCATGCCACTGG - Intergenic
914502453 1:148259150-148259172 GTGAGCCAAGATCATGCCACTGG + Intergenic
914790043 1:150869599-150869621 GTGAGCCATGATCATGCCACTGG - Intronic
915133033 1:153709458-153709480 GCGAGCTATGATTATGCCACTGG - Intergenic
915219571 1:154363677-154363699 GTGAGCCAAGATCACGCCACTGG + Intergenic
915336452 1:155145466-155145488 GTGAGCCGAGATCATGCCACTGG + Intergenic
915389146 1:155525189-155525211 GTGAGCCATGTTCATGCCACTGG + Intronic
915426534 1:155831826-155831848 GTGAGCTATGATCGTACCACTGG + Intronic
915549214 1:156622976-156622998 GTGAGCCATGATCATGCCACGGG + Intronic
916462294 1:165038777-165038799 GTGAGCCGAGATCATGCCACTGG - Intergenic
917818608 1:178737300-178737322 GTGAGCCAAGATCATGCCACCGG - Intronic
917818665 1:178737831-178737853 GTGAGCTGTGATCATGCCATTGG - Intronic
917991158 1:180380203-180380225 GTGAGCCATTATCATGCTACTGG + Intronic
918413227 1:184282252-184282274 GTGAGCCAAGATCACGCCACTGG + Intergenic
919566721 1:199198302-199198324 GTGAGCCAAGATCACGCCACAGG + Intergenic
919769113 1:201145904-201145926 GTGAGCTGTGATCGTGCCACTGG + Intronic
920183055 1:204144288-204144310 GTGAGCTGAGATCATGCCACTGG + Intronic
920899940 1:210098734-210098756 GTGAGCCAAGATCATGCCAGTGG - Intronic
920956318 1:210623125-210623147 GTGAGCCATGATCACACCACAGG - Intronic
921033265 1:211352568-211352590 GTGAGCCATGATCACACCACTGG + Intronic
921205008 1:212841212-212841234 GTGAGCCAAGATCATGCCCCTGG - Intronic
921473465 1:215576518-215576540 GTGAGTTATGATCATGCCTCTGG + Intronic
921644943 1:217603676-217603698 GTGAGCGGAGATCATGCCACTGG - Intronic
921754737 1:218841787-218841809 GTGAGCCAAGATCATGCCATTGG + Intergenic
921862020 1:220050319-220050341 GTGAGCTATAATCGTGCCACTGG - Intergenic
921868853 1:220115502-220115524 GTGAGCCAAGATCGTGCCACTGG + Intronic
922037178 1:221860295-221860317 GTGAGCCAAGATCATGCCAGGGG + Intergenic
922450121 1:225730349-225730371 GTGAGCCATGATCATGCCACTGG + Intergenic
922539731 1:226409679-226409701 GTGAGCCATGATAGTGCCACTGG + Intergenic
922842844 1:228658222-228658244 GTGAGCCATGATCAGGCTACAGG + Intergenic
923178704 1:231495294-231495316 GTGAACTAGGATCATGCCACTGG + Intergenic
923394791 1:233551103-233551125 GTGAGCCAAGATCGTGCCACCGG + Intergenic
923514771 1:234686553-234686575 GTGAGCCGAGATCATGCCGCTGG - Intergenic
923585866 1:235270225-235270247 GTGAGCCGAGATCATGCCACTGG + Intronic
923609454 1:235476967-235476989 GTGAGCTATGATCATGCCACTGG + Intronic
923612487 1:235507060-235507082 GTGAGCTATGATCACACCACAGG + Intergenic
923767986 1:236910718-236910740 GTGAGCAGAGATCATGCCACTGG - Intergenic
923842083 1:237683981-237684003 GTGAGCCGAGATCATGCCACTGG - Intronic
923992193 1:239451166-239451188 GTGGGCTATGATCATGCCACTGG + Intronic
923998756 1:239527067-239527089 GTGAGCCATGATCACGCCACTGG + Intronic
924066601 1:240229700-240229722 GTGAGCTGAGATCATGCCACTGG - Intronic
924476946 1:244390737-244390759 GTGAGCCATGATCACACCACTGG + Intergenic
924705541 1:246498842-246498864 GTGAGCCATGATCGTGCCACTGG - Intronic
924793593 1:247275555-247275577 GTGAGCTGAGATCATGCCACTGG + Intergenic
924857117 1:247884628-247884650 GTGAGCTGTGATCATGCCACTGG - Intergenic
1063109735 10:3024729-3024751 GTGAGCCAAGATCACGCCACTGG - Intergenic
1063269266 10:4488323-4488345 GTGACCCATGATCACGCCACTGG - Intergenic
1063660537 10:8032907-8032929 GTGAGCCATGATTGTGCCACTGG + Intergenic
1064022202 10:11818290-11818312 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1064025309 10:11844045-11844067 GTGAGCTGTGATCATGCCACTGG - Intronic
1064049523 10:12048259-12048281 GTGAGCTAAGATCGTGCCACTGG - Intergenic
1064070319 10:12223339-12223361 GTGAGCCAAGATCATGCCATTGG - Intronic
1064524555 10:16240427-16240449 GTGAGCCAAGATCACGCCACTGG + Intergenic
1064540389 10:16399001-16399023 GTGAGCCAAGACCATGCCACTGG + Intergenic
1064690145 10:17908622-17908644 GTGAGCCAAGATCACGCCACTGG - Intronic
1065095406 10:22275772-22275794 GTGAGCCAAGATCGTGCCTCTGG + Intergenic
1065208722 10:23381930-23381952 CTGTGCTATGATCATGCCACTGG - Intergenic
1065375270 10:25033346-25033368 GTGAGCTATGATTGTGCCACAGG + Intronic
1065550631 10:26865327-26865349 GTGAGCCAAGATCATGCCACTGG + Intergenic
1065873710 10:29978958-29978980 GTGAGCTGAGATCATGCCACTGG + Intergenic
1065939070 10:30547488-30547510 GTGAGCCATGATTGTGCCACTGG - Intergenic
1066096813 10:32079951-32079973 GTGAGCCAAGATCATGCCACCGG + Intergenic
1066538724 10:36420943-36420965 GTGAGCCAAGATCATGCCACTGG - Intergenic
1066548634 10:36530515-36530537 GTGAGCTGTGATCATGCCGTGGG - Intergenic
1066762348 10:38767550-38767572 GTGAGCCGAGATCATGCCACTGG + Intergenic
1067123329 10:43493633-43493655 GTGAGCCATGATTGTGCCACTGG + Intergenic
1067414004 10:46090383-46090405 GTGAGCCGAGATCATGCCACTGG + Intergenic
1067548976 10:47219980-47220002 GTGAGTCAAGATCATGCCACTGG - Intergenic
1067995959 10:51273466-51273488 GTGAGCCATGATCGCGCCACTGG + Intronic
1068027396 10:51663659-51663681 GTGAGCTATGATCAAGCCACTGG + Intronic
1068456815 10:57266068-57266090 GTGAGCCGAGATCATGCCACTGG - Intergenic
1068532247 10:58202607-58202629 GTGAGCTATGATTATGCCACTGG + Intronic
1069284994 10:66702648-66702670 GTGAGCCGAGATCATGCCACCGG + Intronic
1069346007 10:67470834-67470856 GTGAGCTGTGACCATGCCACTGG - Intronic
1069362130 10:67654539-67654561 GTGAGCTGTGATCACGCCACTGG - Intronic
1069528365 10:69194718-69194740 GTGAGCTATGATTGTGCCACTGG + Intronic
1069847604 10:71383576-71383598 GTGAGCTGAGATCATGCCACTGG + Intergenic
1070038116 10:72747778-72747800 GTGAGCCATGATCATGCCACTGG + Intronic
1070066399 10:73039226-73039248 GTGAGCTATGATCATGCCACTGG + Intronic
1070821510 10:79358210-79358232 GTGAGCCATGATCATGCCACGGG + Intergenic
1070829134 10:79407983-79408005 GGGAACAATGATCATGGAGCAGG + Intronic
1070901743 10:80036009-80036031 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1072279689 10:93854478-93854500 GTGGGCCATGATCATGCCACTGG - Intergenic
1072291152 10:93966131-93966153 CTGAGCCATGGTCATGCCACTGG + Intergenic
1072430023 10:95362659-95362681 GTGAGCAATGATAAGGCGGGAGG - Intronic
1072657621 10:97341319-97341341 GTGAGCCAAGATCATGCCACTGG - Intergenic
1072667538 10:97405195-97405217 GTGAGCCATGATCATGCCACTGG - Intronic
1072698995 10:97626319-97626341 GTGAGCCAAGATCATGCCACTGG + Intronic
1072918842 10:99558480-99558502 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1073134770 10:101214366-101214388 GTGAGTTATGATCATGTCACTGG + Intergenic
1073209378 10:101786821-101786843 GTGAGCCGTGATCTTGCCACTGG - Intronic
1073211411 10:101805897-101805919 GTGAGCCGAGATCATGCCACTGG + Intronic
1074162081 10:110843744-110843766 GTGAGCAAGGATCAGGCCTTCGG - Intergenic
1074505773 10:114069281-114069303 GTGAGCCGAGATCATGCCACTGG - Intergenic
1074573153 10:114643631-114643653 GTGAGCCATGATCTTGCCACTGG - Intronic
1074583673 10:114745503-114745525 GTGAGCCAAGATCACGCCACTGG + Intergenic
1074610626 10:115017622-115017644 GTGAGCCAAGATCATGCCACTGG + Intergenic
1075035844 10:119066451-119066473 GTGAGCCAAGATTATGCCACTGG + Intronic
1075437203 10:122453741-122453763 GTGAGCCATGATCATGCCACTGG + Intergenic
1075525532 10:123181920-123181942 GTAAGCAATGATCACACCACTGG - Intergenic
1075774325 10:124970310-124970332 GTGAGCCATGATCACTCCCCTGG - Intronic
1075776095 10:124989795-124989817 GTGAGCCATGTTCATGTCACTGG - Intronic
1077548612 11:3188968-3188990 GTGAGCCGTGATCATGCCACTGG - Intergenic
1077637266 11:3851836-3851858 GTGAGCCAAGATCACGCCACCGG - Intergenic
1077736982 11:4801596-4801618 GTGAGCAGAGATCATGCCATTGG - Intronic
1077891352 11:6420095-6420117 GAGAGCCATGATCTTGCCCCTGG - Intergenic
1078119027 11:8487364-8487386 GTGAGTTGTGATCATGCCACTGG + Intronic
1078323949 11:10363118-10363140 GTGAGCCAAGATCATGCCACTGG + Intronic
1078626345 11:12962326-12962348 GTGAGCCGTGATCACGCCACTGG + Intergenic
1078815521 11:14817678-14817700 GTGAGCCATGATTGTGCCACTGG + Intronic
1078905817 11:15686879-15686901 GTGAGCCAAGATCATGCCACTGG - Intergenic
1079218197 11:18534002-18534024 GTGAGCCATGATCATGTCACTGG - Intronic
1079500533 11:21096768-21096790 GTGAGCCATGATTGTGCCACTGG - Intronic
1079593673 11:22213956-22213978 GTGAACTATGATCATGCCACTGG - Intronic
1080012789 11:27474721-27474743 GTGAGCCAAGATCACGCCACTGG - Intergenic
1080093840 11:28381044-28381066 GTGAGCTATGAACATGCCACTGG - Intergenic
1080310805 11:30889552-30889574 GTGAGAAATGAACAGGCAGCAGG - Intronic
1080587783 11:33697143-33697165 GTGAGCTATGACCATGCCACTGG - Intergenic
1082020499 11:47528954-47528976 GTGAGCTGTGATCCTGCCACTGG - Intronic
1082696354 11:56369628-56369650 GGGAGCCAAGATCATGCCACTGG + Intergenic
1082841163 11:57691125-57691147 GTGAGCCAAGATCACGCCACTGG - Intronic
1083456379 11:62781617-62781639 GTGAGCCAAGATCGTGCCACTGG + Intronic
1083556236 11:63630738-63630760 GTGAGCCAAGATCATGCCACTGG + Intronic
1083891742 11:65599060-65599082 GTGAGCGGTGATCATGACACTGG - Intronic
1084015291 11:66375829-66375851 GTGAGCTGAGATCATGCCACTGG - Intergenic
1084161007 11:67350209-67350231 CTGAGCACTGATCATGTCTCAGG - Intronic
1085567436 11:77527156-77527178 GTGAGCCGAGATCATGCCACTGG - Intronic
1085628376 11:78091138-78091160 GTGAGCCATGATCATGCCACTGG - Intergenic
1085634105 11:78144683-78144705 GTGAGCCAAGATCTTGCCACTGG + Intergenic
1086663640 11:89452986-89453008 GTGAGTCATGTTCATGCCACTGG + Intronic
1087109241 11:94445363-94445385 GTGAGCCAAGATCATGCCATTGG - Intronic
1087689696 11:101306131-101306153 GTGAGCCAAGATCATGCCACTGG - Intergenic
1087818708 11:102687768-102687790 GTGAGCCGAGATCATGCCACTGG - Intergenic
1088036365 11:105321142-105321164 GTGTGCAATGGTCATTCCTCAGG + Intergenic
1088255107 11:107896202-107896224 GTGAGCCGAGATCATGCCACTGG + Intronic
1089156775 11:116408807-116408829 GTGAGCCATAATTATGCCACTGG - Intergenic
1089236580 11:117032560-117032582 GTGAGCTATGATCATGCCACTGG - Intronic
1089427430 11:118390944-118390966 GTGTGCTATGATCATGCCTGTGG + Intronic
1089481900 11:118812494-118812516 TTGAGCTGTGATCATGCCACTGG + Intergenic
1089530756 11:119127597-119127619 GTGAGCTATGATCATGACACTGG - Intronic
1089548813 11:119253779-119253801 GTGAGCTGTGATCATGCCACTGG + Intronic
1089552428 11:119290729-119290751 GTGAGCCAAGATCGTGCCACTGG - Intronic
1089594474 11:119568461-119568483 ATGGGCAATGATCAAGCTGCAGG - Intergenic
1090205535 11:124881875-124881897 GTGAGCTATGATTGTGCCACTGG + Intergenic
1090645351 11:128762898-128762920 GTGAGCCGAGATCATGCCACTGG + Intronic
1091510839 12:1123938-1123960 GTGAGCTAAGATCATACCCCTGG + Intronic
1091730852 12:2879053-2879075 GTGAGCCAAGGTCATGCCACTGG - Intronic
1091763673 12:3104406-3104428 GTGAGCCATGATCATGCCACCGG - Intronic
1091782317 12:3221709-3221731 GTGAGCTGTGATTATGCCACTGG - Intronic
1092188097 12:6496478-6496500 GTGAGCCGTGATCATGCCACTGG - Intronic
1092447846 12:8574265-8574287 GTGATCCCTGATCATGCCACTGG + Intergenic
1092869433 12:12793258-12793280 GTGAGCTGAGATCATGCCACTGG - Intronic
1092922989 12:13248874-13248896 GTGAGCTATGATCATGACACTGG - Intergenic
1093046756 12:14455120-14455142 GTGAGCCAAGATGGTGCCGCAGG + Intronic
1093237202 12:16625629-16625651 GTGAGCTATGATCAGTCCACTGG - Intergenic
1093470715 12:19498957-19498979 GTGAGCCATGATCACGCCACTGG + Intronic
1094060419 12:26309364-26309386 GTGAGCTAAGATCGTGCCACTGG - Intergenic
1094739224 12:33269591-33269613 CTATGCAATGCTCATGCCGCTGG - Intergenic
1094820136 12:34218294-34218316 GTGAGCCATGATCACGCCATTGG - Intergenic
1095207070 12:39450564-39450586 GTGAGCTGTGATCGTGCCACTGG - Intergenic
1095220499 12:39608110-39608132 GTGAACAGAGATCATGCCACTGG + Intronic
1095691587 12:45095533-45095555 GTGAGCCAAGATCATGCCACTGG + Intergenic
1095702910 12:45208911-45208933 GTGAGCCAGGATCACGCCACTGG - Intergenic
1095754456 12:45748333-45748355 GTGAGCCATGATTGTGCCACTGG + Intronic
1096097389 12:48945082-48945104 GTGAGCTGAGATCATGCCGCTGG + Intronic
1096269483 12:50153333-50153355 GTGAGCCAAGATCATGCCACGGG - Intronic
1096329426 12:50697583-50697605 GTGAGCCATAATCATGCCACTGG - Intronic
1096638904 12:52978708-52978730 GTGAGCCAAGATCATGCCACTGG - Intergenic
1096641633 12:52999257-52999279 GTGAGCTGAGATCATGCCACTGG - Intergenic
1096858357 12:54502940-54502962 GTTAGCCATGATTATGCCACTGG + Intronic
1096949786 12:55455903-55455925 GTGAGCTATGATTGTGCCACTGG + Intergenic
1097117089 12:56705507-56705529 GTGAGCCAAGATCGTGCCACTGG - Intergenic
1097764392 12:63508467-63508489 GTGAGCCATGATCACACCACTGG + Intergenic
1097914251 12:65003378-65003400 GTGAGCAGAGATCGTGCCACTGG + Intergenic
1098045194 12:66393232-66393254 GTGAGCCAAGATCGTGCCACTGG - Intronic
1098254128 12:68599344-68599366 GTGAGCCATGATTATGCCTCTGG - Intergenic
1098449213 12:70600749-70600771 GTGAGCCATGATCACGTCACTGG - Intronic
1098949279 12:76622951-76622973 GTGAGCTATGATCATGCCACTGG - Intergenic
1099172380 12:79380461-79380483 GTGAGCTATGATCATGTAGCAGG - Intronic
1100307798 12:93367184-93367206 GTGAGCCAACATCATGCCACTGG - Intergenic
1100516104 12:95329472-95329494 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1100604876 12:96143431-96143453 GTGCACTATGATCATGCCACCGG + Intergenic
1100823317 12:98452283-98452305 GTGAGCCAAGATCATACCACTGG - Intergenic
1101658015 12:106741223-106741245 GTGAGCCAAGATCACGCCACTGG + Intronic
1102080911 12:110097447-110097469 GTGAGCTATGATCACCCCTCAGG - Intergenic
1102090628 12:110184292-110184314 GTGAGCCGAGATCATGCCACTGG + Intronic
1102274419 12:111569658-111569680 GTGAGCCAGGATCATGCCACTGG + Intronic
1102491854 12:113294138-113294160 GTGAGCTATGATCACGCCACTGG - Intronic
1102872789 12:116427027-116427049 GTGAGCTATGATCATGCCACAGG + Intergenic
1102892711 12:116572978-116573000 GTGAGCCAAGATCGTGCCACTGG - Intergenic
1103146664 12:118600959-118600981 GTGAGCCAAGATCATGCCACTGG - Intergenic
1103454539 12:121054511-121054533 GTGAGCCATGATCACCCCACTGG + Intergenic
1103533212 12:121616957-121616979 GTGAGCCATAATCGTGCCTCTGG + Intergenic
1103652753 12:122445650-122445672 GTGAGCCATGATTGTGCCACTGG + Intergenic
1103889110 12:124225213-124225235 GTGTGCGATGAGCATGCTGCAGG + Intronic
1104154328 12:126116699-126116721 GTGAACCAAGATCATGCCACTGG - Intergenic
1104260688 12:127179644-127179666 GTGAGCAATAATTGTGCCACTGG - Intergenic
1104703688 12:130926638-130926660 GTGAGCCAAGATCGTGCCACTGG - Intergenic
1105056319 12:133102691-133102713 GTGAGCCAAGATCGTGCCACTGG + Intronic
1105371868 13:19809281-19809303 GTGAGCTGAGATCATGCCACTGG - Intergenic
1105803053 13:23926638-23926660 GTGAGCCGAGATCATGCCACTGG + Intergenic
1105917317 13:24928484-24928506 GTGAGCCAAGATCACGCCACTGG - Intergenic
1106130478 13:26935325-26935347 GTGAGCCAAGATTATGCTGCTGG + Intergenic
1106520329 13:30491605-30491627 GCGAGCCATGATGATGCCACTGG + Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106738335 13:32611561-32611583 GTGAGCCAAGATCATGCCACTGG - Intronic
1106821038 13:33464791-33464813 GTGAGCTAAGATCATGCCATGGG + Intergenic
1107172779 13:37362929-37362951 GTGAGCTATGATCATGCCACTGG - Intergenic
1107578217 13:41750375-41750397 GTGAGCCGAGATCATGCCACTGG + Intronic
1107700576 13:43043160-43043182 GTGAGCCAAGATCATACCACTGG - Intronic
1107842501 13:44473437-44473459 GTGAACCAAGATCATGCCACTGG + Intronic
1108032247 13:46244712-46244734 GTGAGCTATGATTGTGCCACTGG + Intronic
1109135252 13:58641382-58641404 GTGAGCTATGATCATGCCACTGG - Intergenic
1109174819 13:59142579-59142601 GTGAGCTATGATCATGCCATTGG - Intergenic
1109984671 13:69964097-69964119 GTGAGCTATGATTGTGCCACTGG - Intronic
1110869047 13:80429153-80429175 GTGAGCTCTGATCTTGCCACTGG + Intergenic
1110906901 13:80901261-80901283 GTGAGGTATGATCATGCATCTGG + Intergenic
1111710463 13:91806089-91806111 GTGAGCAGAGATCATGCCACTGG - Intronic
1111877755 13:93918039-93918061 GTGAGCTGAGATCATGCCACTGG + Intronic
1112090048 13:96073587-96073609 GTGAGCTATGATCATGCCACTGG - Intergenic
1112389896 13:98973650-98973672 GTGAGCAGAGATCACGCCACTGG - Intronic
1112419598 13:99235910-99235932 GTGAGCTGTGATCATGCTGCTGG + Intronic
1112795277 13:103050091-103050113 GTGAGCTATGATTGTGCCACTGG + Intronic
1112933950 13:104776335-104776357 GTGAGCCATGATTGTGCCACTGG - Intergenic
1113603107 13:111585329-111585351 GTGAGCCATAATCATGCCACTGG - Intergenic
1113831818 13:113301565-113301587 GTGAGCGAAGATCATGCTACTGG + Intronic
1114070609 14:19102642-19102664 GTGAGCCAAGATCATGCCATTGG + Intergenic
1114091652 14:19297363-19297385 GTGAGCCAAGATCATGCCATTGG - Intergenic
1114274194 14:21127049-21127071 GTGAGCTATGATCACACCACTGG + Intergenic
1114303168 14:21396360-21396382 GTGAGCTGAGATCATGCCACTGG - Intronic
1114457753 14:22867715-22867737 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1114822884 14:26042848-26042870 GTGAGCCGTGATTATGCCTCTGG - Intergenic
1115218052 14:31032013-31032035 GTGAGCTATGATCACACCACTGG + Intronic
1115255580 14:31397712-31397734 GTGAGCTATGGTCATGCCACTGG - Intronic
1115539878 14:34410463-34410485 GTGAGCTGAGATCATGCCACTGG + Intronic
1115602266 14:34966897-34966919 GTGAGCCAAGATCTTGCCACTGG - Intergenic
1115616043 14:35095793-35095815 GTGAGCCGAGATCATGCCACTGG + Intronic
1115659021 14:35472940-35472962 GTGAGCTGTGATCATGCCACAGG + Intergenic
1115662916 14:35514801-35514823 GTGAGCTATGATAATGCCACGGG + Intergenic
1115795172 14:36927112-36927134 GTGAGCAGAGATCAAGCCACTGG + Intronic
1115997766 14:39211714-39211736 GTGAGCCATGATCATGCCACTGG + Intergenic
1116141803 14:41005405-41005427 GTGAGCCGAGATCATGCCACTGG + Intergenic
1116440517 14:44946610-44946632 GTGAGCCAAGATCATGCCCCTGG - Intronic
1116669805 14:47826940-47826962 CTGAGCCATGATCATGCCACTGG - Intergenic
1116817934 14:49599980-49600002 GTGAGCCATGATGCTGCTGCCGG - Intronic
1116826755 14:49680293-49680315 GTGAGCTGTGATCATGCCACTGG + Intronic
1116878809 14:50143267-50143289 GTGGGCTATGATCATGCCACTGG + Intronic
1116891627 14:50274221-50274243 GTGAGCCATGATCATGCCACTGG + Intronic
1117139656 14:52775825-52775847 GTGAGCTATGATCACACCACTGG + Exonic
1117375536 14:55115317-55115339 GTGAGCCAAGATCACGCCACTGG + Intergenic
1117393079 14:55281196-55281218 GTGAGCTATGATCGTGCCACTGG + Intronic
1117586783 14:57215174-57215196 GTGAGCCAAGATCGTGCCACTGG + Intronic
1117692048 14:58317676-58317698 GTGAGCCATGATTGTGCCACTGG - Intronic
1117854701 14:60016259-60016281 GTGAGCTATGATCATGCCACTGG - Intronic
1118632758 14:67721308-67721330 GTGAGCTAGGATCGTGCCTCTGG - Intronic
1118847787 14:69560921-69560943 GTGAGCCAAGATCACGCCACTGG + Intergenic
1119052234 14:71381106-71381128 GTGAGCCAAGATCACGCCACTGG - Intronic
1119399481 14:74352604-74352626 GTGAGCTATGATCACGCCACCGG - Intronic
1119828217 14:77676050-77676072 GTGAGCCATGATCACACCACTGG - Intronic
1119979494 14:79063337-79063359 GTGAGCCAAGATCATGCCATTGG - Intronic
1120254124 14:82096641-82096663 GTGAGCCGAGATCATGCCACCGG - Intergenic
1120335912 14:83154853-83154875 GTGAGCTATGATTGTGCTGCTGG - Intergenic
1120614420 14:86685475-86685497 GTGAGCTATGATTGTGCCCCTGG - Intergenic
1120803146 14:88715711-88715733 GTGAGCCGAGATCATGCCACTGG - Intronic
1122109801 14:99490870-99490892 GTGAGCCGAGATCATGCCACTGG + Intronic
1122213807 14:100190372-100190394 GTGAGCAATGATGATGCCGCAGG - Intergenic
1122559941 14:102605979-102606001 GTGAGCCGAGATCATGCCACTGG - Intronic
1122739441 14:103863064-103863086 GTGAGCCAAGATCATGCCACTGG + Intergenic
1122950431 14:105041641-105041663 GTGAGCCATGATCACACCACTGG - Intergenic
1123815266 15:23971584-23971606 GTGAGCTGAGATCATGCCACTGG + Intergenic
1124086345 15:26553928-26553950 GTGAGCTATGGTCACGCCACTGG - Intronic
1124419841 15:29511382-29511404 GTGAGCTAAGATCACGCCACTGG - Intronic
1124454554 15:29828787-29828809 GTGAGCAGAGATCAAGCCACTGG - Intronic
1124921209 15:34028507-34028529 GTGAGCTATCATCATGCCATGGG + Intronic
1125563948 15:40660905-40660927 GTGAGCCAGGATCATGCCACTGG + Intronic
1125620685 15:41059005-41059027 GTGAGCCATGTTCACGCTGCTGG - Intronic
1125669351 15:41459014-41459036 GTGAGCCAAGATTATGCCACTGG + Intronic
1125871673 15:43107662-43107684 GTGAGCCAAGATCATGCCACTGG + Intronic
1125950980 15:43751074-43751096 GTGAGCTGAGATCATGCCACTGG + Intronic
1125952023 15:43760333-43760355 GTGAGCAATGATCATGCCGCTGG + Intronic
1125981024 15:44001660-44001682 GTGAGCTGTGTTCATGCCACTGG - Intronic
1126619716 15:50625462-50625484 GTGAGCTATGATTGTGCCACTGG - Intronic
1126785020 15:52171036-52171058 GTGAGCCATGATCACGCTACTGG + Intronic
1127121800 15:55778339-55778361 GTGAGCTGTGATCCTGCCACTGG - Intergenic
1127237013 15:57064738-57064760 GTGAGCCAAGATCATGCCACTGG + Intronic
1127527661 15:59809744-59809766 GTGAGCTATGATTGTGCCACTGG - Intergenic
1127600431 15:60530345-60530367 GTGAGCTATGATCACACCACTGG - Intronic
1128246717 15:66138001-66138023 GTGAGCTATGATTGTGCCACTGG + Intronic
1128463868 15:67892065-67892087 GTGAGCCAAGATCATGCCACTGG - Intergenic
1128978799 15:72171883-72171905 GTGAGCCAAGATCACGCCACTGG - Intronic
1129041415 15:72689664-72689686 GTGAGCCATGATCATGCCACTGG + Intronic
1129762055 15:78135053-78135075 GTGAGCTGAGATCATGCCCCTGG - Intronic
1130451009 15:84052127-84052149 GTAAGCCATGATCATGCCACTGG + Intergenic
1130627520 15:85530928-85530950 ATGAGCCAAGATCATGCCACTGG - Intronic
1130962874 15:88675740-88675762 ATGAGCCATGATCCTGCCACTGG - Intergenic
1131191094 15:90317508-90317530 GTGAGCCGAGATCGTGCCGCTGG - Intergenic
1131460161 15:92612176-92612198 GTGAGCCATGATCATGCCACTGG + Intergenic
1131944771 15:97608161-97608183 TTCAGCAATTATCCTGCCGCAGG + Intergenic
1132124411 15:99209788-99209810 GTGAGCAAAGATCATGCCACTGG - Intronic
1132177286 15:99725778-99725800 GTGAGCCTGGATCATGCCACAGG + Intronic
1132487231 16:200366-200388 GTGAGCCAAGATCATGCCACTGG + Intronic
1133000376 16:2848023-2848045 GTGAGCCATGATCACACCACTGG + Intergenic
1133174555 16:4004190-4004212 GTGAGCTAAGATCATACCACTGG + Intronic
1133191250 16:4135160-4135182 GTGAGCCAAGATCACGCCACTGG + Intergenic
1133196336 16:4173439-4173461 GTGAGCCATGATCGCGCCACTGG - Intergenic
1133561260 16:6952580-6952602 GTGAGCCATGATCATGCCACTGG + Intronic
1133586916 16:7204588-7204610 GTGAGCTATGATCGTGCCATTGG + Intronic
1133718451 16:8471553-8471575 GTGAGCTGTGATCATGCCACTGG + Intergenic
1134000619 16:10780030-10780052 GTGAGCCAAGATCGTGCCACTGG + Intronic
1134079984 16:11318455-11318477 GTGAGCTATGATCATGCCGCTGG - Intronic
1134244204 16:12527878-12527900 GTGAGCCGAGATCATGCCACTGG - Intronic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1134378806 16:13704694-13704716 GTGAGCCAAGATCATGCCACTGG - Intergenic
1134412124 16:14011814-14011836 GTGAGCCAAGATCATGCCACTGG + Intergenic
1134481082 16:14619711-14619733 GTGAGCTGTGATCACACCGCTGG + Intronic
1134554358 16:15153851-15153873 GTGAGCAAAGACCATGAGGCTGG - Intergenic
1134555844 16:15164096-15164118 GTGAGCTATGATCATGCCTCTGG - Intergenic
1134583165 16:15388838-15388860 GTGAGCAGTGATCATGTCAGAGG + Intergenic
1134611388 16:15611401-15611423 GTGAGCCAAGATCGTGCCACTGG + Intronic
1134667619 16:16030467-16030489 GTGAGCCAAGATCACGCCACTGG + Intronic
1134916426 16:18075807-18075829 GTGAGCTATGATCATGCCTCTGG - Intergenic
1135080996 16:19435444-19435466 GTGAGCCAAGATCACGCCACTGG + Intronic
1135087187 16:19484703-19484725 GTGAGCCGAGATCATGCCACTGG + Intronic
1135314666 16:21434382-21434404 GTGGGCAATGATCATGTCAGAGG + Intronic
1135367589 16:21866662-21866684 GTGGGCAATGATCATGTCAGAGG + Intronic
1135444225 16:22504500-22504522 GTGGGCAATGATCATGTCAGAGG - Intronic
1135556751 16:23443634-23443656 GTGAGCCGAGATCATGCCACTGG + Intronic
1135629877 16:24027823-24027845 GTGAGCTATGATCACGCCACTGG - Intronic
1135851959 16:25971873-25971895 GTGAGCCAAGATCGTGCCACTGG + Intronic
1136036691 16:27545902-27545924 GTGAGCCAAGATCATGCCATTGG - Intronic
1136122038 16:28143690-28143712 GTGAGCCAAGATCATACCACTGG - Intronic
1136193119 16:28630539-28630561 GTGAGCAGTGATCATGTCAGAGG - Intergenic
1136324779 16:29514857-29514879 GTGGGCAATGATCATGTCAGAGG + Intergenic
1136411346 16:30079243-30079265 GTGAGCCAAGATCAGGCCACTGG - Intronic
1136439464 16:30254842-30254864 GTGGGCAATGATCATGTCAGAGG + Intergenic
1136597895 16:31264586-31264608 GTGAGCTATGATTATGCCACTGG + Intronic
1137330092 16:47485673-47485695 GTGAGCAAAGATCACGCACCTGG - Intronic
1137691171 16:50429034-50429056 GTGAGCTATGATCATGCCAGTGG + Intergenic
1137869278 16:51933929-51933951 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1137966533 16:52939448-52939470 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1138214822 16:55194593-55194615 GTGAGCCATGTTCATGCCACTGG - Intergenic
1138479928 16:57295766-57295788 GTGAGCTATGGTCATGCCACTGG - Intergenic
1138718558 16:59052282-59052304 GTGAGCAAGGATTAGGTCGCTGG + Intergenic
1139164606 16:64551058-64551080 GTGAGCTATGATCATGCCATTGG + Intergenic
1139858849 16:70003990-70004012 GTGAGCAGTGATCATGTCAGAGG + Intergenic
1139885968 16:70207142-70207164 GTGAGCAGTGATCATGTCAGAGG + Intergenic
1139894800 16:70279944-70279966 GTGAGCCGTGATCGTGCCACTGG - Intronic
1139937952 16:70584754-70584776 GTGAGCCAGGATCATGCCACTGG - Intronic
1139939848 16:70597274-70597296 GGGAGCCATGATCGTGCCACTGG - Intronic
1139981668 16:70863826-70863848 GTGAGCTGAGATCATGCCACTGG + Intronic
1140057856 16:71541274-71541296 GTGAGCAGAGATCGTGCCACAGG - Intronic
1140105674 16:71957733-71957755 GTGAGCCAAGATCAAGCCACTGG + Intronic
1140155311 16:72418774-72418796 GTGAGCCAAGATCACGCCACTGG - Intergenic
1140217194 16:73018039-73018061 GTGAGCCATGATCGTGCCACTGG - Intronic
1140389901 16:74576975-74576997 GTGAGCTATGTTCATGCCACTGG - Intronic
1140399624 16:74660395-74660417 GTGAGCAAAGATTGTGCCACGGG + Intronic
1140470258 16:75209779-75209801 GTGAGCGGTGATCATGCCACTGG + Intergenic
1140922773 16:79554031-79554053 GTGAGCTGAGATCATGCCACTGG + Intergenic
1141085764 16:81094447-81094469 GTGAGCCAAGATCCTGCCACTGG + Intronic
1141560975 16:84867620-84867642 GTGAGCCGAGATCATGCCACTGG - Intronic
1141975477 16:87513124-87513146 TAGAGCAGTGATCATGCCCCTGG + Intergenic
1142019550 16:87772744-87772766 GTGAGCCAAGATCATGCTGCTGG - Intergenic
1142334518 16:89479004-89479026 GTGAGCTGAGATCATGCCACTGG - Intronic
1142398520 16:89846858-89846880 GTGAGCCAAGATCACGCCACTGG - Intronic
1142730921 17:1856541-1856563 GTGAGCTGAGATCATGCCACGGG + Intronic
1142731519 17:1861777-1861799 GTGAGCCAAGATCACGCCACTGG - Intronic
1142761932 17:2047634-2047656 GTGAGCCATGATCCTGCACCTGG - Intergenic
1142768573 17:2080360-2080382 GTGAGCTGAGATCATGCCACTGG + Intronic
1142790192 17:2257951-2257973 GTGAGCTGAGATCATGCCACTGG + Intronic
1143549999 17:7624705-7624727 GTGAGCCGAGATCATGCCACTGG - Intronic
1143675841 17:8431913-8431935 GTGAGCCAAGATCATGCCACTGG - Intronic
1143838634 17:9713142-9713164 GTGAGCCGAGATCATGCCACTGG - Intronic
1143887880 17:10079081-10079103 GTGAGCTATGATCACACCACTGG + Intronic
1144433055 17:15212894-15212916 GTGAGCCAAGATCACGCCACTGG - Intergenic
1144547004 17:16206439-16206461 GTGAGCTGAGATCATGCCACTGG - Intronic
1144562915 17:16336607-16336629 GTGAGCTGTGATCAAGCCACTGG - Intronic
1144697911 17:17317904-17317926 GTGAGCTGAGATCATGCCACTGG + Intronic
1144786294 17:17833913-17833935 GTGAGCTGAGATCATGCCACTGG + Intronic
1144867946 17:18348921-18348943 GTGAGCTGTGATCACGCCACTGG + Intronic
1145189796 17:20829099-20829121 GTGAGCCATGATCACGCCACTGG - Intergenic
1145359181 17:22198111-22198133 GTGAGCTGTGATCAAGCCACTGG - Intergenic
1145746815 17:27325928-27325950 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1145911017 17:28543216-28543238 GTGAGCCATGATTGTGCCACTGG + Intronic
1146233563 17:31135620-31135642 GTGAGCCATGATCACACCACTGG - Intronic
1146290931 17:31606654-31606676 GTGAGCCAAGATCCTGCCACTGG + Intergenic
1146727627 17:35169068-35169090 GTGAGCCAATATCATGCCACTGG - Intronic
1146998797 17:37345107-37345129 GTGAGCCGAGATCATGCCACTGG - Intronic
1147321411 17:39648409-39648431 GTGAGCCATGTTCACGCCTCTGG + Intronic
1147474843 17:40700951-40700973 GTGAGCTATGATCATGCCACTGG - Intronic
1147610249 17:41797749-41797771 GTGAGCCAAGATCAGGCCACTGG - Intergenic
1147957375 17:44143586-44143608 GTGAGCCAAAATCGTGCCGCTGG + Intronic
1148252521 17:46096672-46096694 GTGAGCCGAGATCATGCCACTGG - Intronic
1148256013 17:46132885-46132907 GTGAGCCATCATCATACCACTGG + Intronic
1148292115 17:46461939-46461961 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1148314304 17:46679634-46679656 GTGAGCCAAGATCGTGCCACTGG + Intronic
1148704013 17:49611936-49611958 GTGAGCCATGATCATGCTACTGG - Intronic
1148846129 17:50531094-50531116 GTGAGCCATGATCACACCACTGG + Intronic
1148847134 17:50536045-50536067 GTGAGCCATGGTCAGGCCACTGG - Intronic
1148933513 17:51146168-51146190 GTGAGCCAAAATCATGCCACTGG + Intergenic
1148945134 17:51255649-51255671 GTGAGCCATGATTGTGCCACTGG - Intronic
1149445692 17:56711707-56711729 GTGAGCCATGATGGTGCCACAGG - Intergenic
1149530357 17:57390197-57390219 GTGAGCTATAGTCATGCCACTGG + Intronic
1149796046 17:59521123-59521145 GTGAGCTATGATCATACCACGGG - Intergenic
1149810487 17:59665167-59665189 GTGAGCTATGATCGTGCCATTGG + Intronic
1150027304 17:61689948-61689970 GTGAGTCATGATCATGCCACTGG + Intronic
1150242102 17:63642810-63642832 GTGAGCCATGATCACGCCACTGG - Intronic
1150316116 17:64170686-64170708 GTGAGCCAAGATCGTGCCACTGG - Intronic
1150746785 17:67823317-67823339 GTGAGCCAAGATCGTGCCACTGG - Intergenic
1151720194 17:75850748-75850770 GTGAGCTGGGATCATGCCACTGG - Intronic
1151746910 17:76016557-76016579 GTGAGCCTTGATCATGCCACTGG + Intronic
1151751617 17:76041937-76041959 GTGAGCCAAGATCACGCCCCTGG - Intronic
1151777714 17:76218579-76218601 GTGAGCTATGATCACACCCCTGG + Intronic
1151787938 17:76285008-76285030 GTGAGCCATGATCGCGCCACTGG - Intronic
1151868853 17:76822891-76822913 GTGAGCTGTGATCGTGCCACTGG - Intergenic
1151907425 17:77057592-77057614 GTGAGCCAAGATCATGCCACTGG + Intergenic
1153034608 18:749103-749125 GTGAGCCGAGATCATGCCACTGG + Intronic
1153122201 18:1742610-1742632 GTGAGCCGAGATCATGCCACTGG - Intergenic
1153218777 18:2844650-2844672 GTGAGCCATGATCATGCCACTGG + Intergenic
1153406116 18:4741662-4741684 GTGAGCCATGATAGTGCCACTGG - Intergenic
1153909302 18:9692510-9692532 GTGAGCCGAGATCATGCCACTGG + Intergenic
1154220077 18:12444815-12444837 GTGAGCTATGATCACACCACTGG - Intergenic
1154242244 18:12663326-12663348 GTGAGCTGAGATCATGCCACTGG - Intronic
1154273389 18:12939044-12939066 GTGAGCCAAGACCATGCCCCTGG + Intergenic
1154482096 18:14840481-14840503 ATGAGCCAAGATCATGCCACTGG + Intronic
1154957578 18:21274464-21274486 GTGAGCCGTTATCATGCCACGGG - Intronic
1155002552 18:21701267-21701289 GTGAACCATGATCGTGCCACTGG - Intronic
1155223692 18:23709124-23709146 GTGAGCCAAGATCATACCACTGG - Intronic
1156842753 18:41628837-41628859 GTGAGCCAAGATCATGCCACTGG - Intergenic
1158906179 18:62014387-62014409 GTGAGCAGAGATCATGCCACTGG - Intergenic
1160513294 18:79464759-79464781 GTGAGCCATGATCAAGCCACTGG - Intronic
1161174782 19:2835052-2835074 GTGAGGTATGATCACGCCACTGG - Exonic
1161864798 19:6825985-6826007 GTGAGTCAAGATCATGCCACTGG + Intronic
1161924612 19:7291846-7291868 GTGAGCCAAGATCGTGCCACTGG - Intronic
1162055354 19:8060283-8060305 GTGAGCTATGATCATACCATTGG + Intronic
1162071191 19:8153177-8153199 GTGAGCTATGATGTTGCCACTGG + Intronic
1162431165 19:10629631-10629653 GCGAGCTATGATCCTGCCACTGG - Intronic
1162512100 19:11125412-11125434 GTAAGCCAAGATCATGCCACTGG + Intronic
1162527304 19:11213850-11213872 GTGAGCCATGATCGTGCCACTGG - Intronic
1162530889 19:11235934-11235956 GTGAGCCGAGATCATGCCACTGG - Intronic
1162579413 19:11519383-11519405 TTGAGCTATGATCACGCCCCTGG - Intronic
1162639378 19:11996105-11996127 GTGAGCAGAGATCATGCCCCTGG - Intergenic
1162647960 19:12063944-12063966 GTGAGCCGAGATCATGCCACTGG - Intergenic
1162648663 19:12068251-12068273 GTGAGGCATGATCATGCCACTGG + Intronic
1162814309 19:13184007-13184029 TTGAGCAATAGTCATGCCACTGG - Intergenic
1163308595 19:16498337-16498359 GTGAGCTATGATCGTGCCACTGG - Intronic
1163341876 19:16713762-16713784 GTGAGCCAAGATCATGTCACTGG - Intergenic
1163345050 19:16735772-16735794 ATGAGCCAAGATCATGCCACTGG + Intronic
1163363778 19:16864888-16864910 GTGAGCCAAGATCATGCCACTGG - Intronic
1163506471 19:17710110-17710132 GTGAGCCATGATCATGCTCCTGG + Intergenic
1163515067 19:17757858-17757880 GTGAGCCAAGATCATACCACTGG + Intronic
1163537454 19:17885060-17885082 GTGAGCTATGATCGTGCCACTGG - Intronic
1164047991 19:21559229-21559251 GTGAGCCGAGATCATGCCACTGG + Intergenic
1164229745 19:23276625-23276647 GTGAGCCGAGATCATGCCACTGG + Intergenic
1164241892 19:23396436-23396458 GTGAGCCGAGATCGTGCCGCTGG - Intergenic
1164567814 19:29340462-29340484 GTGAGCTGAGATCATGCCACTGG + Intergenic
1164689570 19:30200363-30200385 GTGAGCTATGATTGTGCCACTGG + Intergenic
1164949980 19:32328913-32328935 ATGAGATATGATCATGCCACTGG + Intergenic
1165014947 19:32874083-32874105 GTGAGCTACGATCGTGCCACTGG + Intergenic
1165222696 19:34330027-34330049 GTGAGCCATGTTCGTGCCACCGG + Intronic
1165495170 19:36148459-36148481 GTGAGCTATGATCTTGCCACTGG + Intronic
1165740934 19:38204708-38204730 GTGAGCCGAGATCATGCCACTGG + Intronic
1165872081 19:38980243-38980265 GTGAACCAAGATCATGCCACTGG - Intergenic
1166154297 19:40899364-40899386 GTGAGCCGAGATCATGCCACTGG + Intergenic
1166322970 19:42030512-42030534 GTGAGCTATGATCACGCTGCTGG - Intronic
1166716209 19:44969741-44969763 GTGAGCCGAGATCATGCCACTGG - Intronic
1166969577 19:46556734-46556756 GTGAGCCAAGATCATGCCACTGG - Intronic
1167092911 19:47356895-47356917 GTGAGCCGAGATCATGCCACTGG + Intronic
1167284244 19:48589902-48589924 GTGAGCCATGATTGTGCCACAGG + Intronic
1167407583 19:49323972-49323994 GTGAGAGGTGATCATGCCACTGG + Intronic
1167864209 19:52310947-52310969 GTGAGCCAAGATCACGCCACTGG + Intronic
1168024393 19:53633236-53633258 GTGAGCTGTGATCATGCCACTGG + Intronic
1168646908 19:58065247-58065269 GTGAGCCATGATCATACCACTGG - Intronic
1168659248 19:58153762-58153784 GTGGGCTATGATCATGCCACTGG - Intronic
926416404 2:12653774-12653796 GTGAGCCCTGATCATGGCACTGG + Intergenic
926578412 2:14608176-14608198 GTGAGCTGAGATCATGCCACTGG + Intergenic
926768390 2:16345488-16345510 GTGAGCCAAGATCGTGCCACTGG + Intergenic
927298642 2:21484600-21484622 GTGAGCCATGATCATACCACTGG + Intergenic
927557927 2:24049311-24049333 GTGAGCTATGATCGCGCCACTGG + Intronic
927700157 2:25263014-25263036 GTGAGCCATGATCATGCCACTGG - Intronic
927829068 2:26332682-26332704 GTGAGCTGTGATCATGCCACTGG + Intronic
927988804 2:27432629-27432651 GTGAGCTATGATCATGCCATTGG - Intronic
928107964 2:28484674-28484696 GTGAGCCATGATTGTGCCACTGG + Intronic
928547449 2:32341701-32341723 GTGAGCCGAGATCATGCCACTGG + Intergenic
929351015 2:40955027-40955049 GTGAGCCATAATCATGCCACTGG - Intergenic
929458237 2:42081673-42081695 GTGAGATATGATCATACCACAGG + Intergenic
929741010 2:44600320-44600342 GTGAGCTATGATGGTGCCACTGG - Intronic
929765152 2:44838032-44838054 GTGAGCCATGATCAGGCCACTGG + Intergenic
929785622 2:44988877-44988899 GTGAGCCAAGATCATGCCAATGG - Intergenic
930041954 2:47132107-47132129 GTGAGCCAAGATCGTGCCACTGG + Intronic
930142439 2:47966051-47966073 GTGAGCTGAGATCATGCCACTGG - Intergenic
930639283 2:53838841-53838863 GTGAGCAATGATGGTGCCACTGG + Intergenic
930688940 2:54339098-54339120 GTGAGCCAAGATCGTGCCACTGG + Intronic
930807710 2:55507844-55507866 GTGAGCCGAGATCATGCCACTGG - Intergenic
931003601 2:57820689-57820711 GTGAGCCCAGATCATGCCACTGG + Intergenic
931421423 2:62131596-62131618 GTGAGCCAAGATCATGCCACTGG - Intronic
931447310 2:62337435-62337457 GTGAGCCAAGATCACGCCACTGG + Intergenic
931508028 2:62953491-62953513 GTGAGCTGTGATCATGCCATTGG + Intronic
931786827 2:65627331-65627353 GTGAGCCAAGATCACGCCACTGG - Intergenic
932186973 2:69705874-69705896 GTGAGCTAAGATCATGCCACTGG + Intronic
932676389 2:73785232-73785254 GTGAGCCATGTTCATACCACTGG + Intronic
932676975 2:73790133-73790155 GTGAGCCATGTTCATACCACTGG + Intronic
932677560 2:73795030-73795052 GTGAGCCATGTTCATACCACTGG + Intronic
932678146 2:73799928-73799950 GTGAGCCATGTTCATACCACTGG + Intronic
932678732 2:73804828-73804850 GTGAGCCATGTTCATACCACTGG + Intronic
932974676 2:76584916-76584938 GTGAGCCAAGATCGTGCCACTGG - Intergenic
934055164 2:88245223-88245245 GTGAACTATGATCATGCCACTGG + Intergenic
934675837 2:96249151-96249173 GTGAGCCGAGATCATGCCACTGG - Exonic
934726349 2:96622364-96622386 GTGAGGTATGATCATGCCACGGG + Intronic
934876237 2:97923564-97923586 GTGAGCCATGATTGTGCCACTGG + Intronic
935893334 2:107705027-107705049 GTGAGCGGAGATCATGCCCCTGG - Intergenic
936246422 2:110832110-110832132 GTGAGTTATGATCATGCCACTGG + Intronic
936259063 2:110942826-110942848 GTGAGCCAAGATCATGCCACTGG + Intronic
936746850 2:115587151-115587173 GTGAGCCAAGATCGTGCCACTGG - Intronic
936948549 2:117953836-117953858 GTGAGTTATGATCATGCCACTGG + Intronic
937090499 2:119203052-119203074 CTGAGCAATGAGCATGCCACAGG + Intergenic
937101452 2:119273949-119273971 GTAAGCCATGATCGTGCCACTGG - Intergenic
937116800 2:119412121-119412143 GTGAGCCAAGATCGTGCCACTGG - Intergenic
937266383 2:120617259-120617281 GTGAGCAATCATGCTGCCACAGG - Intergenic
937673538 2:124564409-124564431 GTGAGCCAAGATCGTGCCACTGG - Intronic
938045219 2:128112636-128112658 GTGATCCATGATCATTCCACTGG - Intronic
938046755 2:128128365-128128387 GTGAGCCAAGACCATGCCACTGG - Intronic
938054487 2:128203808-128203830 GTGAACCAAGATCATGCCACTGG - Intergenic
938826870 2:135014296-135014318 GTAAGCTGTGATCATGCCACTGG + Intronic
938851253 2:135262723-135262745 GTGAGCTATAATCATGCCACTGG + Intronic
938904664 2:135826508-135826530 GTGAGCCGAGATCATGCCACGGG + Intronic
938956029 2:136299256-136299278 GTGAGCTGAGATCATGCCGCTGG - Intergenic
939802400 2:146726349-146726371 GTGAGCCAAGATCGTGCCACTGG + Intergenic
939909239 2:147960831-147960853 GTGAGCTATGATTGAGCCGCTGG + Intronic
939913957 2:148017614-148017636 GTGAGCCAAGATCATGCCACTGG + Intronic
939914878 2:148026857-148026879 GTGAGCCATGATCATGCCACTGG + Intronic
940062719 2:149590270-149590292 GTGAGCTATGATCGTGCCACTGG - Intergenic
940953960 2:159708236-159708258 GTGAGCTATGATGGTACCGCCGG + Intergenic
941289740 2:163660937-163660959 GTGAGCCAAGATCATGCCACTGG - Intronic
941994564 2:171589955-171589977 GTGAGCCGTGATTATGCCACTGG + Intergenic
942019183 2:171849855-171849877 GTGAGCCAAGATCACGCCACTGG - Intronic
942080187 2:172393048-172393070 GTGAGCCAAGATCACGCCACTGG + Intergenic
942337108 2:174900446-174900468 GTGAGCTATGATCATACTCCAGG + Intronic
942547911 2:177083929-177083951 GTGAGTCATGATCATGCTACTGG - Intergenic
942674503 2:178413241-178413263 GTGAGCCAAGATCATGTCACTGG - Intergenic
942905806 2:181179508-181179530 GTGAGCCGAGATCATGCCACTGG - Intergenic
943353094 2:186818508-186818530 GTGAACAATGATCATACCACTGG - Intergenic
943518771 2:188920639-188920661 GTGAGCCATGATTATTCCACTGG + Intergenic
943601575 2:189926937-189926959 GTGAGCTATGATCACACCACTGG - Intronic
943895511 2:193353027-193353049 GTGAGCTATAATCACACCGCTGG - Intergenic
944169905 2:196762870-196762892 GTGAGCAGAGATCATGCCACTGG + Intronic
944238686 2:197464939-197464961 GTGAGCCAAGATCACGCCACTGG - Intronic
944427870 2:199602569-199602591 GTGAGCCATGATCTTGCCACTGG + Intergenic
944462379 2:199964190-199964212 GTGAACTATGATCATGCCACTGG - Intronic
944502407 2:200375680-200375702 GTGAGCTGTGATCATGCCACTGG - Intronic
944715493 2:202373233-202373255 GTGAGCCGAGATCATGCCACTGG - Intergenic
944778938 2:202997847-202997869 GTGAGCGATGATCACGCCACTGG - Intronic
944815836 2:203374101-203374123 GTGAGCCATGTTCATGCCACTGG + Intronic
945223936 2:207512539-207512561 GTGAGAGATGATGATGCCTCAGG + Intergenic
946461506 2:219872840-219872862 GTGAGCCAAGATGATGCCTCTGG + Intergenic
947175061 2:227358132-227358154 GTGAGCTGAGATCATGCCACGGG - Intergenic
947193666 2:227539385-227539407 GTGAGCTGAGATCATGCCACTGG + Intronic
947194961 2:227553438-227553460 GTGAGCCATGATCATGCTACTGG + Intronic
947200702 2:227612319-227612341 GTGAGCCAAGATCGTGCCACTGG - Intronic
947226286 2:227843463-227843485 GTGAGCCGTGATCATGCCACTGG + Intergenic
947226584 2:227846332-227846354 GTGAGCTATGATCACACTGCTGG - Intergenic
947414604 2:229880886-229880908 GTGAGCCTAGATCATGCCACTGG + Intronic
947577251 2:231285588-231285610 GTGAGCTGAGATCATGCCACTGG + Intronic
947771938 2:232676942-232676964 GTGAGCTATGATCATACCACTGG + Intronic
948105201 2:235407846-235407868 GTGAGCTACGATCGTGCCACTGG + Intergenic
948209768 2:236184309-236184331 GTTAGCCAAGATCATGCCACTGG - Intergenic
948312551 2:236999620-236999642 GTGAGCATGAATCAGGCCGCGGG - Intergenic
948428670 2:237904361-237904383 GTGAGCTGAGATCATGCCACTGG + Intronic
1168916863 20:1496315-1496337 GTGAGCCGAGATCATGCCACTGG - Intergenic
1168973979 20:1950429-1950451 GTGAGCCAAGATCATGCCACTGG - Intergenic
1169373966 20:5051172-5051194 GTGAGCCAAGATCATGCCACTGG - Intergenic
1169444832 20:5662714-5662736 GTGAGCTATGATCATGCCACTGG + Intergenic
1169460751 20:5792727-5792749 GTGAGCCGGGATCATGCCACTGG - Intronic
1169543038 20:6621302-6621324 GTGAGTTGTGATCATGCCACTGG - Intergenic
1169575275 20:6952882-6952904 GTGAGCCGAGATCATGCCACTGG + Intergenic
1171190743 20:23157594-23157616 GTGAGCCAAGATCGTGCCGCTGG - Intergenic
1171368072 20:24640267-24640289 GAGAGCCAAGATCATGCCACTGG + Intronic
1171446840 20:25210587-25210609 GTGAGCCATGATTGTGCCACAGG + Intronic
1171726910 20:28631954-28631976 GTGAGCTATGATCTTGCCACTGG + Intergenic
1171751346 20:29052659-29052681 GTGAGCTATGATCTTGCCACTGG - Intergenic
1172037739 20:32021598-32021620 GTGAGCCATGATTGTGCCACTGG + Intronic
1172124225 20:32615737-32615759 GTGAGCCAAGATCGTACCGCTGG + Intergenic
1172281726 20:33712503-33712525 GTGAGCCCAGATCATGCCACTGG - Intronic
1172283199 20:33722595-33722617 GTGAGCGGTGATCACGCCACTGG + Intergenic
1172566299 20:35933450-35933472 GTAAGCCAAGATCATGCCACTGG - Intronic
1172670016 20:36628599-36628621 GTGAGCTATGATCACACCACTGG - Intronic
1172676270 20:36674948-36674970 GTGAGCCATGATCACACCACTGG - Intronic
1172679393 20:36700827-36700849 GTGAGCTATGATCACACCACTGG - Intronic
1172696479 20:36826431-36826453 GTGAGCTATGATGGTGCCACTGG - Intronic
1172812328 20:37657505-37657527 GTGAGCTGAGATCATGCCACTGG + Intergenic
1172877862 20:38177043-38177065 GAGAGCAAGGAGCATGCCTCTGG + Intergenic
1172902529 20:38345441-38345463 GCGAGCGATGTTCATGCCACTGG + Intergenic
1173493275 20:43500710-43500732 GTGAGCTATGATCGTGCTACTGG + Intergenic
1173547207 20:43907545-43907567 GTGAGCTATGATCACACCACTGG + Intergenic
1174011609 20:47454319-47454341 GTGAGCCAAGATCATGCTACTGG - Intergenic
1174258016 20:49273186-49273208 GTGAGCCAAGATCATGCCACTGG - Intronic
1174313790 20:49681158-49681180 GTGAGCTATGATCACACCACTGG + Intronic
1174334167 20:49845888-49845910 GTGAGCCGAGATCATGCCACAGG - Intronic
1174428547 20:50450736-50450758 GTGAGCTATGATCTTGCCACTGG - Intergenic
1174601231 20:51726632-51726654 GTGAGCTACGATCACGCCACTGG - Intronic
1174805825 20:53603684-53603706 GTGAGCCGAGATCATGCCACTGG + Intronic
1174866756 20:54144264-54144286 GTGAGCTGTGATCATGTCACCGG - Intergenic
1174919762 20:54689307-54689329 GTAAGCCATGATCATGCCCCTGG - Intergenic
1174921243 20:54704816-54704838 GTGAGCTGCGATCATGCCACTGG - Intergenic
1174963258 20:55182111-55182133 GTGAGCCAAGATCACGCCACTGG - Intergenic
1175091646 20:56509555-56509577 GTGAGCCGAGATCATGCCACTGG + Intronic
1175102160 20:56587055-56587077 GTGAGCTGAGATCATGCCACAGG - Intergenic
1175416016 20:58801496-58801518 GTGAGCTGAGATCATGCCACTGG + Intergenic
1175573681 20:60043473-60043495 GGGAGCTATGATCATGCCATAGG + Intergenic
1175729055 20:61340638-61340660 GTGAGCCGTGATCATGCCACTGG - Intronic
1176228689 20:64019152-64019174 GTGAGCCAAGATCGTGCCACTGG - Intronic
1176313427 21:5218269-5218291 GTGAGCTATGATCTTGCCACTGG + Intergenic
1176732987 21:10519053-10519075 GTGAGCCGAGATCATGCCACTGG - Intergenic
1176798507 21:13396138-13396160 ATGAGCCAAGATCATGCCACTGG - Intergenic
1177831847 21:26148094-26148116 GTGGGTAATGCTCATGCCTCAGG - Intronic
1177835381 21:26181705-26181727 GTGAGCAGAGATCATGCCTGGGG - Intergenic
1178230394 21:30776987-30777009 GTAAGCTATGATCATGCCACTGG + Intergenic
1178283414 21:31304746-31304768 GTGAGCTGAGATCATGCCACTGG - Intronic
1178809982 21:35872705-35872727 GTGTGCTATGATCATGCCCACGG + Intronic
1179068512 21:38049580-38049602 GTGAGCCGAGATCACGCCGCTGG + Intronic
1179439744 21:41384781-41384803 GTGAGCCAAGATCGTGCCACTGG + Intronic
1180489079 22:15825108-15825130 GTGAGCCAAGATCATGCCATTGG + Intergenic
1181430058 22:22874258-22874280 GTGAGCTATGATCATGCCACTGG + Intronic
1181760572 22:25055913-25055935 GTGAGCCGAGATCATGCCACCGG - Intronic
1181957451 22:26598430-26598452 GTGAGTCGTGATCATGCCACTGG - Intergenic
1182139866 22:27944706-27944728 TTAAGCAATCATCATGCCTCGGG - Intergenic
1182425484 22:30269449-30269471 GTGAGCCATTATCATGCCACAGG + Intergenic
1182510879 22:30819277-30819299 GTGAGCAGAGATCATGCCACTGG + Intronic
1182523161 22:30896701-30896723 GTGAGCTGTGATCGTGCCACTGG - Intronic
1182625487 22:31642737-31642759 GTGAGCGAAGATCACGCCACTGG + Intronic
1182719955 22:32389425-32389447 GTGAGCTATGATTGTGCCACTGG - Intronic
1183115220 22:35686641-35686663 ATGAGATATGATCATGCCACTGG - Intergenic
1183182343 22:36268545-36268567 GTGAGCCATGCTCATGCCACGGG - Intergenic
1183289045 22:36987388-36987410 GTGAGCCAAGATCGTGCCACTGG - Intergenic
1184151167 22:42639570-42639592 GTGAGCCGAGATCATGCCACTGG + Intronic
1184563622 22:45277944-45277966 GTGAGCTATGATCGTGCCACTGG + Intergenic
1184626614 22:45737752-45737774 GTGAGCCAAGATCACGCCACTGG - Intronic
1185112603 22:48910198-48910220 GTGAGCCAAGATCGTGCCACTGG - Intergenic
950094821 3:10322662-10322684 GTGAGCCAAGATCATACCACTGG - Intergenic
950586012 3:13892788-13892810 GTGAGCTGAGATCATGCCACTGG + Intergenic
950814886 3:15690618-15690640 GTGAGCTATGATCACGCCACTGG - Intronic
952286690 3:31976506-31976528 GTGAGCTATGATCACACCACTGG - Intronic
952482151 3:33772504-33772526 GTGAGCCATGATTATGCTACTGG + Intergenic
952524553 3:34196503-34196525 GTGAGCCAAGATCGTGCCACTGG + Intergenic
952590802 3:34951928-34951950 GTGAGCCAAGATCGTGCCACTGG - Intergenic
953334888 3:42086359-42086381 GTGAGCTGAGATCATGCCACTGG - Intronic
953651888 3:44813471-44813493 GTGAGCCAAGATCATGCCACTGG - Intronic
953908503 3:46880669-46880691 GTGAGCAGAGATCATGCCACTGG + Intronic
954485267 3:50844269-50844291 GTGAGCTATAATCATGCCACTGG - Intronic
954526058 3:51272330-51272352 GTGAGCTGAGATCATGCCACTGG - Intronic
954545472 3:51431109-51431131 GTGAGCCAAGATCATGCCACTGG + Intronic
955278380 3:57569774-57569796 GTGAGCCAAGATCCTGCCACTGG + Intergenic
955283072 3:57613034-57613056 GTGAGCCGAGATCATGCCACTGG - Intergenic
955330490 3:58043188-58043210 GTGAGCAGAGATCATTCCCCCGG - Intronic
955485649 3:59432162-59432184 GTGAGCCAAGATCATGCCACTGG - Intergenic
955509609 3:59666023-59666045 GTGAGCTGTGATCATGCTACTGG + Intergenic
955598786 3:60621815-60621837 GGGAGCTATGATCATGCCACTGG + Intronic
955690675 3:61587710-61587732 GTGAGCTATGATTGTGCCACTGG - Intronic
955833631 3:63030363-63030385 GTGAGCTCTGATCATGCCACTGG + Intergenic
955842787 3:63129902-63129924 GTGAGCCTAGATCATGCCACTGG + Intergenic
956092634 3:65684116-65684138 GTGAGCTATGATCATGCCGCTGG + Intronic
956101041 3:65768362-65768384 GTGAGCCAAGATCACGCCACTGG + Intronic
956153102 3:66264214-66264236 GTGAGCCAAGATCGTGCCACTGG + Intronic
956523501 3:70131634-70131656 ATGAGCCATGATCATGCCACTGG - Intergenic
956576304 3:70756449-70756471 GTGAGCTGAGATCATGCCACTGG + Intergenic
956639708 3:71404181-71404203 GTGAGCCAAGATCACGCCACTGG - Intronic
957411925 3:79852318-79852340 GTGAGCCAAGATCATGCCACTGG + Intergenic
957559493 3:81803630-81803652 GTGAGCCATGATCATGCCACTGG + Intergenic
957778833 3:84792237-84792259 GTGAGCCAAGATCATACCACTGG + Intergenic
957919474 3:86730224-86730246 GTGAGCCAAGATCACGCCACTGG + Intergenic
958596178 3:96226973-96226995 GTGAGCAGAGATCGTGCCACTGG - Intergenic
958653695 3:96973767-96973789 GTGAGCCGAGATCATGCCACTGG + Intronic
958882296 3:99686728-99686750 GTGAGCTGTGATCACGCCACTGG - Intronic
959142191 3:102499837-102499859 GTGAGACATGATCATGCCACTGG - Intergenic
959195248 3:103172168-103172190 GTGAGCCATGATCATGCCATTGG - Intergenic
959376296 3:105592511-105592533 GTGAGCCAAGATCATGCCACTGG + Intergenic
959393461 3:105805358-105805380 GTGAGCTGAGATCATGCCACTGG - Intronic
959652558 3:108765172-108765194 GTGAGCCGAGATCATGCCACTGG + Intergenic
960086203 3:113594146-113594168 GGGAGCAATGATCCTGCTGGAGG - Intronic
960131556 3:114061631-114061653 GTGAGCCATGATCACGCCACTGG - Intronic
960384440 3:117004501-117004523 GTGAGCCAAGATCATGCCACTGG + Intronic
960992201 3:123319296-123319318 GTGAGCCAAGATCAAGCCACTGG + Intronic
961317339 3:126049429-126049451 GTGAGCTGAGATCATGCCACTGG + Intronic
961560773 3:127727654-127727676 GTGAGCCATGATCGTGCCACTGG + Intronic
961681163 3:128601216-128601238 GTGAGCTGAGATCATGCCACTGG - Intergenic
962724411 3:138208409-138208431 GTGAGCCAAGATCATGCTGCTGG + Intronic
963115628 3:141726676-141726698 GTGAGCTAAGATCATGCCACTGG - Intergenic
963126829 3:141824096-141824118 GTGAGCCATGATCACACCACTGG + Intergenic
963130282 3:141851608-141851630 GTGAGCAATGAGCTGGCCTCCGG + Intergenic
963199901 3:142575426-142575448 GTGAGCAGAGATCACGCCACTGG + Intronic
963664693 3:148167854-148167876 ATGAGCCATGATCATGTCACTGG + Intergenic
963907566 3:150785597-150785619 GTGAGTCAAGATCATGCCACTGG - Intergenic
964126956 3:153243970-153243992 GTGAGCCAAGATCATGCCACTGG - Intergenic
965571182 3:170175569-170175591 GTGAGTTGTGATCATGCCACTGG + Intronic
965664666 3:171080490-171080512 GTGAGCCGAGATCATGCCACTGG - Intronic
965933902 3:174081641-174081663 GTGAGCCAAGATCATGCCATTGG - Intronic
965993969 3:174856060-174856082 GTAAGCTATGATCATACCACTGG - Intronic
966223999 3:177578562-177578584 GTGAGCCAAGATAATGCCACTGG + Intergenic
966422928 3:179751777-179751799 GTGAGCTGAGATCATGCCACTGG - Intronic
966661899 3:182424252-182424274 GTGAGCTGTGATTATGCCACTGG - Intergenic
966696770 3:182797650-182797672 GTAAGCCAAGATCATGCCACTGG + Intronic
966828919 3:183989113-183989135 GTGAGCCGAGATCATGCCACTGG + Intronic
967766217 3:193282428-193282450 GTGAGCTGAGATCATGCCACTGG - Intronic
968147797 3:196314040-196314062 GTGAGCCAAGATCATGCCATTGG + Intronic
968273343 3:197421813-197421835 GTGAGCCAAGATCATGCCACTGG - Intergenic
968418800 4:465027-465049 GTGAGCCAAGATCGTGCCACTGG + Intronic
970123227 4:12780486-12780508 GTGAGCCTATATCATGCCGCTGG + Intergenic
970328699 4:14956289-14956311 GTGAGCAGAGATCACGCCACTGG + Intergenic
970634097 4:17988329-17988351 GTGAGCTATGATAGTGCCACTGG - Intronic
970787299 4:19814510-19814532 GTGAGCCAAGATCGTGCCACTGG + Intergenic
972391907 4:38621871-38621893 GTGAGCCGAGATCATGCCACTGG + Intergenic
972578733 4:40376041-40376063 GTGAGCCATGATTGTGCCACTGG - Intergenic
972656123 4:41065227-41065249 GTGAGCTGTGTTCATGCCACTGG + Intronic
972732091 4:41804618-41804640 GTGAGCCGAGATCATGCCACTGG + Intergenic
973561386 4:52139752-52139774 GTGAGCTGAGATCATGCCACTGG + Intergenic
973651893 4:53004952-53004974 GTGAGCCAAGATCACGCCACTGG - Intronic
973857468 4:55027690-55027712 GTGAGCCATGATCATGCACTGGG + Intergenic
975422467 4:74183594-74183616 GTGAGCCAAGATCATGCCACTGG + Intronic
975687294 4:76929936-76929958 GTGAGCTGTGATCATGCCAGTGG + Intergenic
976164623 4:82241014-82241036 GTGAGCTATGATCATGCCACTGG + Intergenic
976574168 4:86650039-86650061 GTGAGCCAAGATCATGCCATTGG - Intronic
976596309 4:86898334-86898356 GTGAGCCGAGATCATGCCACTGG + Intronic
976628502 4:87212523-87212545 GTGAGCCATGATCTTGCCAGTGG + Intronic
976700160 4:87960985-87961007 GTCAGCAATGATTATGCCTATGG - Intergenic
976713683 4:88100592-88100614 ATGAGCCATGATCATGTCTCTGG + Intronic
976736475 4:88314947-88314969 GTGAGCCGAGATCATGCCCCTGG + Intergenic
977696979 4:99976421-99976443 GTGAGCAGAGATCATTCCACTGG + Intergenic
978490482 4:109306425-109306447 GTGAGCCATGACCATGCCACTGG - Intergenic
978861800 4:113459272-113459294 GTGAGCTATAATCATGCCACTGG - Intronic
979460508 4:120977624-120977646 GTGAGCAAAGATCCTGGGGCAGG - Intergenic
979563710 4:122130241-122130263 GTGAGCTATGATCATACCACTGG - Intergenic
979581903 4:122370580-122370602 GTGAGCCAAGATCATGCCACTGG + Intergenic
979759225 4:124379355-124379377 GTGAGCTGAGATCATGCCACTGG + Intergenic
979944146 4:126804756-126804778 GTGAGCCAAGATCGTGCCACTGG + Intergenic
980011233 4:127596946-127596968 GTGAGCCGTGATCGTGCCTCCGG - Intergenic
980092657 4:128458421-128458443 GTGAGCCAAGATCGTGCCACTGG + Intergenic
980346666 4:131631605-131631627 GTGAGCCAAGATCGTGCCACTGG - Intergenic
980445982 4:132907967-132907989 GTGAGCTGTGATGATGCCACTGG + Intergenic
981222053 4:142248391-142248413 GTGAGCCAAGATCATGCCACTGG - Intronic
981986238 4:150860770-150860792 GTGAGCCAAGATCGTGCCACAGG + Intronic
983440341 4:167774798-167774820 GTGAGCTATGATCATGACACTGG - Intergenic
983578621 4:169285583-169285605 CTGAGCAGAGATCATGCCACTGG - Intergenic
983611474 4:169650027-169650049 GTGAGCCATGATCATGCCACTGG + Intronic
983732273 4:171010746-171010768 GTGAGGCAAGATCATGCCACTGG + Intergenic
983923987 4:173376672-173376694 GTGAGCTGAGATCATGCCACTGG - Intronic
984180177 4:176473125-176473147 GTGAAAAATGTTCATGCCGATGG + Intergenic
984660757 4:182372782-182372804 GTGAGCCAAGATCATCCCACTGG - Intronic
984995901 4:185429723-185429745 GTGAGCTATAATCAGGCCACTGG - Intronic
985433717 4:189907017-189907039 GTGAGCTATGATCTTGCCACTGG - Intergenic
986367266 5:7044961-7044983 GTGAGCCAAGATCATGCCACTGG - Intergenic
986852302 5:11828472-11828494 GTGAGCCAAGATCATGCCACTGG + Intronic
986888242 5:12266754-12266776 GTGAGCAATGGTAGTGCCCCTGG + Intergenic
987554690 5:19431659-19431681 GTGAGCCAAGATCACGCCACTGG - Intergenic
987976186 5:25018132-25018154 GTGAGCCATGGTCCTGCCACTGG - Intergenic
989059301 5:37394240-37394262 GTGAGCGAAGATCATGCCCTGGG + Intronic
989227131 5:39041883-39041905 GTGAGCTATGATCATGCCACTGG + Intronic
990126370 5:52523623-52523645 GTGAGCCAAGATCATGACACTGG - Intergenic
990354206 5:54949853-54949875 GAGAGCCAAGATCATGCCACTGG + Intergenic
990397739 5:55401088-55401110 GTGAGCCATAATCATGCCACTGG - Intronic
991035609 5:62124562-62124584 CTGAGCAATGGTGATGCTGCGGG - Intergenic
991081560 5:62606422-62606444 GTGAGCCAAAATCATGCCACTGG + Intronic
991331219 5:65494500-65494522 ATGAGCCAAGATCATGCCACTGG + Intergenic
991726629 5:69542082-69542104 GTGAGCTATGATCACACCACTGG - Intronic
991868328 5:71085792-71085814 GTGAGCTATGATCACACCACTGG + Intergenic
992680347 5:79146797-79146819 GTGAGCTGAGATCATGCCACTGG - Intronic
992856161 5:80863613-80863635 GTGAGCCAAGATCGTGCCACTGG + Intronic
993610999 5:90054155-90054177 ATGAGAAATGAACATGCCGAAGG - Intergenic
993652357 5:90537042-90537064 GTGGGCTGTGATCATGCCACTGG + Intronic
993806013 5:92410307-92410329 CTGAGCCATGATCATGCCACTGG + Intergenic
993914965 5:93733254-93733276 GTGAGCCAAGATCATGCCCCTGG - Intronic
994101891 5:95902835-95902857 GTGAGCCATGTTCCTGCCACTGG - Intronic
994235438 5:97357179-97357201 GTGAGCCGAGATCATGCCACTGG - Intergenic
994362183 5:98864631-98864653 ATGAGCTGTGATCATGCCACTGG + Intronic
994819758 5:104634286-104634308 GTGAGCTATGATTGTGCCACTGG + Intergenic
994951748 5:106472183-106472205 GTGAGCCAAGATCACGCCACTGG + Intergenic
995131822 5:108638699-108638721 GTGAGCTATGATTGTGCCACTGG + Intergenic
995512926 5:112925989-112926011 GTGAGCCAAGATCATGCCACTGG - Intergenic
995928041 5:117399775-117399797 GTGAGTTGAGATCATGCCGCTGG - Intergenic
996109955 5:119553842-119553864 GTGAGCCAATATCATGCCACTGG - Intronic
996732885 5:126732833-126732855 GTGAGCTATGAGCATTCAGCTGG + Intergenic
997951395 5:138245382-138245404 GTGAGCCCTGATTATGCCACTGG - Intergenic
998040769 5:138949753-138949775 GTGAGCCAAGATCGTGCCACTGG + Intronic
998046395 5:138990508-138990530 GTGAGCCATGATAACGCCACTGG - Intronic
998073665 5:139218717-139218739 GTGAGTCAAGATCATGCCACTGG - Intronic
998241367 5:140448142-140448164 GTGAGCTATGATCATGCCACTGG + Intronic
998327601 5:141295551-141295573 GTGAGCCAAGATCATGCCATTGG - Intergenic
998981618 5:147709791-147709813 GTGAGCCAAGATCATGACACTGG + Intronic
999238353 5:150113378-150113400 GTGAGTCATGATCAGGCCCCAGG - Intergenic
999454272 5:151702149-151702171 GTGAGCCAAGATCATGCCACTGG - Intergenic
999938046 5:156509367-156509389 GTGAGCCAAGATCACGCCACTGG + Intronic
999981004 5:156957770-156957792 GTGAGCTATGATCATATCACTGG + Intronic
1000187351 5:158872250-158872272 GTGAGCTGAGATCATGCCGCTGG - Intronic
1000488319 5:161876988-161877010 GTGAGCCATGATTGTGCCACTGG - Intronic
1000859523 5:166439416-166439438 GTGAGCTGAGATCATGCCACTGG + Intergenic
1001040116 5:168328600-168328622 GTGAGCTGAGATCATGCCACTGG - Intronic
1001121437 5:168983992-168984014 GTGAGCTATGATCATGCCACTGG + Intronic
1001536120 5:172499092-172499114 GTGAGCTATCATCATGCCACTGG + Intergenic
1001805171 5:174578148-174578170 GTGAGCCACGATCATGCCGCTGG + Intergenic
1002030525 5:176425526-176425548 GTGAGCCAAGATCATGCCATTGG - Intergenic
1002349810 5:178576292-178576314 GTGAGCTAACATCATGCCACTGG - Intronic
1003881651 6:10484460-10484482 GTGAGCTATGATTATGCCACTGG - Intergenic
1003958563 6:11189000-11189022 GTGAGCTAAGATCGTGCCACTGG - Intronic
1004324621 6:14663541-14663563 GTGAGCAGAGATCACGCCACTGG + Intergenic
1004368654 6:15033467-15033489 GTGAGCCAAGATCGTGCCACTGG - Intergenic
1004693516 6:18012641-18012663 GTGAACTATGATCATGCCATTGG + Intergenic
1004903514 6:20214530-20214552 GTGAGCAGAGATCACGCCACTGG + Intergenic
1005620941 6:27619490-27619512 GTGAGCTATGGTCACGCCCCTGG + Intergenic
1005665795 6:28053009-28053031 GTGAGCTATAATCACGCCACTGG + Intergenic
1005676499 6:28160895-28160917 GTGAGCTATGATTATGCCACTGG + Intergenic
1005745976 6:28838048-28838070 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1006100721 6:31684481-31684503 GTGAGCTGTGATCGTGCCACCGG - Intergenic
1006269303 6:32951573-32951595 GTGAGCCATGATTGTGCCACTGG + Intronic
1006363544 6:33601049-33601071 GTGAGCTATAATCCTGCCACTGG + Intergenic
1006376671 6:33675364-33675386 GTGAGCCAAGATCATGCCACTGG + Intronic
1006488074 6:34361163-34361185 GTGAGCTATGATCACACCACTGG + Intronic
1006492906 6:34399830-34399852 GTGAGCTGAGATCATGCCACTGG + Intronic
1006533058 6:34673769-34673791 GTGAGCTGTGATCATGCCGCTGG + Intronic
1007139471 6:39556066-39556088 GTGAGTAAAGATCATGCCTATGG + Intronic
1007568372 6:42870862-42870884 GTGAGCCATGATCATGCCACTGG + Intergenic
1007685649 6:43665879-43665901 GTGAGCCAAGATCATCCCACTGG - Intronic
1007771991 6:44199737-44199759 GCGAACAGTGATCATGCCACTGG - Intergenic
1007986261 6:46210046-46210068 GTAAGCCGTGATCATGCCACTGG + Intergenic
1007989300 6:46238607-46238629 GTGAGCTGTGATCCTGCCCCTGG - Intronic
1008398893 6:51040655-51040677 GTGAGCCGAGATCATGCCACTGG - Intergenic
1008644009 6:53495028-53495050 GTGAGCTGTGATCATGCCACTGG - Intergenic
1010218248 6:73424376-73424398 GTGAGCCAAGATCATGCCACTGG + Exonic
1010976176 6:82316543-82316565 GTGAGCTAAGATCATGCCACTGG - Intergenic
1011047187 6:83097952-83097974 ATGAGCTATAATCATGCCACTGG - Intronic
1011286969 6:85735339-85735361 GTGAGCCTAGATCATGCCACTGG - Intergenic
1011471937 6:87716679-87716701 GTGAGCCAAGATCATGCCATTGG + Intergenic
1011653973 6:89532927-89532949 GTGAGCCAAGATCACGCCACTGG - Intronic
1011756738 6:90507778-90507800 GTGAGCCAAGATCATGCCACTGG - Intergenic
1012168259 6:95986571-95986593 GTGAGCAGTGATCATGCCACTGG - Intergenic
1012516358 6:100065244-100065266 GTGAGCAGAGATCATGCCACTGG - Intergenic
1013263722 6:108472857-108472879 GTGACCCAAGATCATGCCACTGG - Intronic
1013515965 6:110886165-110886187 GTGAGCAGAGATCATGCCACTGG + Intronic
1013790909 6:113835372-113835394 GTGAGCTGTGATCATGCCACTGG + Intergenic
1014071960 6:117192462-117192484 GTGAGCCTAGATCATGCCACTGG + Intergenic
1014216012 6:118753472-118753494 GTGAGCCATGATTATGCCACTGG - Intergenic
1014617088 6:123616273-123616295 GTGAGCTATGATCATGCCACTGG + Intronic
1014628889 6:123765282-123765304 GTGAGCCAAGATCACGCCACTGG - Intergenic
1015071839 6:129104078-129104100 GTGAGCTATAATCATGCCACTGG - Intronic
1015537722 6:134283433-134283455 GTGAGCGAAGATCACGCCACTGG + Intronic
1015539947 6:134303726-134303748 GTGAGCTATGATCCAGCCACTGG + Intronic
1015747220 6:136522977-136522999 GTGAGCTATGATCATGCCATTGG + Intronic
1016149435 6:140721205-140721227 ATGAGCCATGATCCTGCCACTGG + Intergenic
1016170987 6:141016866-141016888 GTGAGCTGTGATCATGCCACTGG - Intergenic
1016376429 6:143425456-143425478 GTGAGCTGTGATCATGCCACTGG + Intronic
1016890321 6:148999998-149000020 GTGAGCAATGATGAATCCACAGG + Intronic
1017064171 6:150513410-150513432 GTGAACAATGATCGTACCACAGG - Intergenic
1017098821 6:150829560-150829582 GTGAGCCAAGATCATGCCAAGGG + Intronic
1017153573 6:151303135-151303157 GTGAGCCAAGATCATGCCATTGG + Intronic
1017181088 6:151552840-151552862 GTGAGCTGAGATCATGCCACTGG - Intronic
1017189669 6:151639081-151639103 GTGAGCCATGATCACGCCACTGG - Intergenic
1017353868 6:153478829-153478851 GTGAGCTGAGATCATGCCACTGG + Intergenic
1017382128 6:153843281-153843303 GTGAGCCAAGATCATCCCACTGG + Intergenic
1017417252 6:154234150-154234172 GTGAGCTATGATCACACCACTGG + Intronic
1017428854 6:154350774-154350796 GTGAGCTATGATTGTGCCACTGG - Intronic
1017842089 6:158230886-158230908 GTGAGCTATAATCATGCCTGTGG - Intergenic
1017900392 6:158714294-158714316 GTGAGCCAAGATCACGCCACTGG + Intronic
1018508925 6:164504195-164504217 GTGAGCCAAGATCGTGCCACTGG - Intergenic
1018672769 6:166193358-166193380 GTGAGCCGAGATCATGCCACTGG + Intergenic
1018880485 6:167874186-167874208 GTGAGCAATGACTGTGCCACTGG + Intronic
1019014024 6:168866873-168866895 GTGAGCAATGAGCTTGGTGCAGG + Intergenic
1019030102 6:169002457-169002479 GTGAGCCAAGATCTTGCCACTGG + Intergenic
1019364587 7:626764-626786 GTGAGCTATGATCATGCCACTGG - Intronic
1019396974 7:826169-826191 GTGAGCTGTGATCACGCCCCTGG + Intronic
1019512997 7:1427475-1427497 GTGAGCTATGATCACACCACTGG + Intergenic
1019541371 7:1552997-1553019 GTGAGCACTGATTGTGCCACCGG + Intronic
1019683057 7:2363415-2363437 GTGAGCTATGATTGTGCCACTGG + Intronic
1019974342 7:4568690-4568712 GTGAGCTATGATTGTGCCACTGG - Intergenic
1020018362 7:4845360-4845382 GTGAGCTATGATTGTGCCACTGG + Intronic
1020062906 7:5166060-5166082 GTGAGTCAAGATCATGCCACTGG - Intergenic
1020110888 7:5447170-5447192 GTGAGCTATGATTGTGCCACTGG - Intronic
1020283279 7:6662394-6662416 GTGAGCCAAGATCATGCCATGGG - Intergenic
1020330599 7:7013332-7013354 GTGAACTATGATCATGCCACTGG - Intergenic
1020792670 7:12645261-12645283 GTGAGCCAAGATCGTGCCACTGG + Intronic
1020920420 7:14257105-14257127 GTGAGCTATGATCTTGCCAATGG + Intronic
1021281215 7:18720735-18720757 GTGAGCCACGATCAGGCCACTGG - Intronic
1021726477 7:23552082-23552104 GTAAGCCAGGATCATGCCACTGG - Intergenic
1022657052 7:32329174-32329196 GTAAGCTGTGATCATGCCACTGG + Intergenic
1023246188 7:38206824-38206846 GTGAGCTATGATCATGCCACTGG - Intronic
1023313928 7:38915851-38915873 GTGAGCCAAGATCCTGCCACTGG - Intronic
1023406444 7:39838407-39838429 GTGAGCCATGATCATGCCACTGG - Intergenic
1025246112 7:57318703-57318725 GTGGGCTATGATCTTGCCACTGG + Intergenic
1025717670 7:63977095-63977117 GTGAGCCATGATCACGCCACTGG + Intergenic
1025928416 7:65976883-65976905 GTGAGCTATGATCTTGAGGCAGG + Intronic
1026079693 7:67206573-67206595 GTGAGCCAAGATCGTGCCACTGG + Intronic
1026159956 7:67860025-67860047 GTGAGCCAAGATCATACCACTGG - Intergenic
1026566962 7:71497020-71497042 GTGAGCTATGATCAAGCCACTGG + Intronic
1026961130 7:74408334-74408356 GTGAGCCAAGATCGTGCCACTGG - Intergenic
1027024332 7:74840148-74840170 GTGCGCAGAGATCATGCCACTGG - Intronic
1027063433 7:75103974-75103996 GTGCGCAGAGATCATGCCACTGG + Intronic
1027329537 7:77077368-77077390 GTGAGCCGAGATCATGCCACTGG - Intergenic
1027474650 7:78614052-78614074 GTGAGCTGAGATCATGCCACTGG + Intronic
1028038119 7:86011790-86011812 GTGAGCCGAGATCATGCCACTGG - Intergenic
1028196875 7:87917442-87917464 GTGAGCCGAGATCATGCCACTGG - Intergenic
1028206097 7:88019417-88019439 GTGAGCCGAGATCATGCCACTGG + Intronic
1028206872 7:88027845-88027867 GTGAGCCAAGATAATGCCTCTGG - Intronic
1028867952 7:95735676-95735698 GTGAGCCATGAACATGCCTAGGG - Intergenic
1028881403 7:95884456-95884478 GTGAGCTATGATCATGCCACTGG - Intronic
1028881507 7:95885532-95885554 GTGAGCTATGATCATGCCACTGG - Intronic
1029203833 7:98856551-98856573 GTGAGCCATGATTGTGCCACTGG - Intronic
1029354075 7:100037962-100037984 GTGAGCTAAGATCATGCCACTGG + Exonic
1029365872 7:100115913-100115935 GTGAGCCAAGATCGTGCCACTGG + Intronic
1029671385 7:102034088-102034110 GTGAGCTGAGATCATGCCACTGG + Intronic
1030067212 7:105669136-105669158 GTGAGCCAAGATCACGCCGCTGG - Intronic
1030587769 7:111442079-111442101 GTGAGCAGAGATCATGCCAGTGG + Intronic
1030839225 7:114327974-114327996 GTGAGCCATGATAGTGCCACTGG - Intronic
1031027466 7:116695926-116695948 GTGAGCCAAGATCGTGCCACTGG - Intronic
1031038761 7:116816776-116816798 GTGAGCTATGATCATGCCCCTGG + Intronic
1031388356 7:121181136-121181158 GTGAGAGATGATCATACTGCAGG + Intronic
1031501629 7:122525082-122525104 GTGAGCCATGATAGTGCCACTGG + Intronic
1031943585 7:127815432-127815454 GTGAACCATGATCATGCCACTGG + Intronic
1032140196 7:129322193-129322215 GTGAGCCAAGATCACGCCACTGG - Intronic
1032300184 7:130679563-130679585 GTGAGTCATGATCATGCCACTGG - Intronic
1032714284 7:134491572-134491594 GTGAGCCAAGATCATGCCACTGG + Intergenic
1032722409 7:134561267-134561289 GTGAGCCAAGATTATGCCACTGG - Intronic
1032979916 7:137269686-137269708 GTGAGCAGAGGTCATGCCACTGG - Intronic
1033068644 7:138180916-138180938 GTGAGTTATGATCATGTCACTGG + Intergenic
1033074150 7:138232994-138233016 GTGAGCTAAGATCATGCCACTGG + Intergenic
1033316177 7:140299562-140299584 GTGAGCTATGATTATGCTGATGG - Intronic
1033461938 7:141554282-141554304 GTGAGCTATGATTGTGCCACTGG + Intronic
1034616251 7:152419293-152419315 GTGAGCCGAGATCATGCCACTGG + Intronic
1034627600 7:152505429-152505451 GTGAGCCAAGATCAGGCCACTGG - Intergenic
1035415292 7:158678630-158678652 GTGAGTGATGATCACGCCACTGG + Intronic
1035421713 7:158734730-158734752 GTGAGCCATGATCGCGCCACTGG + Intronic
1036199136 8:6752119-6752141 GTGAGCTAAGATCGTGCCACTGG + Intronic
1036527472 8:9548523-9548545 GTGAGCCAAGATCACGCAGCTGG - Intergenic
1036532060 8:9600367-9600389 GTGAGCCATGATCACACCACTGG - Intronic
1036568877 8:9962126-9962148 GTGAGCTGAGATCATGCCACTGG + Intergenic
1037018732 8:13941853-13941875 GTGAGCTGAGATCATGCCACTGG - Intergenic
1037094149 8:14963392-14963414 GTGAGCCAAGATTGTGCCGCTGG - Intronic
1037288621 8:17327324-17327346 GTAAGCCATGATCGTGCCACTGG - Intronic
1037412060 8:18608162-18608184 GTGAGCCATGATCGTGCCACTGG + Intronic
1037780569 8:21865661-21865683 GTGAGCCATGATCACACCACTGG + Intergenic
1038317822 8:26502513-26502535 GTGAGCCATGATCACACCGCTGG - Intronic
1038378506 8:27068681-27068703 GTGAGCAATGATCATGCCACTGG + Intergenic
1038918304 8:32052329-32052351 GTGAGCTATGATCACACCACTGG - Intronic
1039450489 8:37670653-37670675 GTGAGCAGTGTTCATGCCACTGG + Intergenic
1039549613 8:38433278-38433300 GTGAGCTATGATCATGCCACTGG + Intronic
1039681528 8:39742688-39742710 GTGAGCCAAGATCATGCCATTGG + Intergenic
1039736155 8:40335158-40335180 GTGAGCAGAGATCATGCCATTGG + Intergenic
1039853826 8:41395731-41395753 GTGAGCAGTGATCATGGTGGAGG - Intergenic
1039904890 8:41779301-41779323 GTGAGCTATGATTGTGCCACTGG - Intronic
1040053290 8:43036048-43036070 GTGAGCCGAGATCATGCCACTGG - Intronic
1040356672 8:46625173-46625195 GTGAACTATGATCATGCCACTGG - Intergenic
1040508078 8:48069566-48069588 GTGAGCCAAGATCACGCCACTGG + Intergenic
1041127161 8:54654701-54654723 GTGAGCCATGATCGTGCTACTGG - Intergenic
1042041220 8:64592130-64592152 GTGAGCTGAGATCATGCCACTGG + Intronic
1042236243 8:66616049-66616071 GTGAGCCAAGATCATGCCACTGG - Intergenic
1042310892 8:67378741-67378763 ATGAGCCATAATCATGCCACTGG - Intergenic
1042378338 8:68081748-68081770 GTGAGCCGAGATCATGCCACTGG - Intronic
1042903802 8:73753295-73753317 GTGAGCCATGATTGTGCCACTGG - Intronic
1042915597 8:73872955-73872977 GTGAGCGGAGATCATGCCACTGG - Intronic
1043039370 8:75241644-75241666 GTGAGCTATGATTGTGCCACTGG + Intergenic
1043860884 8:85315616-85315638 GTGAGCCAAGATCATGCCAGTGG + Intergenic
1043937985 8:86165023-86165045 GTGAGCTATGGTCATGCTCCTGG - Intergenic
1043942410 8:86210628-86210650 GTGAGCAAAGATCGTGCCAATGG + Intergenic
1044423392 8:92024451-92024473 GTGAGCCAAGATCCTGCCACTGG + Intronic
1044499862 8:92941120-92941142 GTGAGCCAAGATCACGCCACTGG - Intronic
1045205041 8:100029645-100029667 GTGAGCCAAGATCATGCCATTGG + Intronic
1045290929 8:100832075-100832097 GTGAGCCGAGATCATGCCACTGG - Intergenic
1045370691 8:101519452-101519474 GTGAGCTATGATCACACCACTGG - Intronic
1045424981 8:102056798-102056820 GTGAGCAATTCTCATGGCTCAGG + Intronic
1045622887 8:104003467-104003489 GTGAGCCAAGATCATGCCATTGG - Intronic
1046008057 8:108509895-108509917 GTGAGCTATGATCATGTCACAGG + Intergenic
1046493816 8:114987177-114987199 GTGAGCTGTGATCCTGCCACTGG + Intergenic
1046542051 8:115598361-115598383 GTAAGCCATGATCATGCCACTGG - Intronic
1046591830 8:116216113-116216135 GTGAGCCAAGATTATGCCACTGG - Intergenic
1047229352 8:122983058-122983080 GTGAGCCGAGATCATGCCACTGG - Intergenic
1047451534 8:124969287-124969309 GTGAGCTGAGATCATGCCACTGG + Intergenic
1047687043 8:127315542-127315564 GTGAGCCATGATCGTGCCACTGG + Intergenic
1047738090 8:127784195-127784217 GTGAGCCAGGATCATGCCACTGG + Intergenic
1048612435 8:136038045-136038067 GTGAGCCGAGATCATGCCACTGG + Intergenic
1048761863 8:137804195-137804217 GTGAGCTGAGATCATGCCACTGG + Intergenic
1048900887 8:139036785-139036807 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1050315710 9:4398741-4398763 GTGAGCCAAGATCGTGCCACTGG - Intergenic
1050508410 9:6370442-6370464 GTGAGCTGGGATCATGCCACTGG - Intergenic
1050515703 9:6442019-6442041 GTGAGCCAAGATCGTGCCACTGG - Intronic
1050633605 9:7586266-7586288 GTGAGCCAAGATCATGCCACTGG - Intergenic
1051274496 9:15386124-15386146 GTGAGCCAAGATCACGCCACTGG + Intergenic
1051517960 9:17951871-17951893 GTGAGCTACGATCATGCCACTGG - Intergenic
1051637971 9:19198017-19198039 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1052014737 9:23451497-23451519 GTAAGCTATGATCACACCGCTGG + Intergenic
1052182473 9:25546593-25546615 GTGAGCCGAGATCATGCCACTGG - Intergenic
1052940598 9:34129031-34129053 GTGAGCTGAGATCATGCCACTGG + Intergenic
1052976752 9:34416680-34416702 GTGAGCCAAGATCATGCCACTGG + Intronic
1053260610 9:36660371-36660393 GTGAGCCATGATCACACCACTGG - Intronic
1053300717 9:36947450-36947472 GTGAGCCATGATCATGCCACTGG - Intronic
1053556425 9:39142614-39142636 GTGAGCTGAGATCATGCCACTGG + Intronic
1053722833 9:40965146-40965168 GTGAGCTATGTTCTTGCCACTGG - Intergenic
1054089405 9:60831025-60831047 GTGAGCTGAGATCATGCCACTGG + Intergenic
1054110816 9:61106583-61106605 GTGAGCTGAGATCATGCCACTGG + Intergenic
1054343134 9:63886853-63886875 GTGAGCTATGATCTTGCCACTGG + Intergenic
1054610041 9:67224542-67224564 GTGAGCTGAGATCATGCCACTGG - Intergenic
1054868885 9:70030939-70030961 GTGAGCCGAGATCATGCCTCTGG - Intergenic
1054882372 9:70158010-70158032 GTGAGCTATGATCACACCACTGG - Intronic
1055412138 9:76042126-76042148 GGGGGCAATGATCTTGCCACAGG - Intronic
1055434144 9:76275478-76275500 GTAAGCCAAGATCATGCCACTGG - Intronic
1055527029 9:77145335-77145357 GTGAGCTGTGATCATACCACTGG - Intergenic
1055649160 9:78390063-78390085 GTGAGCCGAGATCATGCCACTGG + Intergenic
1055790628 9:79919607-79919629 GTGAGCAAAGATCATGCCACTGG - Intergenic
1055830537 9:80373062-80373084 GTGAGCTAAGATCATGTCACTGG - Intergenic
1056130984 9:83586338-83586360 GTGAGCCAAGATCATGCCACTGG + Intergenic
1056370726 9:85951709-85951731 GTGAGCAGAGATCATGCCACTGG - Intronic
1056731610 9:89170587-89170609 GTGAGCCATGATCAGGCCACTGG + Intronic
1057154129 9:92825465-92825487 GTGAGCCAAGATCGTGCCACTGG - Intergenic
1057433419 9:95016666-95016688 GTGAGCCATAATCATGCCATTGG - Intronic
1057586685 9:96334580-96334602 GTGAGCCAAGATCGTGCCACTGG + Intronic
1057636130 9:96769379-96769401 GTGAGCCAAGATCGTGCCACTGG + Intronic
1057688436 9:97259989-97260011 GTGAGCCATGATAGTGCCACTGG - Intergenic
1057815918 9:98294532-98294554 GTGAGCCAAGATAATGCCACTGG - Intronic
1058131021 9:101253483-101253505 GTGAGCCAAGATCATGCCCCTGG + Intronic
1058143337 9:101381466-101381488 GTGAGCTGTGATCATGCCACTGG + Intronic
1058798477 9:108521260-108521282 GTGAGAAATCATCATGCAGTGGG + Intergenic
1059104530 9:111500368-111500390 GTGAGCCATGATCACACCACTGG - Intergenic
1059218967 9:112593918-112593940 GTGAACTATGATCATGCCACTGG - Intronic
1059755151 9:117286405-117286427 GTGAGCCAGGATCACGCCACTGG - Intronic
1060028544 9:120193614-120193636 GTGAGCTGAGATCATGCCACTGG + Intergenic
1060211345 9:121712383-121712405 GGGAGCAATGCTTATGCAGCAGG + Intronic
1060339184 9:122758566-122758588 GTGAGCCAAGATCATGCCACTGG - Intergenic
1060621280 9:125069371-125069393 GTGAGCCAAGATCACGCCACTGG - Intronic
1061222622 9:129261002-129261024 GTGAGCTGAGATCATGCCACTGG - Intergenic
1061640833 9:131953871-131953893 GTGAGCCAAGATCATGCCACTGG - Intronic
1061761352 9:132854142-132854164 GTGAGCTGTGATCATGCCACTGG + Intronic
1062626331 9:137444160-137444182 GTGAGCTATGATCCTGCCACTGG - Intergenic
1203452328 Un_GL000219v1:130832-130854 GTGAGCTATGATCTTACCACTGG + Intergenic
1185768656 X:2747934-2747956 GTGAGCCGAGATCATGCCACTGG - Intergenic
1185946498 X:4383091-4383113 GTGAGCTGAGATCATGCTGCTGG - Intergenic
1186049013 X:5569531-5569553 GTCAGCTATGATCATGCCACTGG - Intergenic
1186085397 X:5983888-5983910 GTGAGCTATGATTGTGCCACTGG + Intronic
1186203256 X:7175436-7175458 GTGAGCCATGATCATGCCACTGG + Intergenic
1186397672 X:9226125-9226147 GTGAGCCATGATCACACCACTGG - Intergenic
1186646423 X:11511880-11511902 GTGAGCTGAGATCATGCCACTGG - Intronic
1186889697 X:13948083-13948105 GTGAGCTATGATCAGGCCACTGG - Intergenic
1187158711 X:16744908-16744930 GTGAGCCATGATCACGCCACTGG + Intronic
1187414067 X:19076711-19076733 GTGAGCCAAGATCGTGCCACTGG + Intronic
1187420684 X:19131067-19131089 TTGAGCAATGCTGATGCTGCTGG + Intergenic
1187469811 X:19559380-19559402 GTGAGCCAAGATCGTGCCACTGG - Intronic
1187884060 X:23872339-23872361 GTGAGCTATGATCACGCCACTGG + Intronic
1187983630 X:24786562-24786584 GTGAGCTATGATTGTGCCACTGG - Intronic
1188304205 X:28542549-28542571 GTGAGCTGAGATCATGCCACTGG - Intergenic
1189071750 X:37870927-37870949 GTGAGCCAAGATCAAGCCACTGG + Intronic
1189072823 X:37882916-37882938 GTGAGCCGAGATCATGCCACTGG + Intronic
1189238313 X:39505953-39505975 GTGAGCCATGAGCATGCCACTGG + Intergenic
1190124582 X:47692600-47692622 GTGAGCCAAGATCACGCCACTGG - Intergenic
1190191794 X:48282755-48282777 GTGAGCCGAGATCATGCCACTGG - Intergenic
1190325231 X:49203118-49203140 GTGAGCCATATTCATGCCACTGG - Intergenic
1190853392 X:54268435-54268457 GTGAGCCATGATCTTGCCACTGG + Intronic
1192365983 X:70473647-70473669 GTGAGCTATGATCACACCTCTGG - Intronic
1192443519 X:71192949-71192971 GTGAGCTAAGATCATGCCACTGG - Intergenic
1192818286 X:74616738-74616760 GTGAGCTGAGATCATGCCACTGG - Intergenic
1193418424 X:81253407-81253429 GTGATCCATGACCATGCCACTGG - Intronic
1193535443 X:82709791-82709813 GTGAGCCGAGATCATGCCACTGG - Intergenic
1193813403 X:86078113-86078135 AAGAGCTATGATCATGCCACTGG + Intergenic
1194722837 X:97360566-97360588 GTGAGCCAAGATCGTGCCTCTGG + Intronic
1194734672 X:97497748-97497770 GTGAGCCAATATCATGCCACTGG + Intronic
1195077681 X:101343074-101343096 GTGAGCCGAGATCGTGCCGCTGG + Intergenic
1195448602 X:104982524-104982546 TTGACCAATGATTATGCCTCAGG - Intronic
1195663163 X:107401858-107401880 GTGAGCTATGATCACACCACTGG + Intergenic
1196137182 X:112222675-112222697 GTGAGCTGTGATCATGCCACTGG + Intergenic
1197973541 X:132140661-132140683 GTGAGCCGAGATCATGCCACTGG - Intergenic
1198003915 X:132471632-132471654 GTGAGCTATGATCGTGCCACTGG + Intronic
1198114253 X:133529955-133529977 GTGAGCCAAGATCACGCCACTGG - Intergenic
1198181048 X:134209403-134209425 GTGAGCCAAGATCATGCCACAGG + Intergenic
1198182779 X:134225581-134225603 GTGAGCCAAGATCATGCCACAGG + Intergenic
1198465793 X:136903705-136903727 GTGAGCCAAGATCATGCTGCTGG - Intergenic
1198617080 X:138470411-138470433 GTGAGCCAAGATCGTGCCACTGG + Intergenic
1200782232 Y:7227093-7227115 GTGAGCCAAGAGCATGCCACTGG + Intergenic
1201267647 Y:12223657-12223679 GTGAGCAAAGATCATGCCATGGG + Intergenic
1201301718 Y:12511047-12511069 GTGAGCCGAGATCATGCCACTGG + Intergenic
1201381389 Y:13383536-13383558 GTGAGCTGAGATCATGCCACTGG + Intronic
1201577360 Y:15475376-15475398 GTGAGCTGAGATCATGCCACTGG + Intergenic
1201673671 Y:16554823-16554845 GTAAGCTATGATCATGCCAATGG + Intergenic
1201751036 Y:17432408-17432430 GTGAGCCAAGATCATGCCACTGG - Intergenic
1201787635 Y:17803220-17803242 GTGAGCCAAGATCATGCCACTGG - Intergenic
1201813918 Y:18102768-18102790 GTGAGCCAAGATCATGCCACTGG + Intergenic