ID: 1125953091

View in Genome Browser
Species Human (GRCh38)
Location 15:43770549-43770571
Sequence CTTTGGATTTAGCTTCTTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 2, 1: 0, 2: 1, 3: 23, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125953091 Original CRISPR CTTTGGATTTAGCTTCTTGT TGG (reversed) Exonic