ID: 1125954185

View in Genome Browser
Species Human (GRCh38)
Location 15:43777738-43777760
Sequence GGTCTCAGTGCACCAGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125954185_1125954187 -6 Left 1125954185 15:43777738-43777760 CCAGATCCTGGTGCACTGAGACC 0: 1
1: 0
2: 3
3: 14
4: 230
Right 1125954187 15:43777755-43777777 GAGACCCCAGCACCAACCTCTGG 0: 1
1: 0
2: 4
3: 23
4: 254
1125954185_1125954191 5 Left 1125954185 15:43777738-43777760 CCAGATCCTGGTGCACTGAGACC 0: 1
1: 0
2: 3
3: 14
4: 230
Right 1125954191 15:43777766-43777788 ACCAACCTCTGGCCAGCCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125954185 Original CRISPR GGTCTCAGTGCACCAGGATC TGG (reversed) Intronic
900166020 1:1244701-1244723 GGGCTCAGGGCATCAGGCTCTGG - Intronic
901284756 1:8068446-8068468 GGTTGCAGTGAGCCAGGATCGGG + Intergenic
901891625 1:12271342-12271364 TGTCTCCTTGCACCAGGATGAGG + Intronic
902184052 1:14711859-14711881 AGTTTCTGTGCACCAGGATCTGG - Intronic
902471869 1:16653517-16653539 GTTCTCAGAGCAACAGCATCAGG - Intergenic
902486935 1:16753927-16753949 GTTCTCAGAGCAACAGCATCAGG + Intronic
903056226 1:20638043-20638065 GGTACCAGTGCACCAGGAGAAGG + Exonic
903336925 1:22630929-22630951 GGTTGCAGTGAACCAAGATCAGG - Intergenic
904526036 1:31134709-31134731 GGTTTCAGTGAACCATGATTAGG - Intergenic
904688121 1:32275069-32275091 GGACTCACTGCTCCAGGATGCGG - Exonic
904774813 1:32900300-32900322 GGTTTCAGTGAGCCACGATCAGG - Intronic
905556013 1:38884709-38884731 GGTTTCAGTGAACCAAGATCCGG + Intergenic
908776660 1:67647294-67647316 GGGCTCAGGGCCCCAGGATAAGG - Intergenic
909155488 1:72069379-72069401 GGTTGCAGTGTACCAGGATTGGG + Intronic
910961745 1:92770876-92770898 GGTTGCAGTGAACCGGGATCGGG - Intronic
911574785 1:99562542-99562564 GGTTGCAGTGAACCAAGATCAGG - Intergenic
916297699 1:163237804-163237826 TGTCTCAGTCAACCAGGATTTGG + Intronic
916698299 1:167263452-167263474 GGTTGCAGTGCGCCAAGATCGGG + Intronic
918494127 1:185114573-185114595 GGTTTCAGTGAGCCAGGATCGGG - Intergenic
918528789 1:185494623-185494645 GGTTTCAGTGAGCCAAGATCGGG - Intergenic
919655317 1:200191901-200191923 GGTTGCAGTGAGCCAGGATCTGG + Intergenic
920326533 1:205169382-205169404 AGTGGCAGTGCACCAGGTTCAGG + Exonic
922886392 1:229024096-229024118 CTTGTCAGTGCACCAGGTTCTGG + Intergenic
924326018 1:242894589-242894611 GGTCACAGTGAGCCAAGATCAGG - Intergenic
1062941002 10:1421342-1421364 GGTCTCAGTGTCTCAGGGTCAGG + Intronic
1063559236 10:7111049-7111071 GGTTGCAGTGAGCCAGGATCGGG + Intergenic
1063856494 10:10259977-10259999 AGTCTTAGCGCACCAGGAACTGG - Intergenic
1064219168 10:13425006-13425028 GGTGTCTGTGAACCAGGAACAGG + Intergenic
1066560914 10:36668887-36668909 GGTTTCAGTGGGCCAAGATCAGG - Intergenic
1067260138 10:44682370-44682392 GGTCTCTGGGCACGTGGATCTGG - Intergenic
1067702166 10:48581876-48581898 GCTTTCAGTGCAACAGGAACTGG - Intronic
1070021609 10:72592070-72592092 GGTTGCAGTGAGCCAGGATCGGG - Intronic
1072462984 10:95637415-95637437 GGTATCAGTGCTGCAGAATCAGG - Exonic
1073231690 10:101976275-101976297 GGTTGCAGTGAACCAAGATCGGG + Intronic
1073247434 10:102101407-102101429 GGTTGCAGTGCACTATGATCGGG + Intergenic
1074523817 10:114247826-114247848 GGTCACAGGGCACCAGGATGAGG + Intronic
1074589952 10:114803193-114803215 GGTTGCAGTGAACCAAGATCAGG + Intergenic
1075173981 10:120142684-120142706 GGTCTCTCTGCACCTGCATCAGG + Intergenic
1075385637 10:122053484-122053506 GGTCTCAATGCACCAGGCTCTGG - Intronic
1075689375 10:124385320-124385342 GGTCTCACTGCACATGGTTCTGG - Intergenic
1076023755 10:127095284-127095306 GGACTCAGGGCATCAGGATAGGG - Intronic
1079239594 11:18713213-18713235 GGTTGCAGTGAGCCAGGATCAGG - Intronic
1079384725 11:19968742-19968764 TCTATCAGTGCACCAGGAGCTGG - Intronic
1080457161 11:32428148-32428170 GGCCCCAGTGCCCCAGGCTCAGG - Intronic
1081186674 11:40051315-40051337 GGTTTCAGTGAACCAAGATAGGG + Intergenic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1081673013 11:44951924-44951946 GGTCACAGTGGGCCAGGAACCGG + Intergenic
1084376671 11:68782799-68782821 GGCCTCAGTGCACCCCGCTCGGG + Intronic
1084450457 11:69233696-69233718 GGTTTCAGTGTATCAGCATCTGG - Intergenic
1085440983 11:76562075-76562097 GGTCTGAATTCACCAGGAACTGG - Intergenic
1087562439 11:99807576-99807598 GGTTGCAGTGAACCAAGATCAGG - Intronic
1088306200 11:108410769-108410791 GGTTTCAGTGAGCCAAGATCAGG - Intronic
1091679511 12:2516717-2516739 GGTGTCAGGGCAGGAGGATCAGG + Intronic
1091847020 12:3664942-3664964 GGTTGCAGTGCGCCAAGATCAGG + Intronic
1092496433 12:8999970-8999992 GGTCTCAGTGAGCCGAGATCAGG + Intronic
1092864757 12:12750307-12750329 GGTTGCAGTGAACCAAGATCGGG + Intronic
1094737782 12:33254685-33254707 GGTGTCAGAGCCCCAGCATCAGG + Intergenic
1095420357 12:42018420-42018442 GGTCCAAGTGCAACAGGATTAGG - Intergenic
1095560177 12:43554757-43554779 CCTCTCAGAGCACTAGGATCAGG - Intergenic
1096383457 12:51178504-51178526 GGTCACAGTGAGCCAAGATCAGG + Intergenic
1096471035 12:51875825-51875847 GGTTGCAGTGAACCAAGATCGGG + Intergenic
1102531980 12:113553411-113553433 GGTCTCCGTGCAGCAGTTTCAGG + Intergenic
1103302454 12:119938436-119938458 GGTTGCAGTGAGCCAGGATCGGG - Intergenic
1104003877 12:124878670-124878692 GCCCTCAGTGCACCAGGACTGGG + Intronic
1104582473 12:130021314-130021336 GGCTTCAGTGAGCCAGGATCGGG - Intergenic
1104988061 12:132608445-132608467 GGGGTCAGGGCTCCAGGATCAGG - Intronic
1106704067 13:32261792-32261814 GGTCTGAGTGCTCCAGGATCTGG - Exonic
1111619559 13:90705983-90706005 GGTTGCAGTGAACCAAGATCAGG + Intergenic
1112114584 13:96338301-96338323 GGTCTCAGTGCACCGGGGAAAGG + Intronic
1112703333 13:102037280-102037302 GGTCTCAGTGGACTAAAATCAGG + Intronic
1113894594 13:113755509-113755531 TGTCTCATTCCACCAGGCTCAGG - Intergenic
1114995374 14:28344458-28344480 GATGTCAGTGCACCATGATCAGG - Intergenic
1115201928 14:30862750-30862772 GGTCGCAGTGAGCCAAGATCAGG + Intergenic
1119374613 14:74179591-74179613 GGTTGCAGTGAACCAAGATCAGG + Intronic
1121112904 14:91324489-91324511 GGTGTCAGTGCACTATAATCTGG + Intronic
1121489588 14:94348357-94348379 GTGCACAGTGCACCAGGATTTGG + Intergenic
1122488290 14:102096043-102096065 GGTCTGAGAGCACCAAGATCAGG - Intronic
1123755701 15:23396095-23396117 GGAGTCAGTGCACCTGGATGGGG + Intergenic
1124692845 15:31839731-31839753 GGTGTCACTGCACCATGGTCAGG + Intronic
1125171589 15:36771583-36771605 GGTCTCTGTAGACCAGCATCTGG + Intronic
1125315428 15:38426246-38426268 GGTTGCAGTGAGCCAGGATCAGG + Intergenic
1125612623 15:40982207-40982229 GGTTTCAGTGCACTGAGATCAGG - Intronic
1125954185 15:43777738-43777760 GGTCTCAGTGCACCAGGATCTGG - Intronic
1127705810 15:61546280-61546302 GCTCTCAGTGCACCAGGTAAAGG - Intergenic
1128812193 15:70580799-70580821 GGGCTCAGGCCACCAGGAGCAGG + Intergenic
1129792820 15:78352979-78353001 GGTTACAGTGAGCCAGGATCAGG + Intergenic
1131020540 15:89094185-89094207 GGTTGCAGTGCACCGAGATCGGG - Intronic
1131194233 15:90342313-90342335 GGTTGCAGTGAACCAAGATCAGG - Intergenic
1131734308 15:95315704-95315726 GGTTGCAGTGAACCAAGATCAGG + Intergenic
1132887460 16:2188944-2188966 GGGCTCAGGGCACCAGCTTCTGG - Intronic
1133080454 16:3314950-3314972 GGTCTCAGTGTTCCAGGAGCTGG + Intronic
1133293234 16:4736470-4736492 CTTCTCAGTGCACCATAATCCGG - Exonic
1134683287 16:16141515-16141537 TGTCTCAGGGCACCAGGGGCAGG - Exonic
1136172463 16:28497129-28497151 TGTCTCAGAGAACCAGGAGCTGG + Exonic
1136379148 16:29883867-29883889 GGTTGCAGTGAACCATGATCGGG + Intronic
1136706310 16:32190658-32190680 GGTTGCAGTGAACCAAGATCGGG + Intergenic
1136761599 16:32738753-32738775 GGTTGCAGTGAACCAAGATCGGG - Intergenic
1136806503 16:33131637-33131659 GGTTGCAGTGAACCAAGATCGGG + Intergenic
1137549909 16:49430362-49430384 GGTGTCAGAGCCCCAGCATCAGG + Intergenic
1138376042 16:56564819-56564841 GGTTTCAGGGAACCAGGCTCAGG - Intergenic
1139325091 16:66146324-66146346 GTTCTCAGAGCACCAGGAGAAGG - Intergenic
1139435388 16:66933919-66933941 GGTTTCTGTGCAGCAGGAGCTGG - Intronic
1140095320 16:71870447-71870469 GGTTACACTGCACCAGGACCAGG + Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1140810088 16:78568536-78568558 GGTTGCAGTGACCCAGGATCGGG - Intronic
1140869077 16:79090208-79090230 GGTCTGAGTGGGCCAGGGTCGGG + Intronic
1141118962 16:81335979-81336001 GCTCTCAGTGCACCAGTGTGAGG + Intronic
1142200370 16:88758215-88758237 GGTCTCGGTGCACAAGGACTTGG - Intronic
1203063754 16_KI270728v1_random:999066-999088 GGTTGCAGTGAACCAAGATCGGG - Intergenic
1142571897 17:880173-880195 TGTCTCCGGGGACCAGGATCAGG - Intronic
1143460648 17:7101408-7101430 GATCTCAGTCCTCCAGGGTCAGG + Exonic
1143744470 17:8981398-8981420 GGTTTCAGTGAGCCAAGATCAGG + Intergenic
1143851212 17:9813425-9813447 GGGCTGAGGGCAACAGGATCAGG + Intronic
1145278394 17:21450571-21450593 GCTGTCAGTGGCCCAGGATCTGG + Intergenic
1145823888 17:27861940-27861962 GGTTGCAGTGAACCAAGATCAGG + Intronic
1146613245 17:34327208-34327230 CTTCTCAGTGCACCATTATCAGG - Intergenic
1146669159 17:34724941-34724963 GATCTCAGAGCACCAGGCTGGGG + Intergenic
1147134248 17:38426005-38426027 GGTCTGAGGGCATCAGGCTCTGG + Intergenic
1151999281 17:77635262-77635284 GGTCACAGTGGCCCAGGAGCTGG + Intergenic
1155013982 18:21813864-21813886 AGTCTTAGAGTACCAGGATCAGG + Intronic
1157761303 18:50267499-50267521 GGTCACAGTGGACCAGGGTCAGG + Intronic
1157767507 18:50311412-50311434 GATCACAGTGGACCTGGATCAGG + Intergenic
1158286021 18:55884175-55884197 GGTTTCAGTGAGCCAAGATCGGG - Intergenic
1161024023 19:2026862-2026884 GGGCTCACTGTACCAGGATAGGG - Intronic
1161386921 19:3999604-3999626 GGTTGCAGTGCACCGAGATCAGG + Intergenic
1161722864 19:5913376-5913398 GGTCTTAGGGCCCCAGGACCTGG + Intronic
1164474904 19:28568417-28568439 TGTCTCTGTGCAGGAGGATCTGG - Intergenic
1164767645 19:30784086-30784108 GGTCACAGAGCAGCAGGATGGGG + Intergenic
1164838147 19:31371920-31371942 GGTATCACTGCACCAGACTCTGG + Intergenic
1166078997 19:40431713-40431735 GGTTGCAGTGAGCCAGGATCAGG + Intergenic
1166716273 19:44970175-44970197 GGTTTCCTTGCACCAGGTTCAGG + Intronic
1167135272 19:47611931-47611953 GGTTGCAGTGAACCAAGATCAGG - Intronic
1167725921 19:51212435-51212457 GGTGTCAGATCACCAGGATGAGG - Intergenic
1168056034 19:53865960-53865982 GGTCTCAGTGCACCCAGATCAGG - Intergenic
1168673626 19:58260337-58260359 GGTTGCAGTGAACCAAGATCGGG - Intronic
1202704269 1_KI270713v1_random:10311-10333 GTTCTCAGAGCAACAGCATCAGG - Intergenic
925187566 2:1859779-1859801 GGTATCAGGGCACCAGGGCCAGG - Intronic
925205197 2:2000186-2000208 GGACTCTGTGCACCAGGTTGTGG - Intronic
928668498 2:33576417-33576439 GGTTTCAGTGAGCCAAGATCAGG - Intergenic
928916687 2:36479543-36479565 GGTCTCCGTGGGCAAGGATCAGG - Exonic
929122567 2:38495505-38495527 GGTCACAGTGCTCCCGGAACTGG - Intergenic
929725082 2:44416994-44417016 GGTTTCAGTGAGCCATGATCAGG - Intronic
932286697 2:70539957-70539979 AGTCTCAGTTCACCAGAATGTGG + Intronic
932595310 2:73089605-73089627 GGTCTCTGAGCACCAGGAGAAGG - Intronic
932882764 2:75519054-75519076 GATCTCAGTGCTCCAGCCTCTGG + Intronic
933073395 2:77891271-77891293 GGTCTTAGTGCACCAGGTAGTGG - Intergenic
934527103 2:95058751-95058773 GCTCTCAGCTCACCAAGATCTGG - Intergenic
936753221 2:115672807-115672829 GGTTGCAGTGAACCAAGATCAGG - Intronic
938267373 2:129938195-129938217 GGTTTCAGTGAGCCAAGATCGGG + Intergenic
946079907 2:217108904-217108926 GGTCCCACTGCAGCAGGGTCTGG + Intergenic
948594799 2:239072997-239073019 GGACGCGGGGCACCAGGATCAGG - Intronic
1169153935 20:3313249-3313271 GGGTTCTCTGCACCAGGATCTGG + Intronic
1169550080 20:6693446-6693468 GGTCTCTGTGAAATAGGATCAGG - Intergenic
1172725092 20:37033672-37033694 GGTCTCAGTGAGCCAAGATGAGG - Intronic
1173443348 20:43096661-43096683 CTTCTCAGTGCATCTGGATCTGG - Intronic
1174220854 20:48954040-48954062 AGCCTCAGTGCAACAGGTTCAGG + Intronic
1174831253 20:53814292-53814314 GGTTTCTGTGCACCAGCAACTGG - Intergenic
1175647507 20:60687253-60687275 GGTCGCAGTGAGCCAAGATCGGG + Intergenic
1176044087 20:63083502-63083524 GCACTCAGTGACCCAGGATCTGG - Intergenic
1176103382 20:63374636-63374658 GGTCTCAGAGTAGCAGGCTCAGG + Intronic
1176204865 20:63882833-63882855 GGTCTCAGGGCAGCAGAGTCAGG - Intronic
1177041701 21:16120802-16120824 GGTTGCAGTGAGCCAGGATCAGG - Intergenic
1178209450 21:30511911-30511933 GGTTTCAGTGAGCCATGATCAGG + Intergenic
1179189373 21:39109641-39109663 GGTATAACTGCACCAGGCTCTGG - Intergenic
1179887293 21:44319625-44319647 GGGCCCAGTGCACAGGGATCTGG + Intronic
1180825014 22:18855928-18855950 GGTCTCAGTGGCCCAGGACAAGG + Intronic
1181032933 22:20157014-20157036 TGTCTCTGTGCCCCAGGACCAGG + Intergenic
1181123204 22:20686450-20686472 GGTCGCAGTGAGCCAAGATCAGG + Intergenic
1181187717 22:21118620-21118642 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1181211481 22:21291873-21291895 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
1181500764 22:23314385-23314407 GGTCTCAGTGGCCCAGGACAAGG - Intronic
1181651385 22:24261046-24261068 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
1181652454 22:24267668-24267690 GGTCGCAGTGAGCCAAGATCAGG + Intergenic
1181705993 22:24649693-24649715 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1183333636 22:37234563-37234585 GGTCTCAGTGGACCAGGTCAGGG - Intronic
1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG + Intronic
1184661047 22:45965652-45965674 GGTCTCAGAGCTCCTGGGTCAGG + Intronic
1203215467 22_KI270731v1_random:3558-3580 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1203275159 22_KI270734v1_random:81833-81855 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
951119466 3:18908199-18908221 GCTCTCAGAGCAACAGCATCAGG + Intergenic
962888605 3:139651719-139651741 GGTCTCAGGGTCCCAGGCTCCGG + Intronic
963366173 3:144337362-144337384 GGCCTCAGTGAACCAGAAACTGG - Intergenic
968001811 3:195211768-195211790 GGCCTCATTGCACAAAGATCTGG + Intronic
968015781 3:195331392-195331414 GTTCTCAGTGAGCCAAGATCGGG - Intronic
968620831 4:1602820-1602842 GGTCTGAGGGCAGCAGGAGCCGG + Intergenic
972678820 4:41286175-41286197 GGTGTCTGTGCACCAGGGGCTGG - Intergenic
978553347 4:109951293-109951315 GGTTTCAGTGAGCCAAGATCAGG + Intronic
980204244 4:129697377-129697399 GGTTGCAGTGAGCCAGGATCAGG + Intergenic
980533029 4:134079032-134079054 GGTTGCAGTGAACCAAGATCAGG - Intergenic
983052147 4:163061085-163061107 GGTCTCAGAGTCCTAGGATCTGG - Intergenic
985547681 5:518297-518319 GGTCTCAGGGTACCAGGTCCTGG - Intronic
987418618 5:17691972-17691994 CTCCTCAGGGCACCAGGATCTGG - Intergenic
990856573 5:60274002-60274024 GGTCTCAGGGCATCAGGAGATGG + Intronic
996816703 5:127582229-127582251 GGTATCAGGGAACCAAGATCTGG - Intergenic
997868546 5:137486611-137486633 TGAATCAGTGCACCAGGATCTGG + Intronic
998882557 5:146658198-146658220 GGTCCCAGAGCACCAGGGTCAGG - Intronic
999270739 5:150295107-150295129 CTTCTCAGGGCACCAGGAACAGG + Intergenic
1001034180 5:168285423-168285445 GGACTCTGTTCACCTGGATCAGG + Intergenic
1001244838 5:170098299-170098321 GGTCTTAGTGCATAAGGGTCTGG + Intergenic
1001628196 5:173154583-173154605 GGTCACAGTGAGCCAAGATCAGG - Intronic
1004137356 6:12980400-12980422 AGACTCAGGGCACCAGGATCTGG + Intronic
1004718034 6:18237927-18237949 GGTTGCAGTGAACCAAGATCGGG - Intronic
1006083808 6:31582264-31582286 GGCCTTAGTGCCCCAGGATCAGG - Exonic
1006541216 6:34741406-34741428 GGTCTCACTGGATCAGGGTCAGG + Intergenic
1006615488 6:35323412-35323434 GGTTGCAGTGAACCAAGATCAGG - Intergenic
1006940734 6:37750535-37750557 GGTCTCAGTGAGCCGAGATCAGG + Intergenic
1010012816 6:71068964-71068986 GGTCCCAGTGCACCAAAGTCAGG - Intergenic
1010769665 6:79813927-79813949 GGTTTCAGTGCAGCAGGAATTGG + Intergenic
1011591848 6:88977473-88977495 GGTGTCAGAGCCCCAGTATCAGG - Intergenic
1013093589 6:106923014-106923036 GGCTGCAGTGCACCATGATCAGG + Intergenic
1013225239 6:108115885-108115907 GGTCTCAGTCCACCTGGTGCTGG + Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018559730 6:165089171-165089193 AGTCCCAGGGCACCAGGAGCAGG - Intergenic
1019407590 7:891853-891875 GGGCTCAGTGCCCCAGGGGCAGG - Intronic
1019478272 7:1254550-1254572 GGTCCCAGAGGACCAGGCTCTGG - Intergenic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1024443528 7:49450248-49450270 GGTTTCAGTGAGCCAAGATCAGG - Intergenic
1026055072 7:66976659-66976681 GGTTGCAGTGAGCCAGGATCAGG - Intergenic
1026500167 7:70937156-70937178 GGTTGCAGTGGACCAAGATCAGG - Intergenic
1026705230 7:72685047-72685069 GGTTGCAGTGCGCCAAGATCAGG + Intronic
1032316542 7:130843459-130843481 GGTTGCAGTGAGCCAGGATCGGG + Intergenic
1034818731 7:154197393-154197415 GGTATCAGTGCACCAAGCTAGGG - Intronic
1035281458 7:157781011-157781033 GGTGTGAGTGGACCAGGATGTGG - Intronic
1036683854 8:10895359-10895381 GGGCTCTGTGCACCTGGAACTGG - Intergenic
1036718613 8:11150788-11150810 AGTCACAGTGAACCAAGATCAGG + Intronic
1039558907 8:38497034-38497056 GGTCTCACTGCACCAGGGCTGGG - Intergenic
1042844265 8:73154673-73154695 GGTTTCAGTGAGCCAAGATCAGG + Intergenic
1048396348 8:134017845-134017867 GGTCTCAGGGCAGCACGGTCTGG - Intergenic
1050182017 9:2933234-2933256 GTTCTCAGGGCAGCAGGTTCCGG - Intergenic
1053203756 9:36169739-36169761 GGTCACAGTGGACCAGCTTCTGG + Exonic
1053851269 9:42289981-42290003 GGTCGCAGTGAGCCAAGATCGGG + Intergenic
1055108054 9:72532925-72532947 GGAGTCAGTCCACCAGGCTCAGG + Intronic
1055715954 9:79118188-79118210 GGTCTCAATGCAGCATGCTCTGG + Intergenic
1059032551 9:110714568-110714590 AGTGGCAGTACACCAGGATCGGG + Intronic
1060587458 9:124795411-124795433 GCCCCCAGTGCACCAAGATCAGG + Intronic
1060723141 9:125991305-125991327 GGTTTCAGTGAGCCAAGATCAGG - Intergenic
1060934458 9:127507198-127507220 GGTCTCTGTGGTCCAGGATGAGG - Exonic
1061299026 9:129694223-129694245 GGTTGCAGTGAGCCAGGATCAGG - Intronic
1062015052 9:134287210-134287232 GGTCCCAGGGCCCCAGGACCAGG + Intergenic
1189283021 X:39832483-39832505 GGTTTCACTGCTCCAGCATCTGG + Intergenic
1191642396 X:63441633-63441655 CGTCTCAGTGCTCCACAATCAGG - Intergenic
1191900751 X:66038803-66038825 GGTCACAGAGCCCCAGGATAGGG + Intronic
1194358917 X:92922714-92922736 GGTCTGTGTGAACCAGGTTCAGG + Intergenic
1194753122 X:97706208-97706230 CATCTGAGTGCCCCAGGATCTGG - Intergenic
1200570223 Y:4819183-4819205 GGTTGCAGTGAACCAAGATCCGG + Intergenic
1200667131 Y:6038727-6038749 GGTCTGTGTGAACCAGGTTCAGG + Intergenic
1200685981 Y:6259297-6259319 TGTCCCAGAGCAGCAGGATCTGG + Intergenic
1201243801 Y:11983733-11983755 GGTTTCAGTGAGCCAAGATCAGG + Intergenic