ID: 1125955665

View in Genome Browser
Species Human (GRCh38)
Location 15:43789345-43789367
Sequence TGGGATGACCTGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 526}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125955655_1125955665 10 Left 1125955655 15:43789312-43789334 CCTTTACCTACACAATAATCCTG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 46
4: 526
1125955657_1125955665 4 Left 1125955657 15:43789318-43789340 CCTACACAATAATCCTGTGGCTC 0: 1
1: 0
2: 0
3: 11
4: 132
Right 1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 46
4: 526
1125955654_1125955665 11 Left 1125955654 15:43789311-43789333 CCCTTTACCTACACAATAATCCT 0: 1
1: 0
2: 0
3: 17
4: 254
Right 1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 46
4: 526
1125955660_1125955665 -9 Left 1125955660 15:43789331-43789353 CCTGTGGCTCTTGATGGGATGAC 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 46
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125955665 Original CRISPR TGGGATGACCTGAGGGAGGA GGG Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900641783 1:3691065-3691087 TGGGGTGAGCAGAGGTAGGAAGG + Intronic
900665396 1:3811582-3811604 TGGGCTGAGCCGTGGGAGGAGGG - Intergenic
900960345 1:5915111-5915133 AGAGAAGTCCTGAGGGAGGAGGG + Intronic
901059025 1:6463139-6463161 GGGGGTGGCCTGAGGGATGAGGG + Exonic
901181309 1:7343648-7343670 TGTGATGACCTTTGGGAGGTGGG - Intronic
901783622 1:11610411-11610433 TGGGAGGACCTGAGGGACCCAGG + Intergenic
901811876 1:11772015-11772037 TGGGAGGATCTGAGCCAGGAGGG - Intronic
902489009 1:16766898-16766920 TAGGAGGTCCTCAGGGAGGAGGG - Intronic
902538609 1:17136545-17136567 TGGGTTGCCCTGGGAGAGGATGG - Intergenic
903955259 1:27021185-27021207 TGGTAGGACCTGAGGTAGGGTGG - Intergenic
904263042 1:29301724-29301746 TGGGATGAGGGGAGGGGGGAAGG - Intronic
904421640 1:30398202-30398224 TGAGGTGACCTGAGGATGGAGGG + Intergenic
904421676 1:30398310-30398332 TGAGGTGACCTGGGGGTGGAGGG + Intergenic
904421707 1:30398417-30398439 TGAGGTGACCTGGGGGTGGAGGG + Intergenic
904421734 1:30398497-30398519 TGAGGTGACCTGGGGGTGGAGGG + Intergenic
904773129 1:32892160-32892182 AGGGGAGACCTGATGGAGGAGGG + Intronic
905264122 1:36739380-36739402 TGGGAGAACTTGAGGGAGGGAGG - Intergenic
905886141 1:41493218-41493240 TGGGAGGCCCTGAGCGGGGAAGG + Intergenic
905915504 1:41681726-41681748 TGGTGGCACCTGAGGGAGGAGGG + Intronic
907915128 1:58861327-58861349 AGGGAAGAAGTGAGGGAGGAAGG + Intergenic
908385394 1:63636411-63636433 TGGGACGACCTAAGACAGGAAGG - Intronic
908510180 1:64844948-64844970 AGAGATGACCTGAGGGACCAGGG - Intronic
909164120 1:72195967-72195989 TGAGTGAACCTGAGGGAGGAAGG - Intronic
912459551 1:109821771-109821793 TATGATCACCTCAGGGAGGAAGG - Intergenic
912798073 1:112704915-112704937 TGAGCTGGACTGAGGGAGGAAGG - Intronic
914394728 1:147254399-147254421 TGGGAGGAAGTGAGGGAGGAAGG + Intronic
914442858 1:147722332-147722354 GGCGATGTCCTTAGGGAGGAGGG + Intergenic
915268240 1:154733814-154733836 GGGGATGAAGGGAGGGAGGAAGG - Intronic
915735436 1:158081734-158081756 AGGGATGAGCTCACGGAGGATGG + Intronic
916074643 1:161193417-161193439 TGGGGTGATGTGAGGAAGGAAGG - Intronic
916309610 1:163381733-163381755 TGTGAAGTCCTGAGGCAGGAAGG - Intergenic
918332261 1:183471987-183472009 TGGGAGGAACTGTAGGAGGAAGG + Intergenic
918416927 1:184319589-184319611 TGGTATAACCTGAGAGACGATGG - Intergenic
919817858 1:201452944-201452966 CAGGATGCCCTGAGGTAGGAAGG + Intergenic
919840883 1:201608717-201608739 TGGGGTCAGCTGGGGGAGGAGGG + Intergenic
919869794 1:201811684-201811706 TTGGATGACCTGAGTGAAGCAGG + Exonic
920129453 1:203720535-203720557 TGCGATGCCCTGAGGTAAGATGG - Exonic
920419032 1:205817744-205817766 TGGGATTCCCTTAGGCAGGATGG + Intergenic
920984855 1:210877371-210877393 TCAGCTGCCCTGAGGGAGGATGG + Intronic
921968942 1:221123266-221123288 TGGGATTATCTCAGGGATGATGG + Intergenic
922053773 1:222020814-222020836 GGAGTTGAACTGAGGGAGGATGG - Intergenic
923531427 1:234815626-234815648 TAGGAGGTCCTCAGGGAGGAGGG + Intergenic
923608189 1:235464468-235464490 GGGGAGGAAGTGAGGGAGGAAGG - Intronic
924639269 1:245817554-245817576 TTTGATGACCTGAGAGAAGAAGG + Intronic
1063115212 10:3067778-3067800 TGGGGTGACCGGAGAGAAGAGGG + Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063462817 10:6225339-6225361 TGGGCTGACCTGAGAGAGGCTGG + Intronic
1063540394 10:6927901-6927923 AGAGAAGACATGAGGGAGGATGG - Intergenic
1063960957 10:11305125-11305147 TTGGATTTCCTGTGGGAGGAGGG - Intronic
1064004189 10:11687380-11687402 TGGGAGGACCTGTGGGAAGAAGG - Intergenic
1064043387 10:11988572-11988594 TGGGATTACAGGAGGGAGGAAGG + Intronic
1064846882 10:19665590-19665612 TGCGATGTCTTGGGGGAGGAAGG - Intronic
1066136697 10:32454408-32454430 TGGGATGACTAGAGGTGGGAGGG + Intronic
1067703301 10:48588944-48588966 TGGGATGACCTCAGGGGAGGTGG + Intronic
1067706116 10:48607546-48607568 TGGGGTGGCCTGTGGGAGGATGG + Intronic
1067968496 10:50942045-50942067 TGGGAGGACCTGAAGAAGGAGGG - Intergenic
1068657180 10:59587836-59587858 TGAGATGTGCTGAGAGAGGAGGG - Intergenic
1068946091 10:62730238-62730260 TGGGACAGCCAGAGGGAGGATGG - Intergenic
1069622536 10:69846680-69846702 TGGGAGCACTGGAGGGAGGAAGG - Intronic
1070441733 10:76452700-76452722 TGGAAGGCCCTGGGGGAGGATGG + Intronic
1071949340 10:90684809-90684831 TGGGGTGGCATGAGGGAAGAGGG + Intergenic
1072670913 10:97428390-97428412 AGGGATGGCCTGGGGGAGGATGG + Intronic
1073006766 10:100330567-100330589 TGGGAGGAGCTGAGACAGGAGGG + Intergenic
1073857147 10:107690184-107690206 TGGGATCAAAAGAGGGAGGAAGG + Intergenic
1073894927 10:108144343-108144365 GGGGACTACCAGAGGGAGGAGGG - Intergenic
1074533095 10:114310435-114310457 CTGGATGACCTGAGGCAAGAGGG + Exonic
1075170524 10:120109440-120109462 GGGGATTACTTGAGGGTGGAGGG + Intergenic
1075482270 10:122792092-122792114 TGAGAGGGCATGAGGGAGGATGG - Intergenic
1075632636 10:124010491-124010513 TTGGAAGCACTGAGGGAGGAAGG + Intronic
1075814324 10:125253243-125253265 TTGGATGAAGGGAGGGAGGAAGG - Intergenic
1076273196 10:129174565-129174587 AGGGATCAAATGAGGGAGGAGGG + Intergenic
1076428114 10:130381716-130381738 TGGCAGGGGCTGAGGGAGGAGGG - Intergenic
1076808938 10:132876659-132876681 TGGGAGGGCCTGTGGGAGGCTGG + Intronic
1078144051 11:8711091-8711113 TGGCCTGGCCTGAGGGAGGAAGG - Intronic
1078451457 11:11443788-11443810 TGGGAAGAACTGGGGGAGGCAGG - Intronic
1079560525 11:21813946-21813968 TGGCAAGACCTAAGGGAGGAAGG + Intergenic
1079575212 11:21995987-21996009 TGGGGTGGGGTGAGGGAGGAGGG - Intergenic
1079576895 11:22015482-22015504 GGGGTTTACCTGAGGGTGGAAGG - Intergenic
1080348638 11:31356063-31356085 TGGAATGACCTAAGGTAAGAGGG - Intronic
1080806886 11:35662370-35662392 TGGGATTTCCTGAGTGCGGAAGG - Intergenic
1081139104 11:39475734-39475756 TGGGGTGGCGGGAGGGAGGAGGG - Intergenic
1081808342 11:45901890-45901912 AGGGATGGCCTGAGGGGGCAGGG + Intronic
1082138117 11:48574440-48574462 TGGGATGGGGGGAGGGAGGAGGG - Intergenic
1082232075 11:49780108-49780130 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1083006985 11:59355968-59355990 TGGCAGAACCTGAGGGATGAAGG + Intergenic
1083282906 11:61638440-61638462 GGGGAGGACAGGAGGGAGGACGG + Intergenic
1083616416 11:64028687-64028709 TGGGAGGAGCTGCGGGAGGAGGG - Intronic
1083946997 11:65929248-65929270 TGGGGTGGCCTGAAGGAAGAAGG - Intergenic
1084068551 11:66719304-66719326 AGGGATGGCCTGGTGGAGGATGG - Intronic
1084117878 11:67052557-67052579 TGGGGTGGCCTGAGAAAGGAGGG - Intergenic
1084257530 11:67953295-67953317 TCGCATGACCTGAAGGATGATGG - Intergenic
1084512754 11:69616382-69616404 TGGGTTTACCAGAGGCAGGAAGG - Intergenic
1085270930 11:75269375-75269397 TGGGATGGCGTGAGGGTGGGAGG - Intronic
1085403474 11:76248104-76248126 AGGGCTGAGCTAAGGGAGGAGGG - Intergenic
1085967641 11:81548093-81548115 TGTTATGACCTGAGGAAGGATGG - Intergenic
1086527965 11:87751264-87751286 AGGGATGACCTGGCAGAGGAAGG + Intergenic
1086653188 11:89318240-89318262 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1087122532 11:94589793-94589815 TGTGATGACCTGAGACAGGGAGG - Intronic
1087474858 11:98622232-98622254 TGGGAGGAAGAGAGGGAGGAGGG - Intergenic
1089073128 11:115716670-115716692 GGGAAAGACCGGAGGGAGGAAGG - Intergenic
1089302544 11:117507395-117507417 AGGGGTGCCCTGAGGGCGGAGGG - Intronic
1090079644 11:123603376-123603398 TCGGGGGACCTGAGGGAGCAAGG + Intronic
1090465960 11:126933387-126933409 CGTGATGACTTGAAGGAGGAAGG - Intronic
1091317651 11:134625791-134625813 TGGGATTACCTGGGGGCCGATGG + Intergenic
1091672433 12:2462051-2462073 GGGGGTGAGCTTAGGGAGGAAGG - Intronic
1091797781 12:3307067-3307089 TGGGCAGAGCTGAGGGAGGCTGG + Intergenic
1092287202 12:7135582-7135604 TGGGTTGTCCTGAGGGAGGTGGG - Intronic
1092427759 12:8388091-8388113 TCGCATGACCTGAAGGATGATGG - Intergenic
1092429029 12:8395072-8395094 TCGCATGACCTGAAGGATGATGG - Intergenic
1092707342 12:11298676-11298698 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
1094818450 12:34207729-34207751 TGGGAAGAACAGAGGGAGGGAGG - Intergenic
1095938017 12:47705880-47705902 TGGGGTGGCCGGTGGGAGGAGGG - Intronic
1095947711 12:47763298-47763320 TGGGATGGAGAGAGGGAGGATGG + Intronic
1096623634 12:52879792-52879814 TGGGGGGAGCTGAGGGCGGAGGG - Intergenic
1096757644 12:53813417-53813439 AGGGATGATATGAGTGAGGAGGG - Intergenic
1096849626 12:54427269-54427291 TGTGATCACCTCAGGGAGGGGGG + Intergenic
1098240746 12:68464338-68464360 TGGAATTTCCTGAGTGAGGAGGG - Intergenic
1098290440 12:68952597-68952619 TGGGATGAGGGGAGGGAGGTGGG - Intronic
1098646766 12:72911505-72911527 TGGGGAGACCTCAGGGAGGAAGG - Intergenic
1098671407 12:73235203-73235225 TGGGATTACCAGATGCAGGAGGG - Intergenic
1099047638 12:77742297-77742319 TGGGATGAATTCAGTGAGGAAGG - Intergenic
1099440008 12:82687436-82687458 TGGAAGGACCCGAGGGAGGGAGG + Exonic
1100209138 12:92383203-92383225 TATGGTGCCCTGAGGGAGGAGGG + Intergenic
1101502894 12:105320526-105320548 TTGGCCGACCTGAGGGAGAAAGG + Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102586805 12:113929369-113929391 TGGGCTTATCCGAGGGAGGAAGG - Intronic
1102588516 12:113940185-113940207 TGGGACCACAGGAGGGAGGAGGG + Intronic
1102757577 12:115355489-115355511 TGGGATTTCCTGATGGAAGATGG + Intergenic
1104133665 12:125917737-125917759 GAAGATGTCCTGAGGGAGGAGGG + Intergenic
1104482096 12:129116223-129116245 TGGGAAGACCTGAGGGAACATGG + Intronic
1104841253 12:131827220-131827242 TGGGATCACCTGTAGGAGGTGGG - Intergenic
1106017686 13:25884824-25884846 TGGGATGGCTCGTGGGAGGAGGG - Intronic
1106111560 13:26782024-26782046 TGAGATGAGATGGGGGAGGAGGG - Intergenic
1106469572 13:30042476-30042498 AGGGATCACCAGAGGGAGGTTGG - Intergenic
1106613833 13:31308778-31308800 TGTGGTGACCTGTGGGAGAAGGG - Intronic
1107047833 13:36013212-36013234 TTTGATGAGCTGAGAGAGGAAGG - Intronic
1107577596 13:41744034-41744056 AGGGCTGCCCTGAGGGAGAAAGG - Intronic
1107989847 13:45810149-45810171 TGGTGTCTCCTGAGGGAGGATGG - Intronic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1109301871 13:60597948-60597970 GGGGCGGACCTGAGGGTGGAGGG - Intergenic
1109311749 13:60703100-60703122 GGGGACTACCCGAGGGAGGAGGG - Intergenic
1109777005 13:67054033-67054055 AGGGATGTGGTGAGGGAGGAGGG - Intronic
1110802746 13:79718656-79718678 AGGGATGATTTGAGGGTGGAAGG - Intergenic
1112466096 13:99646320-99646342 TGGGGTGGCCTGGGGGAAGAAGG + Intronic
1112771994 13:102801788-102801810 TGGTAAGACCTGTGTGAGGAAGG + Intronic
1112986664 13:105458286-105458308 TGGCATGAACTGTGTGAGGAAGG - Intergenic
1113587138 13:111473209-111473231 TGGGCAGACCTGAGGGACGTGGG + Intergenic
1114379988 14:22192950-22192972 TGGGGTGAACTGGGGGTGGAGGG + Intergenic
1114665067 14:24372791-24372813 TGGGATGAGCTGAGTGGGGGTGG - Intronic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1114972865 14:28056132-28056154 TGGGCTGAGGGGAGGGAGGAGGG - Intergenic
1115762111 14:36584920-36584942 TTCGAGAACCTGAGGGAGGAGGG - Intergenic
1115900430 14:38141054-38141076 TGGTAGGATCTGAGGGAGAAGGG - Intergenic
1116650334 14:47583226-47583248 TAGAATGACGTGAGGGAGAATGG + Intronic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117766222 14:59086052-59086074 TGGGTAGACCTGAGTGAGGAAGG - Intergenic
1117771939 14:59142311-59142333 TGGGAGGAAGGGAGGGAGGAAGG + Intergenic
1118351107 14:64972701-64972723 TGGGCTCACCCGAGGTAGGAAGG + Intronic
1118438558 14:65792694-65792716 TTGGCTGACCAGAGGGAGAAGGG + Intergenic
1119890933 14:78181577-78181599 TGGGCAGCCCTCAGGGAGGAGGG + Intergenic
1120184698 14:81382556-81382578 GGGGATGTGATGAGGGAGGAGGG + Intronic
1121019319 14:90569457-90569479 TCATCTGACCTGAGGGAGGAGGG + Intronic
1121124757 14:91399030-91399052 TGGGAGGACCAGAGGGAGAGTGG - Intronic
1121820779 14:96964329-96964351 TGGGAGGACCTGGTGGGGGATGG + Intergenic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1122836870 14:104434840-104434862 TGGGGTGGACTGAGGGAAGATGG + Intergenic
1122837217 14:104436190-104436212 TGGGCGGAGCTGAGGGAGGCAGG + Intergenic
1124257769 15:28159716-28159738 TTTGATGAGCTGAGAGAGGAAGG - Intronic
1124617899 15:31255846-31255868 AGGAAGGACCTGAGGGAGGGCGG + Intergenic
1124967530 15:34447479-34447501 AGGGAAGAGATGAGGGAGGAGGG - Intergenic
1125002874 15:34789565-34789587 TGCGAGGTCCTGAGGGAGCAAGG - Exonic
1125051870 15:35308481-35308503 GGGGAAGACCTGAGGAAGGCAGG + Intronic
1125262858 15:37847384-37847406 TGGGAGGACCTGAGGAGAGATGG - Intergenic
1125428468 15:39573289-39573311 TGGGAAGATGTGTGGGAGGAAGG - Intergenic
1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG + Intronic
1127322363 15:57859278-57859300 TGGCATGACCTGAAGGCAGAAGG + Intergenic
1127785106 15:62348922-62348944 AGGGATGTGGTGAGGGAGGAAGG - Intergenic
1128525617 15:68410338-68410360 TGGGATGGGGTGAGGGAGGTGGG + Intronic
1129207414 15:74045265-74045287 AGGGAGGTCCTGAGTGAGGAAGG + Exonic
1131056265 15:89377253-89377275 TGGCATGCCCTGGGGGAAGAAGG - Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132177635 15:99728019-99728041 TCAGAACACCTGAGGGAGGAAGG - Exonic
1132191180 15:99862439-99862461 AGGGAAGAGATGAGGGAGGAGGG + Intergenic
1132724866 16:1334187-1334209 TACGAGGACCTGCGGGAGGAGGG - Intronic
1132789133 16:1675371-1675393 GGGGATGAAATGAGGCAGGAAGG - Exonic
1133051208 16:3118555-3118577 TGGGAGGACCTGGGACAGGAGGG - Intronic
1133758503 16:8780118-8780140 TGCGATGGCCTGAGGTGGGATGG + Intronic
1133915703 16:10107651-10107673 TGGGATTCCCAGGGGGAGGACGG - Intronic
1133967698 16:10543522-10543544 TGAGAAGCACTGAGGGAGGAAGG - Intronic
1136040359 16:27574000-27574022 TGAAAGGACCTGAGGGAGCAGGG + Intronic
1136343849 16:29663067-29663089 GGGGCTCACCTGAGGGAGGCAGG - Intronic
1137642034 16:50040546-50040568 TGGGTTGTCCTGAGAGAGGATGG - Intergenic
1139377430 16:66508975-66508997 TGGGATGACGTGGGGGCAGAGGG + Exonic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1139575284 16:67837810-67837832 TGGGATGAAGTGAGGCAGGGAGG + Intronic
1140051529 16:71485615-71485637 TTGGATGACCTGATAGATGAAGG + Intronic
1140270149 16:73458313-73458335 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1140920672 16:79534587-79534609 TGGGATGGGGGGAGGGAGGAGGG + Intergenic
1141308726 16:82892079-82892101 AGGGATGAGCTGAGGTTGGAAGG - Intronic
1141464881 16:84198760-84198782 TGGGAGAATCTGAGGGAGGTGGG + Intergenic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1203029528 16_KI270728v1_random:562951-562973 TGGGGTGGCGGGAGGGAGGAGGG + Intergenic
1203042193 16_KI270728v1_random:771480-771502 TGGGGTGGCGGGAGGGAGGAGGG - Intergenic
1142597279 17:1035766-1035788 GGGGAGGGGCTGAGGGAGGATGG - Intronic
1143161524 17:4874854-4874876 TGGGCGGCACTGAGGGAGGAAGG - Intronic
1143278317 17:5731114-5731136 AGGGTTGCCCTGAGGGAGAAAGG - Intergenic
1143314972 17:6025683-6025705 TAGCATGATCTGAGGGTGGAGGG + Intronic
1143759326 17:9089703-9089725 TGGGATGAGCAGAGGTAGAAGGG - Intronic
1144287413 17:13790997-13791019 TGGTATGAACTGAGGGAGTCTGG + Intergenic
1144553363 17:16260589-16260611 TGGGATGACCTGCCTGTGGAAGG + Intronic
1145241659 17:21243834-21243856 TGGGATGCCCTGAGGATGAAGGG + Intronic
1145243284 17:21251983-21252005 TGGGACCTCCTGAGGGGGGATGG + Intronic
1145398909 17:22515741-22515763 GGGGATGACCAGAGGCAGGGAGG + Intergenic
1146820894 17:35982977-35982999 AGGGATGAAGGGAGGGAGGAAGG - Intergenic
1146908532 17:36633201-36633223 AGTGACGACCTGAGGGAGAAGGG - Intergenic
1147262182 17:39214995-39215017 CGGGATGAGCTGACCGAGGATGG - Exonic
1148049184 17:44760763-44760785 TGGGCTGGGCAGAGGGAGGAAGG + Intronic
1148243183 17:46013214-46013236 TGGGGTCACCTGAGGGTGCAAGG - Intronic
1148691317 17:49528491-49528513 AGGGGTGGCCTGAGGGAAGAGGG + Intergenic
1148759941 17:49994422-49994444 CGGGATGAGCTGAGAGAGGAAGG - Intronic
1148808716 17:50277485-50277507 TGGAATGTGCTGAGAGAGGAAGG + Intronic
1151055855 17:71030899-71030921 TGGGCTGGCTTGAGGAAGGAAGG - Intergenic
1151425356 17:74027706-74027728 AGGGCTGAGATGAGGGAGGAAGG + Intergenic
1151479848 17:74363474-74363496 TGGGATGCCCTCAGGGACCAGGG - Intergenic
1151979153 17:77498702-77498724 TGGGAGGGCCTGGGGGGGGACGG - Exonic
1152477613 17:80528371-80528393 TTGGAAGGCCTGAGAGAGGAGGG + Intergenic
1152901570 17:82944041-82944063 TGGGATGCACTGAGGATGGAAGG + Exonic
1153980303 18:10303050-10303072 TGAGAAGAACTGAGGGAGGGTGG - Intergenic
1155100077 18:22602141-22602163 GGGGCTGACTTGAGGGTGGAGGG - Intergenic
1156024083 18:32631587-32631609 TGGGTTCACCTGAGGCTGGATGG + Intergenic
1156267484 18:35501672-35501694 TGTCAAGGCCTGAGGGAGGAGGG - Intergenic
1156381715 18:36567819-36567841 TGGGATTACCTGGGGGAGAGGGG - Intronic
1156525089 18:37759445-37759467 TGGTATTACCCGAGGAAGGAGGG - Intergenic
1157474486 18:48012552-48012574 AGGAATGAGCTCAGGGAGGAAGG - Intergenic
1157478069 18:48036038-48036060 TGGGGTGACCAGAGCTAGGAAGG + Intronic
1157698414 18:49743648-49743670 TGGGATGACAGGAGAGGGGAAGG + Intergenic
1157748338 18:50156983-50157005 AAGGATGACCTGGGGGAGGGTGG - Intronic
1158215451 18:55096324-55096346 TGGGGTGATCAGAGGGAGAAAGG + Intergenic
1158971142 18:62667827-62667849 TGGGAGGCTCTGAGGCAGGAGGG - Intergenic
1159060357 18:63508147-63508169 AGGGGTGAGCTGGGGGAGGAGGG + Intergenic
1159353066 18:67299908-67299930 TGGCAAGACCTATGGGAGGAAGG + Intergenic
1161397332 19:4051793-4051815 TGGGAGGCCCAGAGAGAGGAAGG + Intronic
1161542592 19:4861114-4861136 TTGGAGGGCCTGAGGGAGCAGGG - Intronic
1162101638 19:8342734-8342756 TAGGACGACCTGGGGGTGGACGG - Intronic
1162175329 19:8825994-8826016 TGGGATGAGATGAGAGAAGAAGG + Intronic
1162359572 19:10210440-10210462 TGGGAAGAGTTGAGGGAGGAAGG - Intronic
1163442198 19:17327944-17327966 TGGGATAATCTGAGGGAGGCGGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163770811 19:19190053-19190075 TGAGCAGACCTGAGGGATGAAGG - Intronic
1163779612 19:19239576-19239598 TGGGAGGAGGAGAGGGAGGAGGG - Intronic
1163939196 19:20477201-20477223 TGGGCTTACCTGAGGGGGCATGG + Intergenic
1164786018 19:30931667-30931689 TGGGATGCCCTGGGAGAGGTAGG + Intergenic
1165894105 19:39131329-39131351 AGGGAGGCCCTGAGGGAGGTAGG - Intronic
1166052366 19:40267991-40268013 TGCAAGGACCTGAGGCAGGAGGG + Intronic
1166543349 19:43619873-43619895 TGGGATGCGCTGGGGGTGGAGGG + Exonic
1166876422 19:45900517-45900539 GGTGATGACTTGAGGGAGCAGGG - Intronic
1167195174 19:48023394-48023416 AGGGAGGAAGTGAGGGAGGAGGG + Intronic
1167550301 19:50155693-50155715 TGTGAGGAACTGTGGGAGGAGGG - Intronic
1168232654 19:55043052-55043074 TGGGATGACCTGAGTCTGGTAGG - Intronic
1168279092 19:55294464-55294486 GGAGATGACCTGAGGATGGAAGG - Intronic
1168311982 19:55465068-55465090 TGGGCTGAGCAGAGGGAGGGAGG - Intergenic
1168348501 19:55662374-55662396 AGGGATGAGGGGAGGGAGGAGGG - Intronic
1168353807 19:55690261-55690283 TGGCATGGCCACAGGGAGGAGGG + Intronic
1168521730 19:57056511-57056533 GGGGCAGACCTGAGGGTGGAGGG + Intergenic
925058920 2:876183-876205 CGGGATGGCCTGAGGGAGTGGGG + Intergenic
925069675 2:956415-956437 TGTGAAGGCCCGAGGGAGGAAGG - Intronic
925885358 2:8390594-8390616 TGGGATGCCCTGGGGTAGGATGG + Intergenic
926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG + Intronic
926355115 2:12034371-12034393 ATGGATGACCTGAGTGAGGACGG - Intergenic
927226212 2:20767838-20767860 TGGGATGACCTGCTGCAGAAAGG + Intronic
927794351 2:26034734-26034756 AGGTAAGACCTGTGGGAGGACGG + Exonic
928384213 2:30850851-30850873 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
929023911 2:37580454-37580476 TGGCATGACAGGAGGGAGGAAGG + Intergenic
929243508 2:39676769-39676791 TGGAATGACCATAGGCAGGATGG - Intronic
933654385 2:84875597-84875619 TGGGATGAATAGAGGGATGAGGG + Intronic
934534083 2:95118467-95118489 TGGCATGGCCAGAGGGAAGATGG - Intronic
935765830 2:106366896-106366918 TGGGTTGACCTGAGGGTGGATGG + Intergenic
936224977 2:110640595-110640617 TGGGATGCTCTCAGGCAGGATGG - Intronic
937609739 2:123846414-123846436 AGGGATGACTAGAAGGAGGATGG + Intergenic
937829709 2:126406088-126406110 TGGGAAGACTTCAGGGAAGAGGG + Intergenic
938765728 2:134459642-134459664 TGGGAAGGGCTGGGGGAGGAGGG - Intronic
940781279 2:157936775-157936797 TGGCATGACCTAAGGAAAGAAGG - Intronic
941025773 2:160454587-160454609 TGGGAGGTCCTGAGGCAGGAAGG + Intronic
941715585 2:168760075-168760097 TGGGGGGATCTGAGGGAGGCTGG - Intronic
942259630 2:174146037-174146059 TGTGAGGATCTGAGGGAAGAGGG + Intronic
942363042 2:175192727-175192749 TGGGCTGGCGGGAGGGAGGAGGG + Intergenic
942422325 2:175820929-175820951 TGGGATGAACAGAGGAGGGAGGG - Intergenic
942529282 2:176891292-176891314 TTGGATGTCCTGAGAGAGAAGGG - Intergenic
942602411 2:177654823-177654845 TGGGAGGAAAGGAGGGAGGAAGG - Intronic
943213803 2:185004487-185004509 TGGGAAGACATGGGGGATGAGGG + Intergenic
943615525 2:190087715-190087737 TGGAAAGACCTCAGGGTGGAAGG - Intronic
944161014 2:196659975-196659997 GGGGAAGACATGAGGAAGGATGG - Intronic
944192736 2:197020939-197020961 TGGGATGGGGGGAGGGAGGAGGG - Intronic
947006053 2:225512640-225512662 TGGGAGGAAGGGAGGGAGGAAGG - Intronic
947077710 2:226363900-226363922 AGGGAGGAACGGAGGGAGGAAGG + Intergenic
947203368 2:227637097-227637119 TGGGATCACCTGACGGGGGTGGG + Intergenic
947650258 2:231780864-231780886 AGGGGCGTCCTGAGGGAGGAAGG - Intronic
948979434 2:241485486-241485508 AGGGAGGACCTCAGGGAGGGAGG - Intronic
948979482 2:241485638-241485660 AGGGAGGACCTCAGGGAGGGAGG - Intronic
1169325207 20:4670252-4670274 TGGGATGACCTTGAGCAGGAAGG - Intergenic
1170215838 20:13890113-13890135 TGTGCTGGCTTGAGGGAGGAGGG - Intronic
1170435965 20:16329103-16329125 TTGGATGACATGAGGCTGGAAGG - Intronic
1170440945 20:16378236-16378258 TGGAAAGAGGTGAGGGAGGAGGG + Intronic
1170627423 20:18040390-18040412 TGGGATGGGCTGAGATAGGATGG + Intronic
1170711458 20:18794814-18794836 TAGGATGACATGCGGCAGGAAGG + Intergenic
1170825672 20:19792772-19792794 CGGGGTGATTTGAGGGAGGAGGG + Intergenic
1170937658 20:20823945-20823967 TGTGATCACCTGACAGAGGAGGG - Intergenic
1172523440 20:35583655-35583677 TGGGATGACATGTGGGTGGAAGG - Intergenic
1172857167 20:38014140-38014162 AGGCAAGACTTGAGGGAGGAAGG + Intronic
1173477015 20:43367021-43367043 GGGGACTACCAGAGGGAGGAAGG + Intergenic
1174190831 20:48739241-48739263 TGGGATGATCTTGGGGAGGGTGG - Intronic
1174195445 20:48769573-48769595 TGGGAGGAGATGAGGGAGAAGGG - Intronic
1174212731 20:48892667-48892689 TGGGATGGGCTATGGGAGGAGGG - Intergenic
1174295099 20:49540144-49540166 TGTGATGTCCTGGGGCAGGAGGG + Intronic
1174353477 20:49983652-49983674 TTGGGTGACCTGGGCGAGGAGGG + Intronic
1174563770 20:51449691-51449713 TGGGATGACCTCAGGCAGCCTGG - Intronic
1174829393 20:53798677-53798699 TGGGAGGACATGAAGGAAGAGGG - Intergenic
1175708614 20:61201779-61201801 TGGAGTGTCCTGAGTGAGGATGG - Intergenic
1176196359 20:63837877-63837899 TGGGATGACAGGGGGCAGGAGGG + Intergenic
1177164670 21:17586879-17586901 TGGGGTGAGGGGAGGGAGGAGGG - Intronic
1177513764 21:22121993-22122015 GGGGAGGACCTGAAGGAGCAGGG - Intergenic
1179168810 21:38956959-38956981 TGGCTTGGGCTGAGGGAGGAAGG - Intergenic
1179322726 21:40307933-40307955 TGGGATGAGGGGAGGGGGGAGGG + Intronic
1179566591 21:42252854-42252876 GGGGATGATGTCAGGGAGGAGGG - Intronic
1179587882 21:42385219-42385241 TGTGAGAACCTGAGGGAGTATGG - Intronic
1179822188 21:43943408-43943430 TGGGACGGCAGGAGGGAGGAAGG - Intronic
1180723205 22:17924864-17924886 TGAGTTGCCCTGAGGAAGGAAGG - Intronic
1180912690 22:19463713-19463735 TGGGTTGCCCTGAGGGCAGATGG - Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181464402 22:23102983-23103005 TGGTAAGCCTTGAGGGAGGAGGG + Intronic
1181464534 22:23103794-23103816 CCAGCTGACCTGAGGGAGGAAGG - Intronic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1182134556 22:27889161-27889183 CCTGATAACCTGAGGGAGGAGGG + Intronic
1182443583 22:30377705-30377727 TGGGAGTTCCTGAGGGAGGCTGG + Intronic
1182597613 22:31434215-31434237 TGGGATGGGCTGAATGAGGAAGG + Exonic
1182876942 22:33700483-33700505 TGGGATGACATGAGGGCTGGCGG + Intronic
1183019386 22:35015007-35015029 TGGGAAGTCCTGAGGTTGGAGGG - Intergenic
1183330261 22:37216199-37216221 TGGGATTACCTGTGGGATGGGGG - Intergenic
1184101038 22:42341903-42341925 TGGGAGGACCACAGGGAGGAGGG + Intronic
950282339 3:11719302-11719324 CGGGATGCCCTGCGGGAGGGAGG - Intronic
950857001 3:16115151-16115173 TGGCGTGAGCTGAGGCAGGAGGG + Intergenic
951259218 3:20486736-20486758 TGGGCCTACCTGAGGGTGGAGGG - Intergenic
951820464 3:26804439-26804461 TGGGATGGGGGGAGGGAGGAGGG + Intergenic
952388425 3:32859936-32859958 TGGTATGACCTGAGGAAGAAGGG - Intronic
953162001 3:40429557-40429579 TGGGAGTAGCTGAGGCAGGAGGG + Intergenic
953680798 3:45036549-45036571 CGGGATGTCCTGAGGAAGAAGGG - Intergenic
954324697 3:49857034-49857056 TGGGGTGACCTGAGGGACTGGGG - Intergenic
954608937 3:51934130-51934152 TAGGGTGACCTGGGGGAGGGTGG - Intronic
954840791 3:53509595-53509617 GGGGCTGACCCGAGGGAGGGCGG + Intronic
954849735 3:53590138-53590160 TGGCATGAGCTGAGGCTGGATGG - Intronic
955350905 3:58192232-58192254 TGGCCTGACCTCAGAGAGGAGGG + Intergenic
955636976 3:61040977-61040999 GGGGATGTCCTAGGGGAGGAAGG - Intronic
956034905 3:65080150-65080172 TGTGATGAACTGAGGGTGGATGG + Intergenic
959564988 3:107825088-107825110 GGGGATGAACTGTGGCAGGATGG + Intergenic
960252497 3:115471536-115471558 TAGGATGACATGTAGGAGGAGGG + Intergenic
961281612 3:125768985-125769007 TCGCATGACCTGAGGCATGATGG + Intergenic
961391213 3:126553248-126553270 TGGGGTGACCTGGGGGAGGCAGG + Intronic
963337789 3:143997120-143997142 GGGGCTTACCTGAGGGAGAAGGG - Intronic
963401646 3:144806355-144806377 TGGGATGACCTTCCAGAGGAAGG - Intergenic
963471988 3:145752172-145752194 TGGGCTGAGGTGAGGTAGGAAGG - Intergenic
963626734 3:147682836-147682858 TGGGATGGCGGGAGGGGGGAGGG - Intergenic
963778232 3:149461809-149461831 TGGGGTGAGTTGGGGGAGGAAGG - Intergenic
964344461 3:155742503-155742525 TGGGAGTACCTGGGGGAGGCTGG - Intronic
965118626 3:164522184-164522206 TGGGATGGCCTGAGGCATCAGGG - Intergenic
965737866 3:171840891-171840913 TGGGATGACTAGAGGGAGCAGGG + Intergenic
966747863 3:183295578-183295600 GGGGGTCACCTGAGGGAGGTAGG - Intronic
966985991 3:185180941-185180963 TGGGTTGCCCCTAGGGAGGAAGG - Intergenic
967932182 3:194698180-194698202 TGGGATACCCTGAGGGTGAAAGG - Intergenic
967975277 3:195030919-195030941 TGGGGTGCCCTGAGGGAGAAGGG + Intergenic
968287559 3:197517702-197517724 GGGGTTGGCCTGAGGGGGGATGG - Intronic
969016057 4:4105100-4105122 TCGCATGACCTGAAGGATGATGG - Intergenic
969181581 4:5446115-5446137 TGGGATGCCCTGAGGGGGCATGG - Intronic
970077851 4:12245091-12245113 TGGGAAGACTTAAGGGAGGCAGG + Intergenic
970382932 4:15526101-15526123 TGGGATGTGCAGAGGGAGGTAGG - Intronic
971365906 4:25976986-25977008 TGGGCAGACCTGAAGGAGGTGGG - Intergenic
973195248 4:47432276-47432298 TGGGTTGACATGAGGCAGGATGG - Intergenic
973741901 4:53926468-53926490 TGGGCTGACCTAAGCAAGGATGG - Intronic
974659177 4:64864130-64864152 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
975704222 4:77095903-77095925 TGGGATGACCTGAAGTGGGCAGG - Intergenic
976486153 4:85607369-85607391 AGGGAGGAACGGAGGGAGGAAGG + Intronic
977072922 4:92415463-92415485 TGGGAGGAACTGTGGGAGGAGGG - Intronic
977809627 4:101345723-101345745 TGGGATGTGCGGAGTGAGGAAGG - Intronic
978312394 4:107398922-107398944 TGAGAAGACCTGAAGGAGAAGGG + Intergenic
979224554 4:118269434-118269456 TGGGCCTACCTGAGGGCGGAGGG - Intergenic
981062771 4:140444373-140444395 GGGGCTTACTTGAGGGAGGATGG - Intronic
981611753 4:146600487-146600509 TGGGATAACCTGAGGCATGAAGG + Intergenic
981679191 4:147375633-147375655 TGGGATGAGGGGAGGGGGGAGGG - Intergenic
981799876 4:148643037-148643059 TGGGGTGGAATGAGGGAGGAAGG + Intergenic
982434141 4:155363015-155363037 TGGAATGACTTGAGGGAACAGGG + Intronic
983639670 4:169933409-169933431 TAGAGTGACCTGGGGGAGGATGG + Intergenic
985095594 4:186409507-186409529 GGGGAGGAAATGAGGGAGGAGGG + Intergenic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985631375 5:1015817-1015839 TGGTAAGACCTGTGAGAGGACGG - Intronic
985837068 5:2279412-2279434 TATGCAGACCTGAGGGAGGAAGG + Intergenic
985845289 5:2340320-2340342 GGGGACTACCTGAGGGTGGAGGG - Intergenic
986426907 5:7641679-7641701 TGGGACTACTAGAGGGAGGAGGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987539553 5:19236424-19236446 TTGGATTACCAGAGGGAGGGGGG + Intergenic
988548198 5:32176710-32176732 GGGGAAGAAGTGAGGGAGGAAGG + Intergenic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989284392 5:39682656-39682678 TGGGGTGAGGGGAGGGAGGAGGG - Intergenic
990810355 5:59715687-59715709 TGGCAAGACCTATGGGAGGAAGG + Intronic
991056459 5:62325968-62325990 TGGGATTACTAGAGGAAGGAGGG + Intronic
992543914 5:77791819-77791841 TGGGAAGACCTGAGGCAGTTAGG + Intronic
992556334 5:77907041-77907063 TGGGAAGACGTGAAGGTGGAAGG - Intergenic
992896909 5:81253531-81253553 AGGGTGGACCTGAAGGAGGAGGG - Intronic
994928301 5:106147546-106147568 TGGGGTGACGGGAGGGGGGAGGG + Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995446362 5:112248652-112248674 TGGGAAGACCAGAGGGAGTTAGG - Intronic
995559187 5:113362853-113362875 TGGGATGACTCCAGGGTGGAGGG + Intronic
995785182 5:115820122-115820144 GGGGATAACTAGAGGGAGGATGG - Intergenic
996150326 5:120026817-120026839 AGGGCTGACTTGAGGGTGGAGGG - Intergenic
996512710 5:124335038-124335060 TGGGATGAGCTGAGAGACGTGGG + Intergenic
996832117 5:127752099-127752121 TTTGATGAGCTGAGGGAAGAAGG - Intergenic
997264439 5:132486909-132486931 TGGGAAGCCCTCAGGGAGGGAGG - Intronic
997353961 5:133250453-133250475 TGGCATGAGCTGAGGGAAGCAGG + Intronic
997380830 5:133436369-133436391 GAGGATGACCTGTGGCAGGAAGG + Intronic
998554219 5:143107238-143107260 TGGTATGACATGAGGTTGGAGGG + Intronic
998853269 5:146371232-146371254 TAGCATGACCTCAGGTAGGAAGG - Intergenic
999507027 5:152208321-152208343 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
999721270 5:154400818-154400840 TGGAATGAGGTGAGGGTGGAGGG + Intronic
1000165631 5:158645796-158645818 GGGGCTTACCTGAGGGTGGAGGG + Intergenic
1000293369 5:159891700-159891722 GCTGAAGACCTGAGGGAGGAGGG - Intergenic
1001885519 5:175286960-175286982 AGTGATGACCACAGGGAGGAAGG - Intergenic
1001894732 5:175368492-175368514 TGGGATGCCCAGAAGAAGGAGGG - Intergenic
1002010248 5:176273645-176273667 TGGGGTGAGGTGAGGGGGGAGGG - Intronic
1002400420 5:178988845-178988867 TGGGACAACCTCAGGGTGGAAGG - Intronic
1002433494 5:179217858-179217880 GGGGATGGCCTGAGGGCAGACGG + Intronic
1002433503 5:179217896-179217918 GGGGATGGCCTGAGGGCAGACGG + Intronic
1002484425 5:179524523-179524545 TGGGAGGAGCTCAGGGATGATGG - Intergenic
1002501821 5:179651796-179651818 TGGGAGGAGCTCAGGGATGATGG - Intergenic
1003456463 6:6287310-6287332 TGGTCTGAACTCAGGGAGGACGG - Intronic
1003636930 6:7840562-7840584 TGGGATGGTCTGAGGCAGAAAGG + Intronic
1003859304 6:10307587-10307609 TGGGTTGACCTCTGGGAGCAGGG + Intergenic
1004885074 6:20043358-20043380 GGGGCTTACCTGAGGGTGGAGGG - Intergenic
1005808987 6:29502135-29502157 TTGCATGACCAAAGGGAGGAGGG + Intergenic
1006169790 6:32086256-32086278 TTGGCTGACCTTTGGGAGGAGGG - Intronic
1007738046 6:43994164-43994186 TAGGATCCCTTGAGGGAGGAGGG + Intergenic
1010523794 6:76876029-76876051 TTTGATGAGCTGAGAGAGGAAGG - Intergenic
1011180997 6:84620414-84620436 TGGGATCACTAGAGGTAGGAGGG - Intergenic
1011356277 6:86475849-86475871 TGGGATGACCCTAGGGGGGCAGG - Intergenic
1011358424 6:86497092-86497114 TGTGATGACTTGAGAGAAGAAGG - Intergenic
1012249823 6:96967850-96967872 GGGCATGCCCTGAGGCAGGAAGG + Intronic
1013549493 6:111193090-111193112 TGGGAGGCCATGTGGGAGGATGG - Intronic
1014148536 6:118026244-118026266 TGTGATGAGATGGGGGAGGATGG + Intronic
1015117100 6:129661799-129661821 TGGGATGGGCTGAGGGTGGAGGG - Intronic
1015596534 6:134872397-134872419 GGGAAAGACCTGAAGGAGGAAGG - Intergenic
1015825873 6:137311210-137311232 TGGGATGCTGAGAGGGAGGATGG + Intergenic
1016005398 6:139084057-139084079 TGGGATGATCTGAGACAGGCAGG + Intergenic
1016986189 6:149897655-149897677 AGGGAGGATCTGAGGGAGAATGG + Intronic
1017604444 6:156118883-156118905 TGCCAAGAGCTGAGGGAGGAAGG + Intergenic
1017611641 6:156193049-156193071 GGGGCCTACCTGAGGGAGGAGGG - Intergenic
1017816694 6:158021538-158021560 TGGGAGGGCTGGAGGGAGGAGGG + Intronic
1017827971 6:158096404-158096426 AGGGATGTCTAGAGGGAGGAAGG - Exonic
1018583917 6:165334966-165334988 GTGGATGCCCTGTGGGAGGACGG - Intronic
1019384077 7:744080-744102 TGGGGTGAGGTGAGGGGGGAGGG - Intronic
1019508352 7:1404798-1404820 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019508367 7:1404832-1404854 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019508382 7:1404866-1404888 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019508397 7:1404900-1404922 TGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1020593151 7:10168619-10168641 TTTGATGAGCTGAGAGAGGAAGG + Intergenic
1020598904 7:10248000-10248022 TGGGACGCACTGAGGGAGGCTGG - Intergenic
1021085479 7:16417624-16417646 GGGGATCACTAGAGGGAGGAGGG + Intronic
1021190021 7:17609534-17609556 TGGGACTACCAGAGGGAAGAAGG + Intergenic
1022153853 7:27639426-27639448 TGAGACTACCTGAGGGGGGAGGG + Intronic
1023142354 7:37114015-37114037 TGGGTGGAGTTGAGGGAGGAAGG + Intronic
1023410040 7:39881178-39881200 TGAGAAGACCTGAAGCAGGAGGG - Intergenic
1023545844 7:41317177-41317199 GGGGTTGACCTGGGGTAGGATGG - Intergenic
1026960409 7:74404217-74404239 TGGGGAGACCCGAGGGAGAATGG - Exonic
1027456867 7:78403141-78403163 TGGGATGGGGGGAGGGAGGAGGG - Intronic
1027755333 7:82204375-82204397 TGGCAAGACCTAGGGGAGGAAGG + Intronic
1028348721 7:89816893-89816915 TGCCATGACCTGATGGAGCAGGG - Intergenic
1028984494 7:96998967-96998989 TGGGATGAAGGAAGGGAGGAGGG - Intergenic
1029032459 7:97483197-97483219 TGGGAAGACCTGAAAGAGCATGG + Intergenic
1029074726 7:97926743-97926765 TCGCATGACCTGAAGGATGATGG - Intergenic
1029219739 7:98978791-98978813 TGGGAAGCCCTGACGGAGTACGG + Exonic
1029222388 7:99000726-99000748 TGGGGTGTCCTGAAGGAGCAGGG + Intronic
1029545968 7:101210745-101210767 TGGGATACCCTGAGGGAAGAAGG - Intronic
1030098339 7:105921437-105921459 TGGGTTGAGGGGAGGGAGGAGGG + Intronic
1030224396 7:107132699-107132721 TGGGAAAACTTGAAGGAGGAAGG + Intronic
1031871257 7:127091727-127091749 AGGGATGACCAGTGGGAGGAGGG - Intronic
1031914806 7:127552943-127552965 TGGGATGGCGGGAGGGGGGAGGG + Intergenic
1032200837 7:129821644-129821666 TTGGATGAGGTGAGGGAGGCAGG + Intergenic
1032371938 7:131364631-131364653 TGGGACTACTTGAGGGTGGAGGG - Intronic
1032416448 7:131738763-131738785 AGGGATGACCAGAGGAAGAAGGG + Intergenic
1032416779 7:131741608-131741630 TGGGAGGAGCTGAGGAAGGATGG - Intergenic
1035395386 7:158531496-158531518 TGGGATGAGCTGAGCCTGGAGGG - Intronic
1035929141 8:3762217-3762239 TGGGATGATCTGAGTCAGGAGGG - Intronic
1036157907 8:6359445-6359467 TGGGCTGACCTCAGATAGGATGG - Intergenic
1036257813 8:7219522-7219544 TAGCATGACCTGAAGGATGATGG - Intergenic
1036259062 8:7226519-7226541 TAGCATGACCTGAAGGATGATGG - Intergenic
1036307560 8:7612992-7613014 TCGCATGACCTGAAGGATGATGG + Intergenic
1036309861 8:7678118-7678140 TAGCATGACCTGAAGGATGATGG - Intergenic
1036311115 8:7685115-7685137 TAGCATGACCTGAAGGATGATGG - Intergenic
1036358411 8:8060993-8061015 TAGCATGACCTGAAGGATGATGG + Intergenic
1036359671 8:8068001-8068023 TCGCATGACCTGAAGGATGATGG + Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036582339 8:10086951-10086973 TGGGTTGGCCTTAGGAAGGAGGG + Intronic
1036829747 8:12012639-12012661 TCGCATGACCTGAAGGATGATGG - Intergenic
1036891286 8:12598969-12598991 TCGCATGACCTGAAGGATGATGG - Intergenic
1036892543 8:12605959-12605981 TAGCATGACCTGAAGGATGATGG - Intergenic
1036898836 8:12656906-12656928 TCGCATGACCTGAAGGATGATGG - Intergenic
1037908597 8:22729779-22729801 GGGGAGGACCTGGTGGAGGAGGG + Intronic
1037911135 8:22744248-22744270 TGGTAGCACCTGAGGGAGGTGGG + Intronic
1038261059 8:25994775-25994797 TGGGACTACTTGAGGGTGGAGGG + Intronic
1038401728 8:27289028-27289050 AGGGATCAGCTGAGAGAGGAGGG + Intronic
1038600958 8:28942003-28942025 TGGGGTGGCCTGAGGGCGGATGG - Intronic
1039476471 8:37841678-37841700 GGGGAGGACTTGAGGGAGGGGGG - Exonic
1039698695 8:39940729-39940751 TGGGATGAATAGGGGGAGGAGGG - Intronic
1040444790 8:47482720-47482742 TGGCAAGATATGAGGGAGGAGGG + Intronic
1041123775 8:54613680-54613702 TGAGATGAACTGAGTGTGGAAGG + Intergenic
1044408909 8:91863317-91863339 TGAGATGAGGTCAGGGAGGAAGG + Intergenic
1045344089 8:101279222-101279244 TGGGATGACTAGGGGGAGGAGGG + Intergenic
1045515053 8:102852123-102852145 TGGCATGACCAAAGGTAGGATGG - Intronic
1045906169 8:107347634-107347656 TGGGATGAGGAGTGGGAGGAAGG + Intronic
1046255216 8:111687882-111687904 AGGGATTACTTGAGGGTGGAGGG - Intergenic
1046483080 8:114849113-114849135 TGGGATGAGGAGAGGGGGGAGGG + Intergenic
1047698422 8:127426800-127426822 AGGGAGGAGCTGGGGGAGGAGGG - Intergenic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1048491072 8:134894478-134894500 TGGGAGGTTCTGAGTGAGGAGGG + Intergenic
1048690342 8:136955820-136955842 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1048857675 8:138698130-138698152 AGGGTGGACCTGAGGGAGGGAGG + Intronic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049297340 8:141849761-141849783 TGGGAGGACCTGGGGCAGGGAGG - Intergenic
1049466411 8:142752964-142752986 ACAGATGACCTGAGGCAGGAGGG - Intergenic
1049680145 8:143914581-143914603 TGGGAAGACTTAGGGGAGGAGGG - Intergenic
1049685716 8:143938566-143938588 TGGGAGGCGCTGAGGGAGGGTGG - Intronic
1052278064 9:26701223-26701245 GGGGATGACTAGAGGGGGGATGG + Intergenic
1052785058 9:32820652-32820674 TGGGAAGAAGTGAAGGAGGAGGG - Intergenic
1055136522 9:72835274-72835296 TGGGATGAACAGAGTGAAGATGG - Intronic
1055549187 9:77414589-77414611 TGGGATGGGGGGAGGGAGGAGGG + Intronic
1055583777 9:77734549-77734571 TCAGCTGACCTGAGGTAGGATGG + Intronic
1056032449 9:82567222-82567244 AGGGATGAAGGGAGGGAGGAGGG + Intergenic
1059080387 9:111242959-111242981 GGGGCTTACCTGAGGAAGGAGGG + Intergenic
1060870421 9:127035364-127035386 TTGGATCAACTGAGGGAGGTAGG + Intronic
1061133936 9:128722878-128722900 TGGCAGGAAGTGAGGGAGGAAGG + Intronic
1061779463 9:132987217-132987239 TGGGAAGCCCAGAGGGAGCAAGG - Intronic
1061789004 9:133048780-133048802 TGGGGTAAAATGAGGGAGGAGGG + Intronic
1062255429 9:135618617-135618639 TGAGATGAGGTGAGGGAGGAAGG + Intergenic
1062523265 9:136968373-136968395 TGGAGGGACCTGAGGGAGGCTGG + Intergenic
1062591701 9:137277426-137277448 AGGGATAACCTGGGGGAGGTGGG + Intergenic
1203358693 Un_KI270442v1:191237-191259 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
1203372065 Un_KI270442v1:316561-316583 TGGGATGAGGGGAGGGGGGAGGG + Intergenic
1185632220 X:1523511-1523533 TGTGATTGCCAGAGGGAGGAGGG + Intronic
1186735840 X:12463070-12463092 TGTGGTAAGCTGAGGGAGGATGG + Intronic
1186908480 X:14136400-14136422 GGGGATGACCTCATGAAGGACGG + Intergenic
1187338644 X:18402201-18402223 TAGGATGGCCTCAGGGATGAGGG + Intergenic
1187615348 X:20987767-20987789 TGGGCTTACCTGAGGGTGGAAGG + Intergenic
1188506442 X:30889287-30889309 AGGGACGCACTGAGGGAGGAGGG - Intronic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1188553514 X:31386226-31386248 TGGGGTGAGGGGAGGGAGGAGGG + Intronic
1189088400 X:38051194-38051216 GGAGATGACCAGAGGGAAGAGGG + Intronic
1189842558 X:45096315-45096337 TGGGTAGAGCTGAGGGAGGGAGG - Intronic
1190037512 X:47039560-47039582 GGGGATTACTAGAGGGAGGAGGG - Intronic
1190853756 X:54272472-54272494 TGGGAAGAAGGGAGGGAGGAAGG + Intronic
1190945495 X:55089277-55089299 TGGGCTGGGATGAGGGAGGAAGG + Intronic
1190983812 X:55482618-55482640 TGGGAAGATCTGAGGGAGAGGGG + Intergenic
1192433514 X:71128124-71128146 TGGGGTGTACTGAGTGAGGAAGG + Intronic
1193209523 X:78789523-78789545 TGGGTTGATCTTATGGAGGATGG - Intergenic
1194657665 X:96592869-96592891 GGGTAAGACCTGAGGGTGGAAGG - Intergenic
1195672555 X:107482179-107482201 TGGGAAGACCGGGGGGAGGAGGG - Intergenic
1196575606 X:117314812-117314834 TGGGACTACTTGAGGGGGGAGGG - Intergenic
1197265816 X:124369704-124369726 TGGGATGATGGCAGGGAGGATGG + Intronic
1197574962 X:128200079-128200101 TTAGATGAGCTGAGAGAGGAAGG + Intergenic
1197986371 X:132270165-132270187 TGGGATGTTCAGAGGGAGCAGGG - Intergenic
1198412870 X:136389568-136389590 TGGGATGATATGAGTTAGGAGGG - Intronic
1198768699 X:140105529-140105551 TGAGATGACCAGAGGCAGAAAGG - Intergenic
1198974691 X:142323059-142323081 GGGGACTACCTGAGGGTGGAGGG - Intergenic
1200078987 X:153566279-153566301 TGGCAGGACCTCAGGGAGGAGGG - Intronic
1200574189 Y:4867509-4867531 TTGGATGAGCTGAGAGAAGAAGG + Intergenic
1200817456 Y:7548361-7548383 TGGGATGGCCAGAGAGAGGGAGG + Intergenic
1201424000 Y:13829787-13829809 TGTGATGCTTTGAGGGAGGAAGG + Intergenic