ID: 1125956072

View in Genome Browser
Species Human (GRCh38)
Location 15:43792151-43792173
Sequence CGCAGGCGGAGCGCTCAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125956072_1125956077 2 Left 1125956072 15:43792151-43792173 CCACGCTGAGCGCTCCGCCTGCG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1125956077 15:43792176-43792198 CCTCCGCCACTTACCCACCCCGG 0: 1
1: 0
2: 1
3: 15
4: 187
1125956072_1125956084 20 Left 1125956072 15:43792151-43792173 CCACGCTGAGCGCTCCGCCTGCG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1125956084 15:43792194-43792216 CCCGGCTCAAGCACGACCCGTGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125956072 Original CRISPR CGCAGGCGGAGCGCTCAGCG TGG (reversed) Intronic
900284061 1:1890895-1890917 CGCCCGCGGAGCGCGCAGCGCGG - Exonic
902477027 1:16693705-16693727 CGCAGGCCGGCCGCCCAGCGCGG + Intergenic
902861691 1:19251551-19251573 CGGAGGCGGAGCCCGCGGCGCGG - Exonic
903350093 1:22711725-22711747 CGCGGCCGCGGCGCTCAGCGTGG + Intronic
922806968 1:228395177-228395199 GACAGGCGGAGCGTGCAGCGGGG - Exonic
1064408925 10:15088671-15088693 CGCGGGAGGGGCGCTCCGCGAGG - Intronic
1065342030 10:24716548-24716570 CACAGGAGGTGCGCTCAGGGAGG + Intronic
1076713508 10:132351991-132352013 CGCAGGTGCAGCGCTCCGTGTGG + Intronic
1076713528 10:132352070-132352092 CGCAGGTGCAGCGCTCCGTGTGG + Intronic
1076713587 10:132352302-132352324 CGCAGGTGCAGCGCTCCGTGTGG + Intronic
1076713617 10:132352434-132352456 CGCAGGTGCAGCGCTCCGTGTGG + Intronic
1076713637 10:132352513-132352535 CGCAGGTGCAGCGCTCCGTGTGG + Intronic
1076713663 10:132352617-132352639 CGCAGGTGCAGCGCTCCGTGTGG + Intronic
1076856396 10:133117415-133117437 CAGAGGCCAAGCGCTCAGCGTGG + Intronic
1091313071 11:134588449-134588471 CGCAGGTGCAGCTCTCAGCAGGG - Intergenic
1096682797 12:53268172-53268194 CGCCGCGGGAGCGCGCAGCGCGG + Intergenic
1096779744 12:53984995-53985017 GGCAGGCGGAGCGCGCAGAGTGG - Intergenic
1102197123 12:111033907-111033929 CGCGGGCGGAGCGCGCCGGGCGG - Intergenic
1102518485 12:113465342-113465364 CGGAGGCGGCGCGCACGGCGCGG - Intronic
1104768938 12:131348340-131348362 TGCGGGGGGTGCGCTCAGCGGGG - Intergenic
1104810814 12:131619302-131619324 TGCAGGGGGTGCACTCAGCGGGG + Intergenic
1105405047 13:20126883-20126905 AGCAGGCAGAGCTCTCAGCCTGG - Intergenic
1105578056 13:21671099-21671121 CGCAGGAGGAGCGCTCCGCCCGG + Intergenic
1105843312 13:24274052-24274074 TCCAGGCGGAGAGGTCAGCGTGG + Intronic
1106340065 13:28819692-28819714 CGCAGGCGGTGGGCGCGGCGCGG - Intergenic
1112579897 13:100669647-100669669 CGCAGGGGGTGGGCTCAGAGAGG - Intronic
1116426491 14:44798609-44798631 CGCAAGCGCAGCGCGCAGCCCGG - Intergenic
1119646583 14:76352909-76352931 AGTGTGCGGAGCGCTCAGCGAGG - Intronic
1124118306 15:26867527-26867549 AGCAGGCGGGGCGCGCAGCCAGG + Intronic
1125956072 15:43792151-43792173 CGCAGGCGGAGCGCTCAGCGTGG - Intronic
1132807659 16:1782509-1782531 GGCCGGCGGAGCGCGCAGCGGGG - Exonic
1137737632 16:50736751-50736773 CGCAGGCGGAGATCGCAGCAGGG + Intergenic
1142240176 16:88941366-88941388 CGGAGGCGGAGCGCGCGGGGCGG - Intronic
1145925709 17:28645154-28645176 CGCAGGAGCAACGCTGAGCGAGG + Intronic
1146935720 17:36811503-36811525 AGCAGGCGGGGCTCTCAGAGAGG - Intergenic
1148502296 17:48101100-48101122 GACAGGCGAAGAGCTCAGCGCGG + Exonic
1148538093 17:48457404-48457426 CGCAGGTGGCACGCTCAACGCGG + Intergenic
1150217257 17:63477498-63477520 CGCAGGCCGTGCGCGCAGCCCGG - Intergenic
1150643512 17:66964770-66964792 CGGGGTCGGAGCGCGCAGCGCGG + Intergenic
1156426619 18:37020215-37020237 GGCAGGAGGATCGCTCAACGCGG - Intronic
1157753089 18:50195213-50195235 CGGGGGCGGGGCGCTCAGAGAGG + Intergenic
1160967711 19:1753863-1753885 CGCGGGCGGCGCGGGCAGCGCGG + Exonic
1163370267 19:16897497-16897519 GGCTGGAGGAGCGGTCAGCGGGG - Intronic
1166855186 19:45779777-45779799 CGGACGCGGGGCGTTCAGCGAGG - Exonic
928549698 2:32358006-32358028 CGCGGGCTGTGCGCCCAGCGTGG + Intronic
935679616 2:105624681-105624703 AGCAGGAGGAGGGCTCAGCCAGG - Intergenic
937126116 2:119476120-119476142 CCCAGGGGGAGCGCCCAGTGAGG - Intronic
947910285 2:233796113-233796135 CCCAGGCCCAGCGCTCAGAGGGG - Intronic
1171346435 20:24469567-24469589 CGCAGGCGGAGAGCGCAGGGCGG + Exonic
1173827695 20:46057986-46058008 CGCCGGAGGAGCGCAGAGCGAGG - Intronic
1176047976 20:63102578-63102600 CGCGGGCCGAGCGCCCAGAGCGG + Intergenic
1179209595 21:39313757-39313779 CGGAGGCAGAGAGCTGAGCGAGG - Exonic
1180000716 21:44994128-44994150 AGCAGGCGGGGCCCTCAGGGAGG - Intergenic
1180073807 21:45451641-45451663 AGCAGCAGGAGCGCTCAGAGGGG + Intronic
1180950453 22:19718417-19718439 CGCCCGCGGAGCGCGCGGCGGGG - Intronic
1181085167 22:20436489-20436511 CGGAGGCGGGGCTCGCAGCGGGG + Intronic
1181155455 22:20917406-20917428 CGCAGACGGAGCGCGCTGAGCGG + Exonic
1185132506 22:49047114-49047136 CTCAGGCTGAGCTCTCAGCTTGG + Intergenic
955346346 3:58164711-58164733 CGCAGGCCCAGAGTTCAGCGTGG - Intronic
956678001 3:71753612-71753634 CTCCGCCGGAGCGCGCAGCGCGG - Intronic
961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG + Exonic
965040258 3:163499044-163499066 CGCAGGCGCAGCGCGCAGCCTGG - Intergenic
978619030 4:110621503-110621525 CACAGGCGCAGCGCTCCTCGCGG - Intronic
982868845 4:160550457-160550479 CGCAAGCGCAGCGCGCAGCTCGG + Intergenic
984155822 4:176195295-176195317 AGCAGGCGGGGCGCCCACCGGGG + Intronic
986704131 5:10441535-10441557 CGCAGGCGGGTCCCGCAGCGGGG + Exonic
991711740 5:69415256-69415278 GGCAGGCTGAGCGCCGAGCGCGG - Intronic
994185006 5:96807479-96807501 GCCAGGCGGAGCGCTGAGGGAGG + Intronic
1002780459 6:361212-361234 CCCAGGCAGACCGCTCAGCCAGG - Intergenic
1003146221 6:3512727-3512749 GGCAGGAGGAGAGCTGAGCGTGG + Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013422630 6:109979739-109979761 TGCAGGCGGCGCGCTCTGCCAGG - Exonic
1019301995 7:310069-310091 CGCAGGCAGTGCTCTCAGCGGGG + Intergenic
1032709042 7:134446671-134446693 CTCTGGCGAAGCGCTCAGTGTGG - Intronic
1036302897 8:7580525-7580547 CGGTTGCGGAGCGATCAGCGAGG + Intergenic
1036352452 8:8020869-8020891 CGGTTGCGGAGCGATCAGCGAGG + Intergenic
1037928807 8:22865401-22865423 CGCAGGTGGAGCGCGCAGCCAGG - Intronic
1038632863 8:29262721-29262743 CGCAGGCGGAAGGGGCAGCGGGG + Intronic
1038963670 8:32548699-32548721 CGGAGACGGAGCGCTCTACGCGG - Intronic
1039467937 8:37797177-37797199 TGCGGGAGGAGTGCTCAGCGGGG - Intronic
1041091243 8:54302973-54302995 TGCAGTTGGAGAGCTCAGCGGGG - Intergenic
1045305042 8:100951370-100951392 CGCCGCCGCAGCGCCCAGCGCGG + Intronic
1046102492 8:109630924-109630946 GGCAGGAGGAACGCTCAGCGGGG + Intronic
1047961661 8:130016088-130016110 CGCGAGGGGAGCGCGCAGCGGGG - Intronic
1061726886 9:132587028-132587050 CGCGGGCAGAGCGCCGAGCGCGG + Intronic
1203631321 Un_KI270750v1:74588-74610 CCCAGACGCAGGGCTCAGCGAGG - Intergenic
1199772624 X:150984106-150984128 GGCGGGCGGAGCGGTCGGCGGGG + Intronic
1200218510 X:154379280-154379302 CGCAGGCTGCGCGCGCTGCGCGG - Exonic