ID: 1125957575

View in Genome Browser
Species Human (GRCh38)
Location 15:43800806-43800828
Sequence TCGGGGCGGGCTGAGAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125957567_1125957575 12 Left 1125957567 15:43800771-43800793 CCAATCTGGAGACGGTAAGGTTG 0: 1
1: 0
2: 1
3: 4
4: 53
Right 1125957575 15:43800806-43800828 TCGGGGCGGGCTGAGAGCAGAGG 0: 1
1: 0
2: 1
3: 32
4: 305
1125957564_1125957575 20 Left 1125957564 15:43800763-43800785 CCAGAGTTCCAATCTGGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1125957575 15:43800806-43800828 TCGGGGCGGGCTGAGAGCAGAGG 0: 1
1: 0
2: 1
3: 32
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125957575 Original CRISPR TCGGGGCGGGCTGAGAGCAG AGG Intronic
900110867 1:1005030-1005052 TCAGGGCTGGCGGACAGCAGAGG - Intergenic
900285766 1:1899643-1899665 TGGGGGCAGGGGGAGAGCAGAGG - Intergenic
900600269 1:3499884-3499906 TTGGGCCCGGCTGTGAGCAGCGG - Exonic
901068435 1:6505713-6505735 TGCGGGCGGGGTGAGAGCAGAGG + Intronic
901952456 1:12759719-12759741 TGGTGGCGGGCTTAGAGCACAGG + Intronic
902676952 1:18015425-18015447 GAGAGGAGGGCTGAGAGCAGGGG + Intergenic
903809764 1:26028753-26028775 TCGGGGAGGGCTGGGCTCAGAGG + Intronic
908228945 1:62084972-62084994 TCTGGGTGGGCTGAGCACAGTGG + Intronic
910183187 1:84506776-84506798 GCCGGGCGGGCGGGGAGCAGGGG + Intergenic
910757300 1:90706971-90706993 AGGGCGCGGGCTGAGAGCCGCGG + Intergenic
913211728 1:116588245-116588267 TCTGGGCGGGCTGGGAGCTAAGG + Intronic
915148321 1:153808839-153808861 TGGGGGCGGGCGGGGGGCAGTGG + Exonic
915235182 1:154475111-154475133 CAGGGGAGGGCTGAGGGCAGGGG + Intronic
915323723 1:155070053-155070075 ACAGTGTGGGCTGAGAGCAGAGG - Intergenic
916100541 1:161390079-161390101 GCGGGGCGGGACGAGAGGAGGGG + Intergenic
916233339 1:162561645-162561667 GCGGGGCGGGCCGGGAGCGGGGG - Exonic
916676263 1:167066506-167066528 TCTGGACAGGGTGAGAGCAGGGG - Intronic
917345267 1:174022439-174022461 GCGGGGCGGGCGGAGGGGAGGGG + Intergenic
917620607 1:176791827-176791849 GCTGGGCGGGCTGGGTGCAGTGG - Intronic
918215972 1:182392031-182392053 GCCGGGAGGGCTGAGGGCAGAGG + Exonic
918764796 1:188466486-188466508 TAGGGGTTGTCTGAGAGCAGTGG + Intergenic
920378621 1:205522900-205522922 GCGGGGCGGGCGGTGGGCAGTGG + Intronic
921217555 1:212950684-212950706 TCCGGGCGGCGGGAGAGCAGGGG - Exonic
922821155 1:228486822-228486844 TCCGTGCAGGATGAGAGCAGCGG + Intergenic
924562591 1:245169537-245169559 TCTCGGCAGGCTGAGAGCAGAGG + Intronic
1063108842 10:3017608-3017630 CCGGAGTGGGCTGGGAGCAGAGG + Intergenic
1065172627 10:23047256-23047278 TGCAGGCGGGGTGAGAGCAGGGG + Intergenic
1066685376 10:37976520-37976542 CCGGCGCGGGCCGGGAGCAGAGG - Exonic
1067040733 10:42951928-42951950 TCAGGGCGGGCTGGGATCTGGGG + Intergenic
1067999238 10:51312157-51312179 TCAGGAAGGGCTGGGAGCAGTGG - Intronic
1069798983 10:71070636-71070658 CCGGGGCTGGCAGTGAGCAGGGG - Intergenic
1070074986 10:73126187-73126209 TAGGGGTGTGCTCAGAGCAGGGG - Intronic
1070814182 10:79312826-79312848 GCGGGGCGGTCTGAGGGCACAGG - Exonic
1071434608 10:85635596-85635618 TCAGGGCTGGCTGAGGGCAGAGG - Intronic
1073292837 10:102421747-102421769 GCGGGACGGGCTGAGAGTTGGGG + Intronic
1074682064 10:115917181-115917203 ACGGGGCCGGCTGGGAGCGGTGG + Intronic
1076662511 10:132064971-132064993 GCAGAGCGGGCTGGGAGCAGGGG + Intergenic
1076701262 10:132274602-132274624 TCCTGGTGGGCTGAGGGCAGGGG - Intronic
1076741286 10:132487026-132487048 TCGGGGTGGCCTGAGTGGAGGGG - Intergenic
1077330086 11:1980360-1980382 AAGGAGAGGGCTGAGAGCAGGGG + Intronic
1077356308 11:2120520-2120542 TGGGAGCGGGCTGAGACCACAGG - Intergenic
1078094905 11:8290748-8290770 TGGGGGAGAGGTGAGAGCAGAGG - Intergenic
1078452810 11:11453029-11453051 TCAGGGCTGGGTGAGGGCAGGGG - Intronic
1079430859 11:20387503-20387525 TGGGGGCGGGGCGAGAGCGGGGG - Intergenic
1080651351 11:34225191-34225213 TCAGGGAGGGCAGAGGGCAGAGG + Intronic
1081545110 11:44066189-44066211 TCCGGGCGCGCTGAGCGCAGGGG + Intronic
1081753891 11:45531185-45531207 CCGGGATGGGCTGAGAGTAGGGG + Intergenic
1081796162 11:45821439-45821461 TCTGGTGGGGTTGAGAGCAGGGG - Intergenic
1081854941 11:46297083-46297105 TGGGAGGGGGCTGTGAGCAGAGG - Intronic
1083313977 11:61802810-61802832 TCGGCGAAGGCTGACAGCAGGGG + Exonic
1083412824 11:62505752-62505774 TGGGGGCGGGTGGAGAGTAGGGG - Intronic
1083628498 11:64084190-64084212 TGGGAGGGGGCTGAGAGGAGGGG - Intronic
1084360881 11:68667794-68667816 TGGGGGCTGGGTGAGACCAGAGG + Intergenic
1084385451 11:68840895-68840917 TCGTGCCGGGCTGGGAGCGGCGG - Intronic
1085027214 11:73243255-73243277 TAGGGGCGTGCGGAGGGCAGGGG - Intergenic
1087882528 11:103434775-103434797 TTGGTGCCGGCTGAGAGCTGGGG + Intronic
1089216001 11:116835152-116835174 TCTGGGCGGGATGGGAGTAGTGG + Intergenic
1089508186 11:118979069-118979091 TCTGGGGTGGCTGAGAGGAGGGG - Exonic
1090242203 11:125192105-125192127 AGGGGGAGGGCTGAGGGCAGAGG + Intronic
1202813063 11_KI270721v1_random:35539-35561 AAGGAGAGGGCTGAGAGCAGGGG + Intergenic
1091548268 12:1518849-1518871 TGGGGGCGGGGTGTGAACAGGGG + Intergenic
1091571580 12:1691270-1691292 TCGGGGGGAGGTGAGAGCTGAGG + Intronic
1091832869 12:3562774-3562796 TGGGGCCATGCTGAGAGCAGTGG + Intronic
1092238523 12:6823904-6823926 TCGGGGCGGGGCGGGGGCAGAGG + Exonic
1093685231 12:22046709-22046731 TGGGGCCGGGCTGAGAGCCCAGG + Intronic
1096211575 12:49770194-49770216 TCGGTGCTGGCTGTGGGCAGGGG - Intergenic
1096355965 12:50941273-50941295 TTGGGGCAGGCTGAGTGCAGTGG - Intergenic
1097033156 12:56104257-56104279 GAGGGGCGGGCTGAGGGGAGAGG - Intronic
1097190265 12:57216409-57216431 TCGGGGCAGGCGCAGGGCAGGGG - Intergenic
1101241494 12:102843860-102843882 TCGGGGTGAGATGAGAGAAGGGG - Intronic
1104860466 12:131920870-131920892 TGGGGCCGGGCTGAGAGCGCTGG + Intronic
1104986028 12:132598157-132598179 GAGGGGCGGGCGGAGAGGAGGGG - Intergenic
1104986111 12:132598439-132598461 GCGGGGCGCGCGGAGAGGAGGGG - Intergenic
1105941817 13:25154361-25154383 TCTGGGCAGGTTGAGAGCAGAGG + Intergenic
1105969638 13:25416417-25416439 TGGGGGTGGGGTGGGAGCAGGGG - Intronic
1106259053 13:28048712-28048734 GTGGTGCTGGCTGAGAGCAGGGG - Intronic
1106525649 13:30539182-30539204 TCTGGGCTGGCTGGGCGCAGTGG - Intronic
1110552551 13:76825483-76825505 TCGGTGGGGGCTGGGGGCAGAGG - Intergenic
1111262132 13:85754544-85754566 TCAGGGCTGGCTGGGTGCAGTGG - Intergenic
1111467796 13:88640258-88640280 TCTGACCAGGCTGAGAGCAGAGG + Intergenic
1112570457 13:100588805-100588827 CGGGGGCGGCCTGGGAGCAGAGG - Intronic
1114181181 14:20369293-20369315 TAGGGGAGGGCTGGGAGCAGTGG - Intronic
1114521221 14:23337735-23337757 TCCGGGAGGGCTGATAGCATGGG - Intergenic
1116887050 14:50231661-50231683 CCGCGGCGGGCGGTGAGCAGCGG + Intergenic
1117275297 14:54187826-54187848 TGGGGGTGGGGTGGGAGCAGGGG - Intergenic
1118742111 14:68747234-68747256 TTGGTGCAGGCTGAGAGGAGGGG - Intergenic
1119313594 14:73672316-73672338 AAGGGTCAGGCTGAGAGCAGTGG + Intronic
1119769912 14:77214082-77214104 TTGGGGAGGGCTGAGAGATGGGG - Intronic
1121010505 14:90517505-90517527 TCTGGGCGGGCTGGGGGCAGGGG - Intergenic
1121083334 14:91126423-91126445 TTGGGGTGTGCTCAGAGCAGGGG + Intronic
1121413704 14:93764367-93764389 GAGGGGCTGGCTGAGAGGAGAGG - Intronic
1122378742 14:101286708-101286730 TGGGGGTGGGGTGAGGGCAGTGG - Intergenic
1122493053 14:102132990-102133012 TGGGGGCGGGCTGGGCGCAGTGG + Intronic
1122629901 14:103102881-103102903 TGGGAGAGGGCTGAGAGCCGAGG + Intronic
1122939097 14:104973306-104973328 CCAGGGAGGGCTGAGGGCAGCGG + Intronic
1124514558 15:30355433-30355455 TCGGGCTGGTCTGAGTGCAGTGG + Intergenic
1124728362 15:32175332-32175354 TCGGGCTGGTCTGAGTGCAGTGG - Intergenic
1125957575 15:43800806-43800828 TCGGGGCGGGCTGAGAGCAGAGG + Intronic
1126616140 15:50582244-50582266 TCGGTGGGGGCTGTGTGCAGTGG - Intronic
1128078921 15:64844753-64844775 TTGGGGAGGGCTCTGAGCAGGGG - Intronic
1128176598 15:65561801-65561823 TCGGGACAGGCTGGGGGCAGGGG - Intronic
1130272679 15:82460264-82460286 TTGGGGCAGGCTGGGTGCAGTGG + Intergenic
1130371493 15:83288549-83288571 GCAGGGTGGGCAGAGAGCAGTGG + Intergenic
1130465031 15:84187617-84187639 TTGGGGCAGGCTGGGTGCAGTGG + Intergenic
1130487657 15:84407187-84407209 TTGGGGCAGGCTGGGTGCAGTGG - Intergenic
1130499234 15:84485920-84485942 TTGGGGCAGGCTGGGTGCAGTGG - Intergenic
1130512947 15:84604179-84604201 CCGGCGCTGGCTGAGACCAGAGG + Exonic
1130553277 15:84905460-84905482 CCGGGTGGGGGTGAGAGCAGGGG - Intronic
1130587321 15:85192231-85192253 TTGGGGCAGGCTGGGTGCAGTGG + Intergenic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1132327983 15:100987861-100987883 TAGGGGAGGGGTGAGGGCAGGGG + Intronic
1132640783 16:977408-977430 CCGGCGCAGGCTGTGAGCAGAGG - Intronic
1132990072 16:2787762-2787784 TGGGGGCTGGCGGAGAGCAGTGG + Intronic
1133321530 16:4916790-4916812 TAGGGGTGGGCTGGGTGCAGTGG - Intronic
1134419507 16:14072014-14072036 CAGAGGTGGGCTGAGAGCAGCGG + Intronic
1136169126 16:28477635-28477657 TCTGGGAGGGCAGAGAGCAGGGG + Exonic
1136957459 16:34803063-34803085 TCGTGGCGGGCAGAAAGCCGCGG - Intergenic
1137271935 16:46907868-46907890 TCGGGGAGGGCTGGGGCCAGTGG + Intronic
1137735360 16:50719583-50719605 TCGAGGGCGGCTGAGACCAGAGG + Intronic
1138351571 16:56348785-56348807 TCGGGGAGGGCAGTGAGGAGGGG - Intronic
1138560408 16:57797813-57797835 ACGGGTCGGGCACAGAGCAGGGG - Intronic
1139469143 16:67169114-67169136 TCGGGGAGGGCAGAGGCCAGGGG + Intronic
1142120129 16:88383066-88383088 TCGGGGCGGGGTGGGAGGAGAGG - Intergenic
1142121171 16:88387356-88387378 TCAGGGCGGGGTGGGAGCGGCGG + Intergenic
1142266394 16:89065767-89065789 TCGTGGAGTGCTGAGAACAGGGG - Intergenic
1142378203 16:89717599-89717621 TCGGGGCGGGATGAGAAAATGGG - Intronic
1142817760 17:2440532-2440554 TGGGGTCGGGCTGGGCGCAGTGG - Intronic
1143150819 17:4807015-4807037 GCGGGGCGGGCCGAGGGCAGCGG + Intergenic
1143294912 17:5863684-5863706 CCAGGGAGGGCTGAGAGAAGAGG + Intronic
1143871335 17:9959155-9959177 TCAGGGTGGGCTGCGAGCTGGGG - Intronic
1144551087 17:16241299-16241321 TTGGGGTGGGCTGGGTGCAGTGG + Intronic
1144670467 17:17129959-17129981 TCAAGGCTGGCTGGGAGCAGAGG - Intronic
1146063387 17:29618436-29618458 TGGGTGCCGGCTGAGAGGAGAGG + Intronic
1146896249 17:36544519-36544541 TCGGGGCTGACTCAGGGCAGAGG - Intergenic
1147167973 17:38603453-38603475 TCGGGGAGTGCTGAGTGGAGAGG - Intronic
1148017533 17:44532769-44532791 TCAGGGCTGGCTGGGCGCAGTGG - Intergenic
1148183148 17:45620823-45620845 GCGGGGTGGGCTCAGGGCAGGGG - Intergenic
1148206639 17:45784009-45784031 TCGGGGCGCGCTGGCAGCAGTGG - Intergenic
1148265702 17:46224868-46224890 GCGGGGTGGGCTCAGGGCAGGGG + Intronic
1148482747 17:47970886-47970908 GCGAGGCGGGCTCAGGGCAGGGG - Intronic
1149422160 17:56521475-56521497 GGGGGGCAGGGTGAGAGCAGGGG + Intergenic
1150681100 17:67285206-67285228 GCGGGGCAGGCTGGGTGCAGTGG - Intergenic
1151852812 17:76701065-76701087 ACGCGGAGGGCTGTGAGCAGGGG + Intronic
1152045282 17:77930965-77930987 GCGGGGTGGGCTGAGAACTGGGG + Intergenic
1152221617 17:79071753-79071775 TCTGGGCTGGCCGGGAGCAGTGG + Intergenic
1152852861 17:82648089-82648111 CCGGCTCGGGCTGGGAGCAGCGG + Intronic
1152930031 17:83104696-83104718 TCGGAGAGGGCTGACAGGAGAGG + Intergenic
1159921273 18:74229427-74229449 TAGGGGCTGGCTGGGCGCAGTGG + Intergenic
1160680239 19:408917-408939 TCGGGGAGGGCTGGGGGCGGGGG - Intronic
1160836629 19:1127571-1127593 TCGGGGCTGGCTGGGGGCACCGG + Intronic
1160853425 19:1205657-1205679 GCGGGGCGGGCAGAGGGCCGGGG + Intronic
1161077270 19:2291878-2291900 TAGGGGCGGGCTGGCGGCAGAGG - Exonic
1161111034 19:2470212-2470234 TGGGGGCGGGCTGGGTGCAGTGG - Intergenic
1161226713 19:3150317-3150339 TGGGGAGGGGCTGAGGGCAGGGG + Intronic
1161299826 19:3537295-3537317 TCGGGTGGAGCTGACAGCAGAGG - Intronic
1161321410 19:3643372-3643394 TCGGGCCGGCCTGAGGGGAGAGG + Exonic
1161957844 19:7506316-7506338 TAGGGGCGGGGCCAGAGCAGTGG - Intronic
1162418585 19:10552968-10552990 GCTGGGCGAGCTGGGAGCAGAGG - Exonic
1162582842 19:11540893-11540915 CTGGGGCGGGCTGAGAGCCAGGG - Intronic
1163257346 19:16164830-16164852 GCGGGGGGGGCTGAGTGCCGAGG - Exonic
1163729653 19:18941442-18941464 TGGGGTCGGGTTGGGAGCAGAGG + Intergenic
1163756389 19:19108909-19108931 TGGGAGTGGGCTGAGTGCAGCGG - Intronic
1166072051 19:40393571-40393593 TCAGGGCGGGTTGGGCGCAGTGG - Intergenic
1166369621 19:42293665-42293687 TGGGGCCGGGCTGGGAGGAGTGG - Exonic
1166703031 19:44893113-44893135 TGGGGCCAGGCAGAGAGCAGGGG - Intronic
1167435961 19:49478896-49478918 TGGGGGGGGGCTGGGAGCAGGGG - Exonic
1167517866 19:49933628-49933650 TCAGGGCGGGCTTTGAGAAGGGG + Exonic
1167562267 19:50232925-50232947 TGTGGGAGGGCTGGGAGCAGGGG + Intronic
1167606842 19:50485758-50485780 ACGCGGAGGGCTGTGAGCAGGGG - Exonic
1167744577 19:51342972-51342994 CAGGGGAGGGCTGTGAGCAGGGG - Intergenic
1167861160 19:52285185-52285207 TCGTGGTGGTGTGAGAGCAGAGG - Intronic
1167947907 19:53003973-53003995 TCCGGACGGGCTCAGAGCAGAGG - Intergenic
1168365708 19:55785098-55785120 GCGGAGCTGGCTAAGAGCAGGGG + Intergenic
926188933 2:10712703-10712725 TGGGGCCAGGCTGAGAGCTGGGG + Intergenic
926207757 2:10846052-10846074 AAGGGGCTGGCTGAGGGCAGAGG + Intergenic
927099905 2:19780202-19780224 AAGGTGTGGGCTGAGAGCAGTGG - Intergenic
927838219 2:26418356-26418378 TGGGGGTGGGCTGGGAGCTGTGG + Intronic
928146666 2:28784626-28784648 TCTGGGAAGGCTGGGAGCAGTGG + Intronic
929767434 2:44858393-44858415 TGGGGGAGGGGTGAGAGGAGTGG + Intergenic
932304447 2:70692000-70692022 TCAGGGTAGGCTGAGAGTAGGGG - Intronic
932446192 2:71782965-71782987 TGGAGGCTGGCTGAGAACAGAGG - Intergenic
932470394 2:71951277-71951299 CAGGGACGGACTGAGAGCAGAGG - Intergenic
932573596 2:72950950-72950972 TCGGGGCGGGCTGGAATCCGTGG + Intronic
932892960 2:75611862-75611884 GCAGGGCAGGCTGTGAGCAGAGG - Intergenic
933886307 2:86721136-86721158 CCGGGGCCGGCTGGGAGCGGGGG - Intronic
934248000 2:90324031-90324053 CCGGGGCGGGCAGAAAGCCGCGG + Intergenic
934307559 2:91839967-91839989 CCGGGGCGGGCAGAAAGCCGCGG - Intergenic
936091432 2:109504022-109504044 GCCGGGCTGCCTGAGAGCAGAGG + Intronic
937534345 2:122867356-122867378 TCAGGGCAGGCTGGGAGCAGTGG - Intergenic
937910994 2:127075645-127075667 TGGGAGAGGGCTGGGAGCAGAGG - Intronic
937924318 2:127156122-127156144 TAGGGGAGGACTGAGAGCAACGG + Intergenic
938296336 2:130181858-130181880 TCGGGGCGGGCGGGGGGAAGGGG - Exonic
943390463 2:187260817-187260839 ACGGGGTGGGGTGAGAGGAGGGG + Intergenic
946152344 2:217785098-217785120 TAGGGGCTGGCTGAGGGAAGGGG + Intergenic
946163568 2:217850184-217850206 CCCGGGCTGGCTCAGAGCAGTGG - Intronic
947198947 2:227597814-227597836 TCGGGGCGGGGTGAGGGGTGCGG + Intergenic
948371766 2:237494179-237494201 AAGGGGGGGGCAGAGAGCAGAGG + Intronic
948831092 2:240598587-240598609 TCGGGGTGGGGTGTGAGAAGGGG + Intronic
948858198 2:240740399-240740421 GCGGGGAGGGCAGAGAGGAGGGG - Intronic
949001248 2:241615455-241615477 TCTGGGTGGCCTCAGAGCAGGGG + Intronic
1169262521 20:4149007-4149029 CCGGGGGAGGCTGAGAGCCGGGG - Intronic
1171425690 20:25047196-25047218 ACTGGGCAGCCTGAGAGCAGCGG - Intronic
1171997050 20:31739501-31739523 GCGGGGCAGGGTGCGAGCAGGGG + Exonic
1172200019 20:33119022-33119044 TCGGGGTGATTTGAGAGCAGGGG + Intergenic
1175734101 20:61373272-61373294 TCGGTGAGGGCTGAGGGCATTGG + Intronic
1175818526 20:61896193-61896215 TCGGGGTTGGCTGGGATCAGAGG - Intronic
1175870922 20:62208993-62209015 TCTGGACGGGCTGTGGGCAGGGG + Intergenic
1176027434 20:62993295-62993317 GCGGGGGAGGCTGGGAGCAGGGG + Intergenic
1176204529 20:63881072-63881094 TCCGAGCGGGCTGGGCGCAGTGG + Intronic
1178405038 21:32316843-32316865 TCGGGGCTGGCTGAGTCCACAGG + Exonic
1179060762 21:37976801-37976823 TCGGGGCAGGCAGAGTCCAGGGG + Intronic
1179208088 21:39302467-39302489 TAAGGCCGGGCTGAGAGCAGTGG + Intronic
1179538163 21:42065817-42065839 TTGGTGCAGGCTGAGTGCAGTGG - Intronic
1179654641 21:42837680-42837702 GCGGGGAGCGCTGTGAGCAGAGG - Intergenic
1179880173 21:44290322-44290344 ACGGGCCCAGCTGAGAGCAGCGG - Intronic
1180070846 21:45435237-45435259 TGGGGGCGGGAGGAGAGAAGAGG + Intronic
1181283512 22:21736090-21736112 GCGGGGCGGGGCGAGAGCAGGGG + Intergenic
1181480373 22:23195131-23195153 GCTGAGCAGGCTGAGAGCAGTGG + Intronic
1181483092 22:23213352-23213374 TCGGGCTGGGCTGAGAGGTGTGG + Intronic
1181674832 22:24444781-24444803 ACAGGGAGGTCTGAGAGCAGGGG + Intergenic
1183199849 22:36378528-36378550 TCAGGGCTGGCTGAGGACAGTGG + Intronic
1183264474 22:36816870-36816892 GCGGGGCCGGCGGAGTGCAGGGG + Intronic
1183272171 22:36868963-36868985 TGAGGGCGGGGTGAGACCAGTGG - Intronic
1183538736 22:38417653-38417675 TCTGGGCAGGCTGGGAGCAGAGG - Intergenic
1184189633 22:42886129-42886151 TCGGCACAGGCTGAGGGCAGGGG - Intronic
1184649557 22:45913381-45913403 CAGGAGCAGGCTGAGAGCAGGGG - Intergenic
1184783927 22:46662735-46662757 CCAGGGCGGGCAGAGAGCTGGGG + Intronic
1184893790 22:47395252-47395274 GCGAGGATGGCTGAGAGCAGAGG + Intergenic
953660022 3:44885087-44885109 TGGGGATGAGCTGAGAGCAGTGG - Intronic
954143253 3:48621215-48621237 CAGGGGCTGGATGAGAGCAGGGG + Intronic
954383634 3:50232985-50233007 TCGGGGAGGCTTCAGAGCAGTGG + Intronic
954838913 3:53494558-53494580 TCGGGGCGGGCGGAGGGCGGGGG + Intergenic
954912735 3:54122518-54122540 GCGGGGAGGGCGGAGAGGAGAGG - Intergenic
961512361 3:127410870-127410892 GCAGGCCGGGCTGAGAACAGTGG - Intergenic
962188006 3:133280412-133280434 TTGGGGTGGGCTGAGTGTAGGGG + Intronic
962324617 3:134422967-134422989 TGGGTGCAGGCTGAGAGGAGAGG - Intergenic
963266288 3:143243196-143243218 TAGGGGCAGGCTAAGGGCAGGGG + Intergenic
968073442 3:195802386-195802408 GCGGTGGAGGCTGAGAGCAGGGG - Intronic
968432920 4:569212-569234 CCGGGGTGCGCTGAGAGCAGGGG - Intergenic
968495069 4:910802-910824 TCGGGGAGGCCTCAGAGCTGTGG - Intronic
968732638 4:2277007-2277029 TTGGGGCAGGGAGAGAGCAGAGG + Intronic
968922505 4:3529936-3529958 TCGCAGGAGGCTGAGAGCAGTGG + Intronic
968948316 4:3677123-3677145 GCAGGCCGGGCTGAGAGCAGCGG + Intergenic
969486089 4:7473277-7473299 GCGGGAGGGGCTGAGAGGAGAGG + Intronic
969692357 4:8710626-8710648 TCTGGGAGGGCTGAGACCACAGG + Intergenic
973699765 4:53525195-53525217 TCTGGCCAGGCTGGGAGCAGTGG + Intronic
973792953 4:54395086-54395108 TCAGGGGAGGCTGAGAGCAGTGG + Intergenic
977685536 4:99843096-99843118 TGGGGTCTGGCTGAGAGCAGTGG - Intronic
979344385 4:119569697-119569719 TAGGGGTGTGCTCAGAGCAGGGG + Intronic
981450063 4:144886378-144886400 TCGGGGTGGGCTATGCGCAGTGG - Intergenic
981550645 4:145937887-145937909 TCGGGGCGCGCGGAGGGCTGGGG - Intronic
983618411 4:169733601-169733623 CAGGGACGGGCTGAGCGCAGTGG + Intronic
984923720 4:184788031-184788053 TCAGGGCTGGGAGAGAGCAGAGG + Intronic
985549355 5:525123-525145 CCGGAGCGGGCTGTGGGCAGAGG - Intergenic
985891667 5:2720364-2720386 TAGGGGTGGGATGGGAGCAGGGG + Intergenic
986242756 5:5976298-5976320 TCCTGGAGGGCTCAGAGCAGAGG - Intergenic
986416053 5:7529365-7529387 GCTGGGCAGGCTGGGAGCAGAGG + Intronic
987039941 5:14052902-14052924 TCGGGTCAGGATGGGAGCAGTGG + Intergenic
988714236 5:33809340-33809362 TGGGGGCGGGATGGGAGGAGTGG - Intronic
997257141 5:132437815-132437837 TGGGGGCGGGCAGGGAGGAGTGG + Intronic
998119119 5:139561632-139561654 GCGGGACGGGCTGAGGGCCGGGG - Exonic
998366845 5:141637522-141637544 TGCGGGCTGGCTGAGAGCGGTGG - Exonic
998825299 5:146095388-146095410 TTGATGCGGGTTGAGAGCAGAGG + Intronic
999286414 5:150396851-150396873 TTGGGGTGGGCTGGGAGAAGCGG - Intronic
1001106498 5:168858877-168858899 CCTGGGCGGGCTGGGTGCAGGGG + Intronic
1002590984 5:180291735-180291757 TCGGGGCGGGCCGGGGGCTGCGG - Intronic
1002778562 6:349115-349137 TAGGGGTGGGCGGAGTGCAGGGG - Exonic
1004328332 6:14698141-14698163 TCGGTGCTGGCTGGGAGCAGTGG + Intergenic
1005994481 6:30922997-30923019 TCGGGGTGAGCAGAGGGCAGCGG + Intronic
1007327641 6:41073786-41073808 GCGGAGCGGGCTGGGAGGAGGGG - Intronic
1007843899 6:44738487-44738509 TCCAGGAGGGCTGAGAGCAGAGG + Intergenic
1008294004 6:49755057-49755079 TCTGGCCTGGCTGGGAGCAGTGG + Intergenic
1008572821 6:52831268-52831290 ACAGGGTGGCCTGAGAGCAGAGG + Intergenic
1008574528 6:52847329-52847351 ACAGGGTGGCCTGAGAGCAGAGG + Intronic
1008579768 6:52896234-52896256 ACAGGGTGGCCTGAGAGCAGAGG + Intronic
1012474878 6:99607357-99607379 CGGGGTCGGGCTGAGAGGAGAGG + Intronic
1012475795 6:99613803-99613825 TCCGGGGGGACGGAGAGCAGAGG - Exonic
1013053381 6:106559494-106559516 TCAGGCCGGGCTGGGTGCAGTGG + Intronic
1014098285 6:117482935-117482957 CAGGGGCGGGCTGAGGGCTGCGG + Intronic
1015693732 6:135956489-135956511 TCTGAGAGGGCTGAGTGCAGTGG + Intronic
1017146681 6:151240895-151240917 CCGGGGCGGGGCCAGAGCAGCGG + Intronic
1019430427 7:996555-996577 CCGGGGAGGGCTGAGGCCAGTGG - Intergenic
1020081048 7:5285722-5285744 TCAGGATGGGCTGAGCGCAGTGG + Intronic
1022022912 7:26418201-26418223 TGGGGGCGGGTGGAGAGCAGAGG + Intergenic
1023085822 7:36569076-36569098 ACAGGGAGGGCAGAGAGCAGAGG - Intronic
1024554717 7:50593441-50593463 TCGGGGCATGCTGTGTGCAGTGG - Intronic
1025117784 7:56273325-56273347 TCAGTGCTGGCTGAGTGCAGAGG + Intergenic
1025197863 7:56946444-56946466 TCAGGATGGGCTGAGGGCAGTGG - Intergenic
1025674085 7:63630491-63630513 TCAGGATGGGCTGAGGGCAGTGG + Intergenic
1026931187 7:74223857-74223879 TGGGGGCGGCCTTTGAGCAGTGG - Intronic
1028669806 7:93388356-93388378 TCCAGAGGGGCTGAGAGCAGTGG + Intergenic
1029647720 7:101868823-101868845 TCGTGGGGGGATGGGAGCAGTGG + Intronic
1030104174 7:105972965-105972987 GCGGGGTGGGGTGAGTGCAGAGG - Intronic
1031987775 7:128174490-128174512 GCGGTGTGTGCTGAGAGCAGCGG + Intergenic
1032075171 7:128832631-128832653 GAGGGGCTGGCTCAGAGCAGAGG + Intronic
1033449413 7:141449371-141449393 TGGGGGCAGGTTGAGAGTAGAGG + Intronic
1033731715 7:144187213-144187235 TGGGGGCAGGCTGGGGGCAGTGG - Exonic
1033742565 7:144285796-144285818 TGGGGGCAGGCTGGGGGCAGTGG - Intergenic
1033751338 7:144363818-144363840 TGGGGGCAGGCTGGGGGCAGTGG + Exonic
1034463032 7:151209048-151209070 ACGGGGTGTGCTGACAGCAGAGG - Intronic
1035167058 7:156997636-156997658 TCTGGGAGGGCTGAGAGGTGAGG - Intronic
1035699748 8:1629413-1629435 AGGGGGCTGGCTGGGAGCAGGGG - Intronic
1037729045 8:21507944-21507966 TCAGGGCCAGCTCAGAGCAGAGG - Intergenic
1040005669 8:42618798-42618820 TCAGGGCTGGCTGAGGGCTGGGG + Intergenic
1040053274 8:43035960-43035982 GCGGGGTGGGCTGGGCGCAGTGG - Intronic
1041928586 8:63263963-63263985 TCGGGGCTGCCTCACAGCAGAGG - Intergenic
1042769370 8:72362779-72362801 ACGGGGAGGGGTAAGAGCAGGGG - Intergenic
1045664044 8:104466945-104466967 TCGGCCCGGGCTGCGCGCAGGGG + Exonic
1045879407 8:107020605-107020627 AGGGGGCTGGCAGAGAGCAGGGG - Intergenic
1047354157 8:124104332-124104354 TCTGAGCTGGCTGAGAGCAGAGG - Intronic
1047408038 8:124601580-124601602 TCTGGGCTCTCTGAGAGCAGGGG - Intronic
1048374828 8:133813819-133813841 TTGGGGCATGCTGAGAGAAGAGG + Intergenic
1048892511 8:138960447-138960469 CCAGGCTGGGCTGAGAGCAGGGG + Intergenic
1049249753 8:141581980-141582002 AAGGGGCAGGCTGAGATCAGAGG + Intergenic
1049249840 8:141582392-141582414 TGGGGGTGGGCTGAGGGCAAAGG + Intergenic
1049674757 8:143884467-143884489 TGGGGGCGGGCTGAGCGCAGGGG + Intergenic
1049725145 8:144142325-144142347 TCTGGGAGGGCTGAAAGCAGGGG + Intergenic
1049867894 8:144950681-144950703 ACGGGGCGGGCAGCGAGCTGGGG - Intronic
1050276971 9:4010124-4010146 CCGGGGTGGGGTGAGGGCAGGGG + Intronic
1051665089 9:19461473-19461495 TAGGGGAGGGCTGGGAGCGGTGG + Intergenic
1054938163 9:70711367-70711389 TCTGGACTGGCTGAGAGCACTGG - Intronic
1054939854 9:70729360-70729382 TCTGGACTGGCTGAGAGCACTGG - Intronic
1056369618 9:85941170-85941192 TCGGGCTGGGCTGAGAGGGGAGG + Exonic
1057146568 9:92763288-92763310 TCTGGGCTGACTGGGAGCAGAGG + Intronic
1057216675 9:93232401-93232423 CCTGGAGGGGCTGAGAGCAGGGG + Intronic
1058058829 9:100474175-100474197 GCTGGGCGGGGTGAGGGCAGGGG + Intronic
1058443164 9:105029266-105029288 TCAGGATGGGCTGGGAGCAGTGG - Intergenic
1059463387 9:114449642-114449664 TGGGGGCGGGTGGGGAGCAGAGG + Intronic
1059642800 9:116234231-116234253 TCGCTGCAGGCTGAGATCAGTGG + Intronic
1060926938 9:127461640-127461662 ACTGGGCAGGCTGAGGGCAGTGG + Intronic
1062552597 9:137096724-137096746 TCTGGTCGAGCAGAGAGCAGAGG + Intronic
1185795700 X:2962530-2962552 GCGGGGAGGGCAGAGAGGAGGGG + Intronic
1186463447 X:9765960-9765982 TCGGTGGGGGCCGAGAGCACTGG + Exonic
1188321051 X:28737543-28737565 TCAGGGCTGGCTGAGCACAGTGG - Intronic
1189592147 X:42524932-42524954 ACAGGGCTGGCTGAGTGCAGTGG + Intergenic
1189726171 X:43969829-43969851 AGGGGGCGGGCTGGGAGCAGTGG + Intronic
1190415962 X:50180746-50180768 TCGGGGCGGGGAAGGAGCAGGGG - Intergenic
1193148800 X:78104157-78104179 GCAGGGCGCGCCGAGAGCAGCGG + Exonic
1196384562 X:115135228-115135250 TCGGGGGTGGCTGAGGCCAGAGG - Intronic