ID: 1125958142

View in Genome Browser
Species Human (GRCh38)
Location 15:43805368-43805390
Sequence CCTAAAGTCATGCAGGTATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125958142_1125958149 9 Left 1125958142 15:43805368-43805390 CCCCATACCTGCATGACTTTAGG 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1125958149 15:43805400-43805422 TTTATTGAAATGATCCTCCAGGG 0: 1
1: 1
2: 1
3: 16
4: 201
1125958142_1125958148 8 Left 1125958142 15:43805368-43805390 CCCCATACCTGCATGACTTTAGG 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1125958148 15:43805399-43805421 TTTTATTGAAATGATCCTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 203
1125958142_1125958150 13 Left 1125958142 15:43805368-43805390 CCCCATACCTGCATGACTTTAGG 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1125958150 15:43805404-43805426 TTGAAATGATCCTCCAGGGTAGG 0: 2
1: 0
2: 1
3: 22
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125958142 Original CRISPR CCTAAAGTCATGCAGGTATG GGG (reversed) Exonic
903321183 1:22544088-22544110 CCCAAGGTCATACAGGTATTAGG + Intergenic
903466624 1:23556484-23556506 CCTGAAGTTATACAGGTAAGAGG + Intergenic
904469791 1:30729264-30729286 CCAAAAGTCAGGCAGAGATGTGG + Intergenic
904917130 1:33978147-33978169 CCCAAGGTCATGCAGGTACTGGG + Intronic
908830722 1:68175801-68175823 TGTATAGTCATGCTGGTATGCGG - Intronic
909554634 1:76939876-76939898 CCCAAAGTCATTCAGCTAGGAGG - Intronic
912253423 1:108034243-108034265 CCTAAAGTCATGGAGACATAAGG + Intergenic
914004374 1:143719780-143719802 ACTTAAGACATTCAGGTATGAGG - Intergenic
914454488 1:147823240-147823262 CTCAAAGACATGCAGGTATATGG - Intergenic
915638278 1:157201617-157201639 CACAAAGTCATACATGTATGTGG + Intergenic
920088953 1:203438578-203438600 CCTAAATACATGCAGGGAAGTGG + Intergenic
922816924 1:228456038-228456060 TCTAAAGACATGCAGATTTGTGG + Intergenic
1062933317 10:1367002-1367024 CCGAAAGTCAAGCAGGAATGAGG + Intronic
1065804403 10:29381533-29381555 CCTGAGGTCACGCAGGTAAGAGG - Intergenic
1065944783 10:30596493-30596515 CCTAAGGTCACGCAGGTAAGAGG + Intergenic
1070074811 10:73124538-73124560 CCTAAAGACATGCAGATCTATGG + Intronic
1070197732 10:74174346-74174368 CTTAAAGTCATACAGGTAATAGG + Intronic
1073822303 10:107278273-107278295 GCTAAAGTCATTCAGCTAGGTGG - Intergenic
1074293775 10:112162911-112162933 CCCAAAGTCAAGCAGGAATAGGG + Intronic
1075933953 10:126323733-126323755 CCCAAAGTCATGCATGGTTGGGG + Intronic
1078702438 11:13699444-13699466 ACTAAAGTCATCCAGGAATGTGG + Intronic
1080383876 11:31799167-31799189 TCAAAAGTCAGGCAGGGATGGGG + Intronic
1080731651 11:34962240-34962262 CCTAAAGTAATCCATGTAAGAGG + Intronic
1083673163 11:64311166-64311188 CCCAAGGTCATAAAGGTATGTGG + Intronic
1086564920 11:88214633-88214655 CCAAAATTCATGCAAGTATGAGG + Intergenic
1087819275 11:102693112-102693134 CTTAGAGTCAAGCAGGGATGTGG + Intronic
1090471482 11:126984929-126984951 TCTAAAGTCATACAGGTAGTGGG - Intronic
1091613386 12:2030755-2030777 CGTAAAGTTAGGCAGGCATGAGG + Intronic
1094535212 12:31315221-31315243 CCTAAAGTCAAGTAAATATGTGG + Intronic
1094794622 12:33956741-33956763 CCTAAAGTCATGCAAAAATTGGG - Intergenic
1095462496 12:42457311-42457333 CCTGAAGAAATGCAGGTATAAGG - Exonic
1095952358 12:47788515-47788537 CATAAAGTCATGAAGTTATGAGG + Intronic
1099062197 12:77925677-77925699 CCGATGGTCTTGCAGGTATGTGG + Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1100152848 12:91761995-91762017 CATAAAGTCAGAGAGGTATGAGG - Intergenic
1100950018 12:99837294-99837316 CCTATAGTCCTGGAGGTCTGTGG - Intronic
1104275731 12:127325780-127325802 TCTGGAGTCATGCAGGTATAAGG + Intergenic
1107120434 13:36789644-36789666 CCTAAATTCACTCAGGTATGTGG - Intergenic
1107556934 13:41524447-41524469 CATAAAGTCATGTAGATTTGTGG + Intergenic
1107615662 13:42164194-42164216 CCTACTGTCATCCAGGTCTGTGG + Intronic
1109147402 13:58797517-58797539 CTTAAAATAATGCAGGAATGTGG - Intergenic
1109337663 13:61013266-61013288 CCAAAAATCAAGCAGTTATGTGG - Intergenic
1114542729 14:23474203-23474225 CTTAAAGACATCCAGGGATGAGG + Intronic
1117139003 14:52767151-52767173 CCTAAAGAGATGCACGTATTTGG + Intronic
1117191147 14:53293152-53293174 CCTGCAGGCACGCAGGTATGAGG - Intergenic
1122197336 14:100098485-100098507 CCCAAAGTCTTCCAGGTATTTGG - Intronic
1125177593 15:36842513-36842535 CTTAAAGCCATGCAGTTGTGTGG + Intergenic
1125958142 15:43805368-43805390 CCTAAAGTCATGCAGGTATGGGG - Exonic
1126235157 15:46375091-46375113 GCTAAGGTTATGCAGTTATGAGG + Intergenic
1127919421 15:63481566-63481588 CCCAAAGTTATGCAGGCATTAGG - Intergenic
1128080942 15:64856608-64856630 CCTAAATTCTTGCAGGGTTGGGG - Intronic
1132934338 16:2473340-2473362 CCCAAAGTCATGCCAGTCTGGGG - Intronic
1138057041 16:53846079-53846101 CCTAAAGTCACTTAGTTATGAGG + Intronic
1138197473 16:55062077-55062099 CTTAAGGTCATCCAGGAATGGGG - Intergenic
1141322024 16:83020208-83020230 CCTACAGCTATGCAGGTGTGGGG - Intronic
1141429161 16:83962044-83962066 CCTAAGGTCATGCAGGTTATTGG + Intronic
1142851428 17:2706626-2706648 ACTAGAGTCAGGCAGGTGTGTGG - Intronic
1147037452 17:37692298-37692320 CCCAAGGTTATGCAGGTATAAGG - Intronic
1149106819 17:52978502-52978524 TCTAAAGTCAAGCAGGAAAGTGG - Intergenic
1150946804 17:69755525-69755547 CCAAAGGCCATGCAGGTTTGTGG + Intergenic
1154404549 18:14077253-14077275 GCTAAAGCCATGCAGGAAGGAGG - Intronic
1158409920 18:57196696-57196718 CATTAAGACATGCAGGTATTTGG - Intergenic
1162788594 19:13051575-13051597 CCTCAAGTCAGGCAGGTTCGGGG + Intronic
1163583100 19:18149787-18149809 CGTAAAGTCATGCCTGGATGGGG + Exonic
1164642308 19:29835081-29835103 CCTAAAGGAATCCAGGTAAGTGG - Intergenic
1164823017 19:31264601-31264623 CCTGCTGTCATGCAGGAATGTGG + Intergenic
1164878665 19:31712357-31712379 CCTAAAATAATTTAGGTATGGGG - Intergenic
1168068082 19:53931041-53931063 CCAAAAGTCAGCCAGGCATGGGG + Intronic
928673458 2:33626309-33626331 CCTTTAGTGATGCAGGTATAAGG - Intergenic
930263881 2:49177415-49177437 GCTAAAGGGATGCAGGTAGGTGG - Intergenic
932437998 2:71714330-71714352 GCTAAGGTCATCCAGTTATGGGG - Intergenic
932749813 2:74364234-74364256 CCTAAAGTCAAGAAGGTACTTGG + Intronic
934958240 2:98642910-98642932 CCTAAAACCTAGCAGGTATGAGG + Intronic
937559856 2:123208780-123208802 TCTAAAGTCATGCTGGGATTTGG - Intergenic
941745303 2:169080620-169080642 CCTAAAATCAGGCAGGTAGAGGG - Intronic
941874852 2:170421838-170421860 CCTAAAAACATTCAGGGATGGGG - Intronic
942711692 2:178843391-178843413 CCTAAAGTCGTGCAACTATTTGG - Intronic
944296721 2:198073050-198073072 CAAAAAGTCATGCAAGTAGGTGG + Intronic
946305529 2:218855050-218855072 CCAAAAGTCCTGCAGGGAGGAGG - Intergenic
1169674182 20:8135185-8135207 CCTAAAGTCATGCAGCTTACTGG - Intronic
1173148886 20:40549144-40549166 TCCAAAGTCATTCAGGTATTTGG + Intergenic
1173306977 20:41860152-41860174 CCTACAGTCATACAGGCATGAGG + Intergenic
1177453778 21:21307592-21307614 CCTAATGTCATTCAGGTTTTTGG + Intronic
1182990196 22:34760347-34760369 TCTCAAGCCATGTAGGTATGAGG - Intergenic
949503258 3:4702489-4702511 CCTAAAGTCATGCAGCTGCTTGG + Intronic
959024044 3:101220038-101220060 CCTAATGTGATGTAGGTATTTGG - Intergenic
961360831 3:126366116-126366138 CCTACAGTCATGCAGGTGCAAGG - Intergenic
962745012 3:138390520-138390542 CCTGATGTCATGAAGGTAGGAGG - Intronic
967186022 3:186945412-186945434 CCTAAATTCTTGCAAGTGTGAGG - Intronic
967818508 3:193818642-193818664 CCTACAGTCATGCACATATTCGG - Intergenic
968844712 4:3034141-3034163 CCTAATCTAGTGCAGGTATGGGG + Intronic
969196246 4:5566160-5566182 CCTAAAGCCATGAAGGTGCGTGG + Intronic
973741192 4:53921057-53921079 CCCAAAGTCACACAGCTATGTGG - Intronic
977644934 4:99401876-99401898 CCTAAAGTCATGGAGTGAGGGGG - Intergenic
979439257 4:120731805-120731827 CACAAAGTCATCCAGGCATGTGG - Intronic
980231820 4:130055079-130055101 CATAAAGTCGTGCATGTGTGTGG + Intergenic
980699265 4:136402477-136402499 CTTAAAGTAATGCAGATATTAGG - Intergenic
985022775 4:185709743-185709765 CCTACAGTAATGCAGAGATGTGG - Intronic
985118254 4:186613543-186613565 CTTTAAGTCCTGCAGGTCTGAGG + Intronic
985884650 5:2668222-2668244 CCTTGGGTCATGCAGGTCTGCGG - Intergenic
987849459 5:23331743-23331765 ACTAAGGTCATGCATGTATTGGG - Intergenic
990625508 5:57605798-57605820 CCTATAGTCTTGTAGCTATGTGG + Intergenic
990877353 5:60500680-60500702 CCTGAAGTCATGCAGCTAAGTGG - Intronic
991328243 5:65462299-65462321 ACTAAAGTCATGCTGGTCTGTGG + Intronic
991712408 5:69420471-69420493 CCTAAAGTTATGGAGGCATGAGG + Exonic
993502326 5:88678033-88678055 CATAAAGGTAGGCAGGTATGTGG - Intergenic
996683525 5:126254908-126254930 CTAAAAGTCTTGCAGTTATGAGG + Intergenic
996816214 5:127575321-127575343 CATACAGACATCCAGGTATGTGG + Intergenic
996941932 5:129018010-129018032 CCTACAGACATACATGTATGAGG + Intronic
997603057 5:135153647-135153669 ACTGAAGTCATGCAGATATTGGG + Intronic
999531197 5:152465218-152465240 CCTAAACTCATACAGATCTGTGG - Intergenic
1001132017 5:169072142-169072164 CCTGCAGTGATGGAGGTATGGGG + Intronic
1003637775 6:7849138-7849160 CCTAAGGACATGGAGGTGTGAGG - Intronic
1003681184 6:8258835-8258857 CCAAAAATCATGCAGTTATTGGG + Intergenic
1004130636 6:12915899-12915921 CTAGTAGTCATGCAGGTATGGGG - Intronic
1004701187 6:18080913-18080935 TCTAAAGTCATGCAGGTTGCTGG - Intergenic
1006632073 6:35436773-35436795 CCAGAGGTCATGCAGGTAGGGGG + Intergenic
1006706966 6:36028442-36028464 CCTGCACTCACGCAGGTATGCGG + Intronic
1013012854 6:106135514-106135536 CCTCGAGTCATGCAGGGCTGGGG + Intergenic
1013206225 6:107948327-107948349 CCTAAAGTCATACAGCTACCAGG - Intronic
1014800682 6:125774817-125774839 TCTAAAGTCACACAAGTATGTGG - Intergenic
1015561197 6:134517928-134517950 CCTAAAGTCACACAGGTAAGAGG + Intergenic
1017886672 6:158605816-158605838 CCCAAAGTCATGTGGGTTTGTGG - Intronic
1018787046 6:167116519-167116541 CCAAAAGCCATGCAGGTGGGAGG - Intergenic
1020444060 7:8249855-8249877 TCTGAAGTGATGCAGGTATTTGG + Intronic
1020936086 7:14465674-14465696 CCTAAAGTCACACAGTTAGGAGG + Intronic
1025235071 7:57228818-57228840 CCTAAAGCCATGCAGCTCTGGGG - Intergenic
1027562005 7:79742169-79742191 CCTAAAATCATGGAGAAATGAGG - Intergenic
1028505751 7:91568501-91568523 CCCACAGTCATGGAGCTATGTGG - Intergenic
1031286061 7:119869477-119869499 CCCAAAGTGCTGCAAGTATGAGG + Intergenic
1033303370 7:140206229-140206251 CCCAAGGTCATGCTGGTATTAGG - Intergenic
1036651389 8:10646296-10646318 CCTAGAGTCATGCAGCTCTAGGG + Intronic
1038683888 8:29697440-29697462 CCTAAAGTCAAGGAAGTGTGGGG + Intergenic
1038716750 8:29998056-29998078 CCTAAAGTTAAGTAGGAATGTGG + Intergenic
1045334040 8:101182310-101182332 CCTAAGGCCATACAGGTAAGGGG + Intronic
1048324610 8:133429388-133429410 CCTAAAGTCACCCAGCAATGGGG - Intergenic
1049208140 8:141372872-141372894 CCCAAGGTCATGCAGCTAGGAGG + Intergenic
1050310869 9:4352264-4352286 CTCAAAGTCATGCAGGAATATGG + Intergenic
1050984723 9:12067836-12067858 CCTAAAGTCATACAACTAAGTGG - Intergenic
1052738510 9:32370278-32370300 CCTACAGGGATGCAGGAATGCGG + Intergenic
1055732834 9:79296617-79296639 CCTAAGGTCACACAGGTATTTGG - Intergenic
1057042685 9:91858872-91858894 CCCAAGATCATGCAGCTATGGGG + Intronic
1058958800 9:109973479-109973501 CTTAAAGTCATGCTTGGATGTGG + Intronic
1061619256 9:131800613-131800635 CCTAAAGCCATACATGCATGAGG + Intergenic
1187527503 X:20067338-20067360 CCTAAAATCATGCATGTCTGTGG - Intronic
1188090273 X:25955363-25955385 CCTAAATTTATGCTGGGATGGGG + Intergenic
1188428215 X:30074180-30074202 TCTAAAGTCATTCAGGCAAGGGG + Intergenic
1194301856 X:92197588-92197610 CCTAAAGACATGTAAGTATGTGG - Intronic
1194718138 X:97310505-97310527 AGTTAAGTCATGCAGATATGTGG + Intronic
1196946781 X:120834631-120834653 CCTAAACTCAAGCAGCTATTTGG - Intergenic
1197134072 X:123040755-123040777 CGAAAACTCATGCAAGTATGTGG + Intergenic