ID: 1125964361

View in Genome Browser
Species Human (GRCh38)
Location 15:43861599-43861621
Sequence AGCTGTTCTCTGCAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125964357_1125964361 13 Left 1125964357 15:43861563-43861585 CCTGTGTCTGTAGAGGTTCAGTC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1125964361 15:43861599-43861621 AGCTGTTCTCTGCAGGTGGGAGG 0: 1
1: 0
2: 3
3: 27
4: 290
1125964354_1125964361 21 Left 1125964354 15:43861555-43861577 CCAGGTTCCCTGTGTCTGTAGAG 0: 1
1: 0
2: 2
3: 10
4: 195
Right 1125964361 15:43861599-43861621 AGCTGTTCTCTGCAGGTGGGAGG 0: 1
1: 0
2: 3
3: 27
4: 290
1125964356_1125964361 14 Left 1125964356 15:43861562-43861584 CCCTGTGTCTGTAGAGGTTCAGT 0: 1
1: 0
2: 1
3: 5
4: 135
Right 1125964361 15:43861599-43861621 AGCTGTTCTCTGCAGGTGGGAGG 0: 1
1: 0
2: 3
3: 27
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125964361 Original CRISPR AGCTGTTCTCTGCAGGTGGG AGG Intronic
900360699 1:2287601-2287623 AGGTGTGCTCTGCCTGTGGGTGG + Intronic
900564972 1:3327742-3327764 AGGTCTCCCCTGCAGGTGGGTGG - Intronic
901107779 1:6770747-6770769 AGCTCTTCTCTGAATCTGGGTGG - Intergenic
901129007 1:6950539-6950561 ACATGCTCACTGCAGGTGGGTGG + Intronic
901490156 1:9592585-9592607 CACTATTCCCTGCAGGTGGGAGG - Intronic
901722952 1:11215070-11215092 AGCTGTATTTTGCAGGTGTGAGG + Intronic
902080781 1:13819148-13819170 AGGTGTTCTCTGCAGCCGGAGGG + Intronic
902350427 1:15849533-15849555 AGCTGTCCTCGGCAGGCCGGGGG + Intronic
902862936 1:19258895-19258917 AGCTGCTCTCTCCAGAGGGGCGG - Exonic
903439158 1:23374526-23374548 GGTTGTTCTCTGCAGGGGGAAGG - Intergenic
907815159 1:57911438-57911460 AGCTGTCCTCTGCTGCTGGAAGG - Intronic
909509106 1:76431091-76431113 AGCTGTTCTCAGCAAGAGGAGGG - Intronic
915784732 1:158597312-158597334 AGATGTGCTCTTGAGGTGGGGGG - Intergenic
915840148 1:159206643-159206665 AGATGTTCTCTTGAGGTGTGGGG + Intergenic
916070579 1:161167418-161167440 ACCTGTTCTGGGCAGCTGGGTGG - Exonic
916921334 1:169470655-169470677 AGCAGTTCTCTCTAGGTGGTGGG + Intronic
918374792 1:183898135-183898157 AGTTGTTTTCTGAAGGTGAGGGG + Intronic
919512261 1:198480054-198480076 ATCTCTTCTCTGAAGGAGGGAGG + Intergenic
920848288 1:209611556-209611578 AGCTGTCCTCTCCAGGGGGTGGG + Intronic
921221690 1:212978264-212978286 AGCTGTCCTCTGCAGGCGCAGGG - Intronic
922030718 1:221794874-221794896 AGCTGTTTTCTATAGGTGAGTGG - Intergenic
923093601 1:230757766-230757788 TGCTGTTATCTGCAGGGGGTGGG + Intronic
923190027 1:231611323-231611345 AGCTGTCAGCTGCAGGTTGGGGG + Intronic
923776418 1:236982615-236982637 AGATGGTCTTTGCAGGTGGCTGG + Intergenic
1065761176 10:28984631-28984653 GGCTGTTCTTGGCAGGTGTGAGG + Intergenic
1066483508 10:35821603-35821625 AGCTCTTCTCAGCAGGGGGAGGG - Intergenic
1067155109 10:43775066-43775088 AGCTCACCTCTGCAGGTAGGAGG + Intergenic
1069490527 10:68856829-68856851 TGCTGTCCTCCCCAGGTGGGAGG - Intronic
1069875967 10:71563052-71563074 AGCTGTTCTTGGAAGGAGGGTGG + Intronic
1070824286 10:79381779-79381801 TGCTGGGCTTTGCAGGTGGGTGG + Intergenic
1071247441 10:83780288-83780310 AGCTCTTCTCTGAAGGTCAGAGG - Intergenic
1071883113 10:89920888-89920910 AGGCGTTATCTGCAGGTGGAAGG - Intergenic
1072448337 10:95518822-95518844 TTCAGTTCTCTGCAGGAGGGAGG - Intronic
1072537621 10:96375257-96375279 TGGTGTTCACTGCATGTGGGTGG - Intronic
1073948987 10:108785114-108785136 AGGTCTTTTCTGCAGATGGGAGG + Intergenic
1075256042 10:120926687-120926709 AGCAGTTCTGGGGAGGTGGGAGG + Intergenic
1075623043 10:123941683-123941705 AGCCGTCCGCTGCAGGTGGGAGG - Intergenic
1076365614 10:129919626-129919648 AGCTGTGCTCTGGAGGAGGCTGG - Intronic
1076573158 10:131445747-131445769 GGCTGTTCCGTGCAGGTGGGCGG + Intergenic
1076688755 10:132209975-132209997 AGCTGGGCTCTGAAGGTCGGAGG + Intronic
1077649613 11:3958452-3958474 AGCTCTTCTCAGCAGGGGGCAGG - Intronic
1079029973 11:16979377-16979399 AGCTTTGCTCTGAAGGTGGTGGG - Intronic
1080065131 11:28002329-28002351 AGAAGTTCTCTGCAGGGGTGGGG + Intergenic
1084793213 11:71488222-71488244 TCCTGTTCTCTGCAAGTGGGAGG + Intronic
1085128945 11:74021279-74021301 AGCTGAACTCTGGAGGGGGGTGG - Intronic
1086741995 11:90379911-90379933 AGCTGTGCTATGCTGCTGGGGGG + Intergenic
1086949944 11:92881945-92881967 AGCTGGGGGCTGCAGGTGGGTGG - Intronic
1087777339 11:102268567-102268589 AGGTGTTCACTGCAGAAGGGTGG - Intergenic
1088833525 11:113558198-113558220 AAATGTTCTCTGCAAGAGGGAGG - Intergenic
1089649638 11:119904353-119904375 AGCTGATGTCTGCACGTGGGCGG + Intergenic
1090452954 11:126822712-126822734 AGCTGGTCTGAGCAGGAGGGAGG + Intronic
1090990902 11:131815903-131815925 AGCTGGTCTCTGCAGGAGGCGGG + Intronic
1091835689 12:3583979-3584001 AGGTGTGCCCTGGAGGTGGGAGG + Intronic
1092000033 12:5024301-5024323 AGGTGCTCTCTGCAGCTTGGAGG + Intergenic
1092247452 12:6871648-6871670 AGCTGCTCTCTGCAGTTGTGTGG - Intronic
1095251610 12:39985779-39985801 TTCTGTTCTCTGCAGTAGGGTGG + Intronic
1095469916 12:42525519-42525541 TGCTGTTCTCTCCAGGTAGCAGG + Intronic
1097637467 12:62140354-62140376 AGCAGTTCTCTGAAGCTGGTGGG - Intronic
1099298824 12:80866030-80866052 ATGTGTTGTGTGCAGGTGGGGGG + Intronic
1102951789 12:117036149-117036171 TTCTGCTCTCTGCAGGTAGGTGG - Intergenic
1103870582 12:124088395-124088417 AGCTGCTCCCTGCACGTGGCCGG + Exonic
1104104506 12:125646174-125646196 GGTTGTTCCCTGCAGGTGTGTGG + Intronic
1104790655 12:131480200-131480222 AGATGCTATCTGCAGGTGGGAGG + Intergenic
1104967805 12:132517154-132517176 TGCTGCTCCCTGCAGGTGGCAGG - Intronic
1106625306 13:31414741-31414763 AGCTCTTCTCTGCCAGTGAGTGG + Intergenic
1107503585 13:41007156-41007178 ATCTGTACTCTGCAGCAGGGAGG - Intronic
1108178901 13:47821802-47821824 AGCTGCTCCCTGCAGGTTGCTGG + Intergenic
1111847842 13:93534050-93534072 TGCTGTTTTCTGCAGATGCGAGG - Intronic
1112046287 13:95601624-95601646 AGCTGTTCTCTGCACTTGGCAGG + Intronic
1113327499 13:109295944-109295966 AGCTGTCCTCTGCAGCTGCTGGG - Intergenic
1113599769 13:111560124-111560146 AGCTGCCCTCTGCAGGAAGGAGG - Intergenic
1114651477 14:24287422-24287444 AGCTGCTTTCTGCAGCTGAGAGG + Intergenic
1115160193 14:30385140-30385162 ATCTGTTCTCTCCAGAAGGGTGG + Intergenic
1116288586 14:43004382-43004404 AGATGTTTTCTACAGTTGGGAGG + Intergenic
1117094133 14:52280594-52280616 AGCTTTTCTCCACAGGTGTGGGG + Intergenic
1117397056 14:55321307-55321329 ATCTGTTCTTTGCAGGTGGGGGG - Intronic
1117548046 14:56809126-56809148 AGCTGTTCTCTGGCGGGGAGAGG - Intronic
1118789755 14:69079422-69079444 AGCTGTTCTCTTATGGTGGGTGG - Intronic
1120492832 14:85198347-85198369 AGGTGTTGTCTGCATGTGTGTGG - Intergenic
1121533798 14:94677369-94677391 AGGTGCTCTGTGCATGTGGGCGG - Intergenic
1121708892 14:96022121-96022143 TGCTGATATCTGCATGTGGGAGG - Intergenic
1122491290 14:102117561-102117583 AGCTCCTTTCTGCAGCTGGGGGG - Intronic
1122630382 14:103104875-103104897 GGGTGCGCTCTGCAGGTGGGAGG + Intronic
1123578499 15:21695688-21695710 AGGTGTGCTTTGCACGTGGGAGG - Intergenic
1123615126 15:22138170-22138192 AGGTGTGCTTTGCACGTGGGAGG - Intergenic
1124256117 15:28144329-28144351 AGCTGTTGCCTTCTGGTGGGTGG - Intronic
1124568138 15:30834815-30834837 AGCTGTTGCCTTCTGGTGGGTGG + Intergenic
1125964361 15:43861599-43861621 AGCTGTTCTCTGCAGGTGGGAGG + Intronic
1126563990 15:50075711-50075733 AGGTGTTTCCTTCAGGTGGGTGG - Intronic
1127402058 15:58598682-58598704 AGCTATTCTCTACAGGTGTGAGG - Intronic
1128381640 15:67117484-67117506 AGCTGCTCTGTGCAGTGGGGTGG - Intronic
1128777473 15:70333363-70333385 ATATGTACTCTGCAGGTGTGGGG + Intergenic
1130147371 15:81284380-81284402 TGCTGTTATCTGCGGGAGGGTGG + Intronic
1130305091 15:82708212-82708234 GGTTGTTCTCTGGCGGTGGGGGG - Intronic
1131157192 15:90082421-90082443 AGCTTTTCTCTGCAAGTGGTGGG - Intergenic
1131880894 15:96860710-96860732 ATCTGTTCTCTTCTGGTGGTTGG + Intergenic
1202987369 15_KI270727v1_random:429933-429955 AGGTGTGCTTTGCACGTGGGAGG - Intergenic
1133774847 16:8888231-8888253 AGCTGAACTCTGCAGATGGAGGG - Intergenic
1135524762 16:23205874-23205896 AGCTGGGCTCTGGGGGTGGGTGG - Intronic
1135974557 16:27099452-27099474 AGCTGCTCTATGGGGGTGGGAGG - Intergenic
1136542352 16:30935135-30935157 AGCTGTGCTCTGGGGGTTGGGGG + Intronic
1136922810 16:34345914-34345936 AGATGCCCTCTGCAGGTGGTGGG - Intergenic
1136981763 16:35065892-35065914 AGATGCCCTCTGCAGGTGGTGGG + Intergenic
1137395591 16:48114484-48114506 ACATGTTCTCTGCAGGTAGCAGG + Intronic
1137688384 16:50402631-50402653 AGCTTGGCTCTGCAGGTGTGGGG - Intergenic
1137779751 16:51087980-51088002 AGCTGGTCTCTGCAGCATGGAGG + Intergenic
1139615310 16:68085183-68085205 AGCTGGGCTCTGCGGGGGGGGGG + Intronic
1139891072 16:70253562-70253584 AGCAGCTCCCTGCATGTGGGAGG - Intronic
1139966626 16:70749301-70749323 GGCTGTGCTCTGCAGTGGGGTGG - Intronic
1142106488 16:88306387-88306409 AGTTGTTCTCTGTAGGTGTGTGG + Intergenic
1142135834 16:88451719-88451741 AGCTGCTCTCTGGAGGGGGTGGG - Intergenic
1142961640 17:3555527-3555549 AGCTGCTCCCTGCAGGTGAGAGG - Intronic
1144848749 17:18233509-18233531 TGCTGTCCTCTCCTGGTGGGTGG + Intronic
1145256262 17:21324132-21324154 GCCTGTGCTCTGCAGGTGGTCGG - Intergenic
1145809284 17:27755055-27755077 AGCTGTCCACTCCTGGTGGGAGG + Intergenic
1147216880 17:38905614-38905636 AACTCATCTCTGCTGGTGGGAGG - Intronic
1147588313 17:41665711-41665733 GCCTGTTCTCTCCAGGTAGGCGG + Intergenic
1148556028 17:48578918-48578940 GGCTTTTCTCTGCAGCTGGATGG + Exonic
1149905919 17:60526210-60526232 CGCTGATCTCTGCAGGGGCGGGG + Exonic
1151054565 17:71016699-71016721 TGCTTTTCTCTTCAGGTTGGTGG + Intergenic
1151456051 17:74226429-74226451 AGCTGACCACTGCACGTGGGAGG + Intronic
1152140843 17:78535557-78535579 AGCTGTCCTGTCCAGGAGGGAGG - Intronic
1156405711 18:36780839-36780861 AGCTGCTCTGGGCAGGTGAGTGG + Intronic
1156833912 18:41529530-41529552 AGCTGTTTTCTACAGGTGGGTGG - Intergenic
1159131161 18:64281592-64281614 AGAGGTTTGCTGCAGGTGGGAGG + Intergenic
1159710285 18:71749642-71749664 AAGTGTTTTCTGCAGGTGGGGGG - Intronic
1161569504 19:5022810-5022832 AGGAGTGCTCTCCAGGTGGGGGG + Intronic
1163329860 19:16629036-16629058 CGGGGTTCTCTGCCGGTGGGGGG - Intronic
1163504593 19:17698057-17698079 AGCCTCACTCTGCAGGTGGGGGG - Intergenic
1163750835 19:19076488-19076510 AGGTGTTCTCCACAGGTTGGAGG + Intronic
1166310744 19:41961075-41961097 AGGTGTTCCCAGGAGGTGGGAGG + Intergenic
1167744272 19:51341458-51341480 AGCTTTCCCCAGCAGGTGGGGGG - Exonic
1168296458 19:55379359-55379381 AGGGGTTGTCTGCAGGAGGGAGG + Exonic
1168582360 19:57566208-57566230 AGATCTTTTCTGCACGTGGGAGG - Intergenic
925182823 2:1827872-1827894 AGCTGGTGTCTGGAGGTGTGGGG - Intronic
926320309 2:11744734-11744756 AGCTCCTCCCTGGAGGTGGGAGG + Intronic
927051190 2:19330985-19331007 GGCTGTCTTCTGTAGGTGGGAGG - Intergenic
927486389 2:23491250-23491272 AGAGGCCCTCTGCAGGTGGGTGG + Intronic
928197056 2:29223520-29223542 GGCGGTACACTGCAGGTGGGTGG + Exonic
928371980 2:30746798-30746820 TGCTGTTCTCTGCAATTGAGTGG - Intronic
928603959 2:32927139-32927161 AGCTGTCAGGTGCAGGTGGGTGG - Intergenic
932489425 2:72110904-72110926 AGCTGTTCTGGGCAGGTGCAAGG + Intergenic
932699462 2:73983707-73983729 AGCTGTTAGCTGCAGCCGGGCGG + Intergenic
932721090 2:74139404-74139426 AGCTGGTCTCTTCAGGAGTGAGG - Intronic
937178356 2:119965760-119965782 AGCTATGCTCTGAAGGTAGGAGG + Intronic
937348395 2:121142697-121142719 AGCTGTACCCTGCAGTTGGTGGG + Intergenic
937883265 2:126883880-126883902 AACTGAGTTCTGCAGGTGGGGGG + Intergenic
938101393 2:128500219-128500241 AGCTGTGCTCTGTCTGTGGGTGG + Intergenic
938654107 2:133413097-133413119 AGCTGAGCTCAGCATGTGGGTGG + Intronic
939956813 2:148534220-148534242 AGGCCTTCTCTGCAGGAGGGTGG + Intergenic
941151436 2:161919517-161919539 AGCTGCTTTCTGCAGGCAGGTGG - Intronic
942051889 2:172147779-172147801 AGCTGTCTTTTGCAGGTGGGGGG - Intergenic
942846676 2:180434844-180434866 TGCTGTTCTCCACAGGAGGGAGG - Intergenic
944831034 2:203534724-203534746 AGCTGGTTTCTGCAGCTGGGCGG + Intronic
946161078 2:217836388-217836410 AGGTTTTCTCTGCAGGAGAGGGG + Intronic
948384059 2:237570847-237570869 AGCTGTTGTTTGCCTGTGGGGGG - Intergenic
948868705 2:240787746-240787768 AGCTGATCTCTGAAGGTGTGAGG - Intronic
949037164 2:241821165-241821187 ATCTGGTGTCTGCTGGTGGGGGG + Intergenic
1168771107 20:417511-417533 TGCTGTTCTCTGCAGGCTGTGGG + Exonic
1169293799 20:4375363-4375385 AGCTGCTCTTTGCAGCAGGGTGG + Intergenic
1169347421 20:4839605-4839627 AACTGTTCTCTGCAGCTGCAGGG + Intergenic
1169894551 20:10488949-10488971 AGCTGTTTTCTGCTGGTTTGGGG + Intronic
1170286513 20:14715596-14715618 AGAGGTTCTCTGCATTTGGGTGG - Intronic
1172831083 20:37835248-37835270 ATCTGTTATCTGCAGGTTGAAGG - Intronic
1173021872 20:39273945-39273967 ACCTGTCCTCTGACGGTGGGGGG + Intergenic
1173422881 20:42918286-42918308 AGCTGTTACCTGGAGATGGGGGG - Intronic
1174401148 20:50276667-50276689 AGCTGTGATCTGCAGGGGCGAGG - Intergenic
1174772685 20:53315901-53315923 AGCTGAGCTCTGGAGGTGGGTGG + Intronic
1176056186 20:63150515-63150537 TGCTGTTGGCTGCAGGTCGGGGG + Intergenic
1176113688 20:63422040-63422062 AGCTGGTCTTGGCAGGTGGATGG - Intronic
1176164597 20:63665990-63666012 GGCTTTTTTCTGCAGGTGTGAGG - Exonic
1176248137 20:64107107-64107129 AGCTGCTCTCTGCGGGAGGAGGG - Exonic
1176409030 21:6437707-6437729 GGCTTTTCTCCGCAGGTTGGTGG - Intergenic
1177270347 21:18840422-18840444 AGCTGTTCTCTGCAGTGAGGTGG + Intergenic
1178188711 21:30255834-30255856 ATCTGCTCTCTGCAAGTTGGAGG + Intergenic
1180008803 21:45035804-45035826 AACTGTTATCTGGGGGTGGGGGG + Intergenic
1180081452 21:45489578-45489600 AGCTGATCTCCGCAGGTGTCCGG - Intronic
1181404073 22:22669385-22669407 AGCAGTTCTCTGCAGCTCAGTGG - Intergenic
1181438776 22:22925117-22925139 AGCTGAGATCTGCAGTTGGGTGG - Intergenic
1182013011 22:27016294-27016316 ACCTGTTCTGTCAAGGTGGGAGG + Intergenic
1182143402 22:27982090-27982112 TGCTGTGCTCTGCAGGCGAGGGG - Exonic
1182443942 22:30379614-30379636 AGCGGTTCCCTGCAGGGGAGGGG + Exonic
1182461958 22:30489655-30489677 CCCTGTTCTCTGCATGTAGGAGG - Exonic
1182763123 22:32738918-32738940 AGCTTATATCTGCAGGTGAGTGG - Intronic
1183346228 22:37309868-37309890 AGCTGCTCTCTGCAGGGTGCAGG - Intronic
950303839 3:11903618-11903640 ATCTGTTCTCCCCAGGCGGGTGG + Intergenic
950790291 3:15466332-15466354 AGCTCTTACCTGCAGGTGGGGGG + Exonic
951758486 3:26118320-26118342 AGCTGTGCTCTGCAATTGGGGGG - Intergenic
952744582 3:36764730-36764752 CCCTGTTCTCTGTGGGTGGGTGG + Intergenic
954293507 3:49662009-49662031 TGCTGCTGACTGCAGGTGGGGGG - Exonic
956554087 3:70498470-70498492 AGCTGTCTTGTGCAGGTGGATGG + Intergenic
957167877 3:76698401-76698423 AGCTGGTCTCTGGAAGGGGGTGG + Intronic
957715937 3:83929483-83929505 AGATCTTTTCTGCAGGTGGAAGG + Intergenic
958421095 3:93932671-93932693 ATATGTTCTCTTCATGTGGGGGG + Intronic
959973792 3:112435865-112435887 AGCTTTTTTTTGCAGGGGGGTGG + Intergenic
960998166 3:123352995-123353017 AGCTGATCTCTGGGGGAGGGTGG - Intronic
961052323 3:123757430-123757452 AGCTGTGCCCTGCAGCTGTGTGG - Intronic
961464347 3:127072339-127072361 AGCTGCTCTTGGCAGATGGGGGG - Intergenic
962272550 3:133988683-133988705 TGCTGTTCTCTGAAAGAGGGAGG + Intronic
962346307 3:134621081-134621103 AGCTTTTCTCTGCAGATCTGGGG + Intronic
963591670 3:147269024-147269046 AGCAGCTCTCTGCAGTAGGGAGG - Intergenic
968576123 4:1366971-1366993 AGCTGTTGCTGGCAGGTGGGAGG + Intronic
968922729 4:3531018-3531040 ACCTGTTCCCTGCTGCTGGGAGG + Intronic
968949431 4:3682946-3682968 AGCTGGACTCTGGAGCTGGGAGG + Intergenic
969119985 4:4901022-4901044 ACCTGTGCTCAGCAGGTGAGTGG - Intergenic
969277952 4:6149738-6149760 GGCTGCTCTGTGCTGGTGGGGGG - Intronic
970613723 4:17748310-17748332 AGCTTTTCGAGGCAGGTGGGGGG - Intronic
971567465 4:28163596-28163618 ATCAGTTCACTGCAGGTGTGCGG + Intergenic
973268002 4:48230650-48230672 AGCTTTACTCTGCAGGTCGTGGG - Intronic
975405267 4:73981684-73981706 AGTTGTTCTAACCAGGTGGGAGG + Intronic
978275908 4:106949387-106949409 ATCTCTTCTCTGTGGGTGGGTGG + Intronic
979206777 4:118047015-118047037 AGCTGTGCTCTGCAGTGGGCAGG - Intronic
980098249 4:128515475-128515497 AGCTGTGCTATGGAGGTGGAAGG - Intergenic
981289405 4:143056756-143056778 AGCTTTTTTTTGGAGGTGGGGGG + Intergenic
982670322 4:158313426-158313448 AGCTGTGCTCTGCAGTGGGAGGG + Intergenic
984813489 4:183817098-183817120 TACTGTTTTCTGCAGGTAGGTGG + Intergenic
985271290 4:188197077-188197099 AGTAGCTCTCAGCAGGTGGGTGG - Intergenic
985271340 4:188197257-188197279 AGTAGCTCTCAGCAGGTGGGTGG - Intergenic
985271386 4:188197437-188197459 AGTAGCTCTCAGCAGGTGGGTGG - Intergenic
985271401 4:188197497-188197519 AGTAGCTCTCAGCAGGTGGGTGG - Intergenic
985271415 4:188197557-188197579 AGTAGCTCTCAGCAGGTGGGTGG - Intergenic
985893635 5:2736186-2736208 AGGTGATGTGTGCAGGTGGGAGG + Intergenic
986737655 5:10680068-10680090 AGCTGTGCACACCAGGTGGGAGG + Exonic
987048467 5:14129165-14129187 AGCTTCCCTCTGCAGGTGGGAGG + Intergenic
987387524 5:17344126-17344148 CGTTGTTTTCTGGAGGTGGGGGG + Intergenic
988442050 5:31244487-31244509 ATGTGTTCCCTGCAGTTGGGAGG + Intronic
988837588 5:35048261-35048283 CACTTTTCTCTGCAGGAGGGTGG + Intergenic
991583904 5:68183378-68183400 AGCTGTTTTCTGCTGGTGAAGGG - Intergenic
992560956 5:77952365-77952387 AGGTTTTCTCTGTAGGTGGCTGG - Intergenic
994787207 5:104180229-104180251 AGATCTTTTCTGCAGATGGGAGG + Intergenic
997078835 5:130714635-130714657 ATTTCTTCTTTGCAGGTGGGAGG - Intergenic
998480509 5:142459063-142459085 AGCTCCTCTCTGCAGGTTGGGGG + Intergenic
998553350 5:143099295-143099317 AGCTGCCCTGGGCAGGTGGGGGG + Intronic
1000278104 5:159757228-159757250 AGCTTTTCTGTGGAGGTGAGAGG - Intergenic
1001149655 5:169216168-169216190 AGCTGATCAGGGCAGGTGGGAGG - Intronic
1001485440 5:172116459-172116481 CGCTTGTCTCTGCAGGTGGATGG + Intronic
1002065585 5:176650151-176650173 AGGTGTTTGCTGCAGGCGGGTGG + Intronic
1002213402 5:177611492-177611514 AGCTGATCTCAGAAGGTGGAGGG - Intergenic
1002304341 5:178274493-178274515 GGCTGTTCTGAGCAGCTGGGCGG + Intronic
1003524598 6:6887089-6887111 AGCTGCTGTCTGAAGATGGGAGG + Intergenic
1004223164 6:13764304-13764326 AGCTATTCTCAGAAGTTGGGTGG - Intergenic
1004614896 6:17280862-17280884 AGCTGTTCCCAACAGCTGGGGGG + Intergenic
1004882795 6:20025158-20025180 AGCAGTTCTCAGCCGGTAGGTGG - Intergenic
1005299296 6:24455175-24455197 TGCTGTTCTCTGCACTTTGGAGG + Intronic
1005962574 6:30704423-30704445 AGCTGGTTTCTGGAGGTGGAAGG + Exonic
1010191666 6:73202505-73202527 AGCTTTTCTGTGCTGCTGGGTGG - Intergenic
1011177485 6:84580264-84580286 AGCAATTCTCTGGAGCTGGGAGG - Intergenic
1014145525 6:117994031-117994053 AGCTCTTCTCTGCAGGCGCTAGG + Intronic
1015892264 6:137980642-137980664 AGCTGACTTCTGGAGGTGGGAGG + Intergenic
1017702823 6:157092315-157092337 AGCTGTTATCTTAAAGTGGGAGG - Intronic
1017763057 6:157585857-157585879 AGGTGTCCTCTGCAAGTGAGGGG + Intronic
1019118762 6:169786575-169786597 CTCTGTTCCCTGCAGGTGCGTGG + Intergenic
1019481712 7:1269993-1270015 GGCTGTTTGCGGCAGGTGGGCGG + Intergenic
1019483218 7:1275670-1275692 AGCTGTTGTCTGCAGCTCCGGGG - Intergenic
1019999068 7:4744647-4744669 AGCTGTTCTGAGAAGCTGGGTGG + Intronic
1022070584 7:26909632-26909654 AGCTCATATTTGCAGGTGGGTGG - Intronic
1024638009 7:51306294-51306316 GCCTCTTCTCTGCAGGTGAGTGG - Intronic
1024708281 7:51985766-51985788 AGCTATTTTTTGAAGGTGGGAGG - Intergenic
1026010063 7:66629276-66629298 AGCGGTCCTCGGCGGGTGGGCGG + Intronic
1026765551 7:73157282-73157304 GGCTGCTTTCTGCAGGAGGGAGG - Intergenic
1027042024 7:74966975-74966997 GGCTGCTTTCTGCAGGAGGGAGG - Intronic
1027081617 7:75235379-75235401 GGCTGCTTTCTGCAGGAGGGAGG + Intergenic
1028905366 7:96148307-96148329 AGCTGTTCTGAGCAGTAGGGCGG - Intronic
1029390202 7:100269960-100269982 GGCTGCTTTCTGCAGGAGGGAGG + Intronic
1029673235 7:102048354-102048376 GGCTTTTCTGTGCAGGTGGCTGG - Intronic
1034296414 7:149976701-149976723 ACCTGTGGTCTCCAGGTGGGAGG - Intergenic
1034345646 7:150383853-150383875 AGCTGTGCTGGGCTGGTGGGAGG + Intronic
1034397490 7:150838319-150838341 AGTTATTCTCTGCAGTTAGGAGG - Intronic
1034772824 7:153796662-153796684 ACCTGATCTCTGGGGGTGGGTGG + Intergenic
1034809615 7:154120116-154120138 ACCTGTGGTCTCCAGGTGGGAGG + Intronic
1034837289 7:154364323-154364345 AGCTGTGCTCTGCCTGTGGTGGG - Intronic
1035218442 7:157389588-157389610 AGCTGTTCTAGGGACGTGGGGGG + Intronic
1036461814 8:8960142-8960164 AGAAGTTCGCTGCAGGTGTGGGG - Intergenic
1036508953 8:9382891-9382913 AGCTGTTCTCAGCACCTGCGTGG + Intergenic
1036814841 8:11894456-11894478 AGCTCTTCTCTCCAGGTCAGTGG + Intergenic
1037404380 8:18525865-18525887 GCCTGTCCTCTGGAGGTGGGGGG - Intergenic
1037947371 8:22997756-22997778 AGCTGGTCTCTGGAGGTGGGTGG + Intronic
1038027885 8:23608473-23608495 AGCTGTTCTCTGGAGCTGAGAGG - Intergenic
1038537318 8:28362561-28362583 AGGTGTCTTCTTCAGGTGGGTGG - Intronic
1039986045 8:42448769-42448791 AGCTGTTCACAGTAGGTGAGAGG + Intronic
1044118501 8:88364884-88364906 AGATACTCTCTGGAGGTGGGTGG - Intergenic
1047987936 8:130255946-130255968 AGCTGTTCTGTGTGTGTGGGAGG - Intronic
1048057179 8:130878499-130878521 AGCTGATCTCTGAAGATGTGGGG + Intronic
1048073824 8:131047003-131047025 AGCAGTTCTCTGCAACTGGTGGG - Intergenic
1048508765 8:135043716-135043738 AGCTGTCCTCTGTAGGAGAGGGG - Intergenic
1049799703 8:144512089-144512111 AGCTGATCACTGCGGGAGGGTGG + Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1055435754 9:76290461-76290483 AGCTGTTATCTGCTCATGGGAGG - Intronic
1056429367 9:86511925-86511947 AGCTGTTCTCTGCAGGGCAGTGG - Intergenic
1058123663 9:101167341-101167363 AGCTGTTCTGAGCAGTGGGGAGG - Intronic
1058815128 9:108675947-108675969 AGCTGTTGTCTGATGGTGGCTGG - Intergenic
1060267787 9:122122269-122122291 AGTTGATCACTGCTGGTGGGTGG - Intergenic
1060852024 9:126886133-126886155 AGATATTCTCTGCAGGCGCGAGG - Intergenic
1060920554 9:127417694-127417716 AGCTGTGCTAGGCGGGTGGGAGG + Intergenic
1061645945 9:132001996-132002018 AGCTTTGCTCTGCAGGTAAGGGG - Intronic
1061794317 9:133076163-133076185 AGCCTTGCTCTGGAGGTGGGGGG + Intronic
1062029095 9:134353970-134353992 AGCTGTTCACTGCGGATGGAGGG + Intronic
1062090008 9:134670963-134670985 AGCTGATGTCTGGAGGTGGCTGG + Intronic
1062313363 9:135952114-135952136 ATCTGTCCGCTGCAGATGGGTGG + Intronic
1062420335 9:136477823-136477845 AGGTGTTCTCTGCTGGGGTGGGG - Intronic
1185444835 X:252372-252394 AGGTCATCTCTGCATGTGGGTGG + Intergenic
1185444875 X:252577-252599 AGGTGATCTCTGCATGTGGGTGG + Intergenic
1185444899 X:252705-252727 AGGTGATCTCTGCATGTGGGTGG + Intergenic
1185487916 X:497368-497390 TCCCGTTCTCTGCAAGTGGGGGG + Intergenic
1188773484 X:34184491-34184513 AAGTGTACTCTGCATGTGGGAGG + Intergenic
1189617382 X:42797792-42797814 AGATGTTGTCTGCAGGGAGGTGG + Intergenic
1189632958 X:42974741-42974763 AGGTCTTTTCTGCAGGTGAGAGG - Intergenic
1190556140 X:51637508-51637530 GGCTGCCCTCTGCAGTTGGGTGG + Intergenic
1190831696 X:54064512-54064534 AGGGGTTCTCTGCATGTGGTCGG - Intergenic
1191943436 X:66503873-66503895 AGCTGATGTCTGCTGGTGTGGGG + Intergenic
1193049030 X:77081914-77081936 AGCTGGTCTTTGCAGATGGAAGG + Intergenic
1193352387 X:80478269-80478291 ACCTCTTAGCTGCAGGTGGGGGG + Intergenic
1193846533 X:86479012-86479034 AGTTGCTCTCAGCAGGTGGTTGG + Intronic
1193963366 X:87952329-87952351 TGCTCTTCTCTGCAGGAAGGTGG - Intergenic
1194117644 X:89922480-89922502 CTCGGTGCTCTGCAGGTGGGTGG - Exonic
1197089968 X:122524334-122524356 TCCTGTTCTATGGAGGTGGGTGG - Intergenic
1197630536 X:128852826-128852848 AGCTGTGCTCCACAGTTGGGTGG - Intergenic
1198265104 X:135001692-135001714 AGGTGAGCTTTGCAGGTGGGTGG - Intergenic
1200470430 Y:3579639-3579661 CTCGGTGCTCTGCAGGTGGGTGG - Exonic
1201852447 Y:18500836-18500858 AGCTGTTCTCTGCTGTGGTGAGG + Intergenic
1201880874 Y:18819548-18819570 AGCTGTTCTCTGCTGTGGTGAGG - Intronic