ID: 1125965423

View in Genome Browser
Species Human (GRCh38)
Location 15:43871530-43871552
Sequence CCAGAGATGAAAAGGCTGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125965423 Original CRISPR CCAGAGATGAAAAGGCTGTC AGG (reversed) Exonic
900541284 1:3204256-3204278 CCACAGATGAAACGTCTGTGTGG + Intronic
902714202 1:18261283-18261305 ACAGAGAAGAAAAGCCAGTCAGG + Intronic
903338977 1:22642637-22642659 CTAGGGATGAAGGGGCTGTCAGG - Intergenic
904376790 1:30086640-30086662 CCAGAGATGAAAAGACAGTGGGG + Intergenic
904841748 1:33376535-33376557 CCAACGATGAAAAGGCTGATAGG - Intronic
905146691 1:35892754-35892776 CAAAAGATGAAAAGGATCTCTGG - Intronic
906461427 1:46037451-46037473 CCACAGGTGAAAAGGATGTTGGG + Intergenic
907650389 1:56289118-56289140 CCAGAGAAGAAAAAGCAGTGGGG - Intergenic
911575903 1:99577575-99577597 CCAGATATGAATATGCTGACAGG - Intergenic
916716478 1:167451072-167451094 GCAGAGGTGGAAAGGCTGTGTGG + Intronic
917099734 1:171432894-171432916 GCAGAGGGGATAAGGCTGTCTGG + Intergenic
917153340 1:171967676-171967698 GAACAGATGAAAAGTCTGTCTGG - Intronic
917153491 1:171969506-171969528 CAATAGATGAGAAGTCTGTCTGG + Intronic
923554967 1:234993250-234993272 CCAGAGCTGAGAAGGCTGGGTGG + Intergenic
923579606 1:235195671-235195693 CCAAGGAAGAAAAGGCTATCTGG - Intronic
924065070 1:240212755-240212777 TCAGAGATGTAAAATCTGTCTGG + Intronic
924434530 1:244027449-244027471 CTAGAGATGAAGAGGCTTTATGG - Intergenic
924539483 1:244968338-244968360 CCACAGAGGAAAAGGCTGAGAGG + Intergenic
924614598 1:245602249-245602271 ACACAGATGAAAAGGTAGTCTGG - Intronic
924709854 1:246522921-246522943 CCAGAGATGAGGAGGCAGACTGG + Intergenic
1065012685 10:21433600-21433622 GAACAGATGAAAAGTCTGTCTGG - Intergenic
1065289246 10:24213775-24213797 CCAGTGATGAAGAGGATTTCTGG - Intronic
1067214962 10:44293782-44293804 TCAGAGAGGAAAAGGGTGTTTGG + Intronic
1067460266 10:46452984-46453006 GCAGAGATGAGAAGGATGTTTGG - Intergenic
1067524366 10:47029281-47029303 CCAGAGAGAAAAGGGCTGTATGG + Intergenic
1067626924 10:47931619-47931641 GCAGAGATGAGAAGGATGTTTGG + Intergenic
1067850121 10:49749445-49749467 CCAAAGATGCAAAGGCTTGCTGG - Intronic
1068277962 10:54827125-54827147 CCAGAGGTGAACTGGCTATCTGG - Intronic
1068778111 10:60889287-60889309 CCAGAGACTAAAAGCCTGACTGG - Intronic
1069124006 10:64606529-64606551 CAAGAAATGGAAAGGCTGTCTGG + Intergenic
1070950907 10:80429862-80429884 CCAGGCAAGAAAAGGCTGGCAGG - Intronic
1070966167 10:80532611-80532633 GCTGAGATGACAGGGCTGTCTGG + Exonic
1071331804 10:84568106-84568128 AAATAGATGAAAAGTCTGTCTGG - Intergenic
1071582823 10:86789019-86789041 TCAGGGATGAAAAGGGTGTCAGG + Intronic
1073368523 10:102965985-102966007 CAAGAGAAGGAAAGGCTTTCTGG - Intronic
1075615919 10:123891137-123891159 CCAGAGCTGAAATGCATGTCAGG + Intronic
1075948503 10:126457823-126457845 CCAGAGATGAAAAAGCTTCCTGG + Intronic
1076105646 10:127820716-127820738 GAAGAGGTGAAAAGTCTGTCTGG - Intergenic
1076493784 10:130883456-130883478 CCAGAGAGGAAAAGGCAGCCTGG + Intergenic
1077584883 11:3443669-3443691 CAAGGGATGCAAAGGCTGCCGGG + Intergenic
1077944650 11:6882659-6882681 TCAGAGAAGAAAATACTGTCAGG - Intergenic
1078573210 11:12476821-12476843 CCAGGGATGGCAACGCTGTCTGG + Intronic
1078914823 11:15769495-15769517 GCAGAGATGGAAAAGCGGTCAGG + Intergenic
1079162040 11:18004350-18004372 CCCCAGAATAAAAGGCTGTCAGG - Intronic
1079929419 11:26539473-26539495 CCAAAGATTAAAAGGCTTTTTGG - Intronic
1080413652 11:32049782-32049804 CCAGGGAGTGAAAGGCTGTCAGG - Intronic
1081463248 11:43291020-43291042 GAACAGATGAAAAGTCTGTCTGG + Intergenic
1082271186 11:50170625-50170647 CCCGAGATGAAGAGGCCCTCGGG + Intergenic
1084241783 11:67826238-67826260 CAAGGGATGCAAAGGCTGCCGGG + Intergenic
1084615341 11:70231999-70232021 CCAGAGATGGGAAGGCTGGGAGG - Intergenic
1084922706 11:72484066-72484088 CTAGAAATGAAAAGGCTTTGAGG + Intergenic
1085082418 11:73646009-73646031 ACAGAGATGAAAACGCGGTATGG + Intergenic
1086941901 11:92807024-92807046 GAAGAGATGAAAAATCTGTCTGG + Intronic
1087119424 11:94558120-94558142 CCAGAGAAGAAAAAGCTATGGGG + Intronic
1089198760 11:116710852-116710874 CCAGAGGAGAAATGGCTGGCAGG + Intergenic
1089909792 11:122085923-122085945 CCAGAGAAGAGAAGGCTGGGAGG + Intergenic
1089984782 11:122803112-122803134 CCGGAGAGGAAAAGGCAATCTGG - Intronic
1089986949 11:122823828-122823850 TAATAGATGAAAAGTCTGTCTGG + Intergenic
1090051218 11:123381441-123381463 ACAGAGATGGAAAGGCCTTCTGG + Intergenic
1090051225 11:123381490-123381512 CCAGAGATGGGAAGGCCTTCCGG - Intergenic
1090531808 11:127598575-127598597 CTAGAAATGAAAAGGCTGCATGG + Intergenic
1092412033 12:8260946-8260968 CAACAGATGCAAAGGCTGTCGGG + Intergenic
1092526806 12:9314512-9314534 CCAGAGGTGAAAAGGCTGGAGGG + Intergenic
1092540465 12:9417267-9417289 CCAGAGGTGAAAAGGCTGGAGGG - Intergenic
1094512579 12:31105212-31105234 CCAGAGGTGAAAAGGCTGGAGGG + Intergenic
1096770648 12:53934016-53934038 CCAGAGAGGAAAAGGTCTTCCGG + Intergenic
1098973422 12:76878765-76878787 GCAGGGATGAGAAGGCTGGCAGG + Intronic
1100189999 12:92180215-92180237 GAACAGATGAAAAGTCTGTCTGG - Intergenic
1100596514 12:96077089-96077111 CCACAGAGGAAAAGGCTGGTGGG - Intergenic
1100706044 12:97201541-97201563 TCAGAGATGAGAAGGATTTCAGG + Intergenic
1100797425 12:98197015-98197037 TCAGAGATGAAAATGCTGAGTGG - Intergenic
1102194623 12:111016214-111016236 CCATACATGCAAAGTCTGTCTGG + Intergenic
1106285151 13:28312255-28312277 CCAGCACTTAAAAGGCTGTCTGG + Intronic
1107532950 13:41301856-41301878 GAACAGATGAAAAGTCTGTCTGG + Intergenic
1107985350 13:45771140-45771162 GAATAGATGAAAAGTCTGTCTGG + Intergenic
1110514475 13:76393647-76393669 CCAGGAATGAAAAGACTTTCAGG - Intergenic
1112320312 13:98400694-98400716 CCAGAGAAAAAAAGTCTTTCTGG - Intronic
1114495835 14:23131543-23131565 CCAGCGAAGAACAGCCTGTCAGG + Exonic
1117753901 14:58954175-58954197 ACTGAGATGAAAAGGCTGGCTGG - Intergenic
1117763970 14:59060915-59060937 CCAGAGATGAAGAGGCTACAGGG + Intergenic
1119644158 14:76336543-76336565 CCAGCCATGAAGAGGGTGTCAGG - Intronic
1120097252 14:80402877-80402899 GAATAGATGAAAAGTCTGTCTGG + Intergenic
1121016360 14:90551763-90551785 CCAGAGAAGAAAGGGCCGCCCGG - Intronic
1122046264 14:99026179-99026201 GCAGAGATGGGAAGGCTATCAGG - Intergenic
1122181572 14:99958827-99958849 CCAGAGCTCAAAAGTCTCTCTGG - Intergenic
1122676458 14:103418589-103418611 CAACAGATGAAAAGGCAGGCGGG - Intronic
1123107349 14:105848699-105848721 CCAAAGATGAGGAGGCTGTGGGG + Intergenic
1125965423 15:43871530-43871552 CCAGAGATGAAAAGGCTGTCAGG - Exonic
1127119791 15:55761471-55761493 ACAGAGAAGAAAGGGCTGTGTGG + Intergenic
1127325441 15:57890249-57890271 CCAGAGAGGGAAACGATGTCAGG - Intergenic
1127667073 15:61158289-61158311 CCAGAGAGGAGAAGGCTGTCAGG - Intronic
1128204286 15:65837134-65837156 CCTGAAATGGAAAAGCTGTCTGG - Intronic
1128223240 15:65983094-65983116 GAAGAGATGAAAAGGGTGACAGG - Intronic
1128676378 15:69612089-69612111 TCAAACATTAAAAGGCTGTCTGG - Intergenic
1128728784 15:70006699-70006721 CCAGAGCTGAAAAGGATTCCAGG - Intergenic
1129372761 15:75108541-75108563 CTTGAGGTGAAGAGGCTGTCTGG + Intronic
1129592569 15:76930764-76930786 ACAGAGAAGAAAAGGCTTTCTGG - Intergenic
1131797707 15:96036615-96036637 GCAGAAATGAAAAAGCTCTCCGG - Intergenic
1132132402 15:99294822-99294844 CCAAAGATGAAAAGGCTGTAAGG - Intronic
1132955741 16:2592410-2592432 CCAGGGAGGAAAGGGCTCTCAGG + Intronic
1133353277 16:5117147-5117169 CAAGGGATGGAAAGGCTGCCGGG + Intergenic
1133494907 16:6308761-6308783 TAAGAGATGCAAATGCTGTCTGG + Intronic
1133699730 16:8297736-8297758 CCAGAGATATAAAGGGTGGCTGG + Intergenic
1134508097 16:14824332-14824354 CCAGAGAGGTAAGGGCTCTCCGG + Intronic
1134695797 16:16223097-16223119 CCAGAGAGGTAAGGGCTCTCCGG + Intronic
1134976030 16:18571591-18571613 CCAGAGAGGTAAGGGCTCTCCGG - Intergenic
1135191290 16:20356779-20356801 CCTGAGATGGAGAGGTTGTCTGG + Intergenic
1137445749 16:48531116-48531138 GCAGAGATGGAGAGGGTGTCTGG + Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138761230 16:59547129-59547151 AAAGAGATGACAAGGCTGTAGGG + Intergenic
1138908858 16:61372002-61372024 ACAGAGATGAAAATCCTGCCTGG + Intergenic
1138910086 16:61386152-61386174 CAAGAGATGGAAAGGCAGTCTGG - Intergenic
1139537698 16:67588353-67588375 CAAGTGATGAAAAGACTGTAGGG + Intronic
1139789868 16:69424898-69424920 CGAGGGGTGAAAAGGCTGTGTGG + Intronic
1141841201 16:86575452-86575474 CCTCAGATAAAAAGGCTGACGGG - Intergenic
1142038235 16:87875800-87875822 ACAGAGATGAAAAGTTTGGCTGG - Intergenic
1142639220 17:1276044-1276066 CCAAGGATGAAAGGGCTGTGGGG + Intergenic
1143272882 17:5688868-5688890 CCAGGGATGCAAAGGATGTGTGG + Intergenic
1144273291 17:13640752-13640774 GAATAGATGAAAAGTCTGTCTGG - Intergenic
1144291044 17:13826567-13826589 GTAGAGATGAAAAGGGTGGCTGG + Intergenic
1144788734 17:17845967-17845989 CCAGAGAGGAAACCTCTGTCTGG - Intronic
1146388638 17:32400605-32400627 CCAGAGGTGCAAAGGCCCTCAGG - Intergenic
1147168772 17:38606316-38606338 CTAGGGATGGAAAGGCTCTCGGG + Intergenic
1147786491 17:42981916-42981938 CCAGAGATGCAAAGCTTGTAAGG - Intronic
1148644925 17:49214331-49214353 CCAGAGATGAGGAAGCTGCCCGG + Intronic
1148698513 17:49575176-49575198 CCTGGGCTGAAAAGGCTGTTAGG - Intergenic
1148793711 17:50187389-50187411 CCAGAGAGGCAAAGGGTGCCTGG + Intronic
1148856781 17:50583268-50583290 CCAGACATTCAAAGGCTATCTGG + Intronic
1150238376 17:63611524-63611546 TCAGAGATGAAAAGGATCTAGGG - Intergenic
1153830951 18:8922090-8922112 GAATAGATGAAAAGTCTGTCTGG + Intergenic
1154159229 18:11968179-11968201 CAAGAGATGACAAGGCTGCTGGG - Intergenic
1154982862 18:21518229-21518251 CCAGAGGTAAAAAGGGTGTGGGG + Exonic
1157235497 18:45961456-45961478 CTAGCCAGGAAAAGGCTGTCTGG - Intronic
1157506008 18:48227148-48227170 CCATGCCTGAAAAGGCTGTCTGG + Intronic
1158210239 18:55040787-55040809 CAACAGATGAAAAGTCTGTCTGG - Intergenic
1161720075 19:5897648-5897670 GCAGAGATGGAAAAGCTGACCGG - Intronic
1163066877 19:14803511-14803533 ACAAATAGGAAAAGGCTGTCTGG - Intronic
1163284071 19:16335395-16335417 GCAGAGAGGCAGAGGCTGTCAGG + Intergenic
1165250721 19:34531665-34531687 CCAAAGGGGAGAAGGCTGTCAGG - Intergenic
925198215 2:1944972-1944994 ACAGATATGTAAAGGATGTCTGG + Intronic
925253622 2:2463840-2463862 CCAGAGATGGAGATGCTGACAGG + Intergenic
926528569 2:14012489-14012511 CCAGTGTTGAAATGGCTGGCTGG + Intergenic
927031474 2:19124634-19124656 CCAGAGATCAGAAGTCTGACAGG + Intergenic
929857052 2:45646296-45646318 GCAGAGAGAAAAAGGATGTCTGG - Intergenic
931446544 2:62331694-62331716 ACACAGATGAAAAGTCTCTCAGG + Intergenic
932504882 2:72219147-72219169 CCAGAGAAGAGAAGGCTGAAGGG + Intronic
932909395 2:75790119-75790141 CCAAAGAAGAAAAAGGTGTCTGG - Intergenic
936444964 2:112587953-112587975 CCAGGGAAGAGAAGACTGTCAGG - Intronic
937300304 2:120835002-120835024 CCAAAAATGATAAGGCTGCCTGG - Intronic
937641786 2:124220788-124220810 TCAGAGATGATTAGGCTGTGAGG - Intronic
938673936 2:133611653-133611675 CCAAAGATAAAAAGGCTGGGTGG + Intergenic
939339115 2:140870167-140870189 CAATAGATGAAAAGTCTGTCTGG - Intronic
939554366 2:143656536-143656558 TCCAAGATGAAAAGACTGTCTGG + Intronic
939918259 2:148075204-148075226 CCAAAGATGACAGGGCTGTAAGG + Intronic
940553696 2:155194813-155194835 GAATAGATGAAAAGTCTGTCTGG + Intergenic
944343957 2:198637855-198637877 CCAGAGAAGAGAGGTCTGTCAGG + Intergenic
947701212 2:232235963-232235985 CCACAGAGGAGAGGGCTGTCTGG - Intronic
1172382513 20:34507231-34507253 CAAGAGTTGAAAAGGATGTGAGG - Intronic
1172483497 20:35285287-35285309 CCAGAGACGGAAAGGCAGCCAGG + Intergenic
1175392624 20:58636673-58636695 CCAGAGGTGAAGAGCCTGCCAGG - Intergenic
1175494040 20:59400871-59400893 GCAGACATGGAAAGGCTGACAGG - Intergenic
1175770624 20:61621817-61621839 CCACAGATGAAAACGCTCTTTGG + Intronic
1175820428 20:61906205-61906227 CCATAGATGAAAATACTATCTGG - Intronic
1176295385 21:5069465-5069487 GCAGAGATGCAAAGGCAGGCAGG - Intergenic
1178226367 21:30723924-30723946 TCACAGATGAAAAGACTGGCAGG - Intergenic
1178440439 21:32593903-32593925 CCTGAGAGGAAAAGGCAGTGTGG - Intronic
1178518647 21:33268650-33268672 CCAGACAGCAAAAGGCTGGCAGG - Intronic
1179861664 21:44192659-44192681 GCAGAGATGCAAAGGCAGGCAGG + Intergenic
1179934416 21:44593044-44593066 CCGGAGGTGAAGAGGCTGTGGGG - Intronic
1182208208 22:28650166-28650188 CCACACATGAAAAGGCAATCAGG + Intronic
1182546395 22:31079234-31079256 CTAGAGATCAAAGGGCAGTCCGG - Intronic
1184640013 22:45865724-45865746 CCAGAGAGGGAAAGGCTGCCTGG - Intergenic
1184774959 22:46618526-46618548 CCAGAGCTGATGAGGGTGTCGGG + Intronic
949226650 3:1702915-1702937 TAACATATGAAAAGGCTGTCGGG + Intergenic
949834148 3:8249844-8249866 CCATAGGTGAAAAGGCAGGCAGG - Intergenic
950485211 3:13269352-13269374 CCAGAGAGGGAAAGGGGGTCTGG - Intergenic
951120479 3:18921053-18921075 CCAGAGAAGAATAGTATGTCTGG + Intergenic
952196071 3:31076429-31076451 CTAGAGATGAAAAAATTGTCTGG + Intergenic
953148894 3:40306026-40306048 CAGGAGAAGAAAAGGCTGCCTGG + Intergenic
953154558 3:40357420-40357442 GCAGAAAAGAAAAGGCAGTCAGG + Intergenic
953388469 3:42520721-42520743 CCAGGGAGGAAAAGGCCATCTGG - Intronic
954975009 3:54685087-54685109 CCAGAGAACAAAAGCCTGTGGGG + Intronic
955004375 3:54955332-54955354 GAACAGATGAAAAGTCTGTCTGG + Intronic
957057243 3:75453154-75453176 CAAGGGATGCAAAGGCTGCCGGG + Intergenic
958266701 3:91446260-91446282 CCAGACATGAAAAGGGAGGCTGG - Intergenic
958834295 3:99126231-99126253 CCAGAGATGTAAAAGCAGACTGG - Intergenic
961296210 3:125886581-125886603 CAAGGGATGCAAAGGCTGCCGGG - Intergenic
962389540 3:134959727-134959749 CCAGGGAAGAAAAGGCTCTGAGG + Intronic
962434165 3:135349011-135349033 CCAGGGAGGATAAGGCTGCCAGG + Intergenic
962576155 3:136756835-136756857 GAACAGATGAAAAGTCTGTCAGG - Intergenic
963376153 3:144467559-144467581 CCAAAGATGAAAAAGCTGGTGGG - Intergenic
963863569 3:150335764-150335786 CCAGAGTTTAAAATGCTGTCAGG - Intergenic
966154161 3:176898125-176898147 CCAGAGAAGAAAAGGACATCTGG + Intergenic
966565617 3:181377659-181377681 CCAGCTATGAACAGCCTGTCTGG + Intergenic
969000077 4:3973512-3973534 CAAGGGATGCAAAGGCTGCCGGG + Intergenic
969662329 4:8537604-8537626 CCTGATAGGAGAAGGCTGTCAGG + Intergenic
969662344 4:8537673-8537695 CCTGATAGGAGAAGGCTGTCAGG + Intergenic
969753944 4:9135095-9135117 CAAGGGATGCAAAGGCTGCCGGG - Intergenic
969813834 4:9671291-9671313 CAACAGATGCAAAGGCTGCCGGG - Intergenic
970259165 4:14205899-14205921 ACAGAGATGAAAAGGCAATGAGG + Intergenic
971991860 4:33908804-33908826 ACAAAGATGAAAAGGCAGTTTGG + Intergenic
974156260 4:58077261-58077283 CCAGAGATGAAGTGGCTTTGTGG + Intergenic
975356135 4:73406482-73406504 CCTGATATGAATAGGCTTTCTGG + Intronic
975405107 4:73980287-73980309 CCAGAGATGGAAATGGTTTCTGG + Intergenic
982020327 4:151196475-151196497 CCAGAGATGAAAAAATTCTCAGG + Intronic
982743627 4:159083730-159083752 CCAGAAATGAAAAGGATGATGGG - Intergenic
986214631 5:5707982-5708004 CCAGAGATCAAAAGTCTTCCTGG + Intergenic
987858060 5:23447312-23447334 GAAGAGATGAAAAGTCTGTCTGG - Intergenic
988681327 5:33487120-33487142 GAATAGATGAAAAGTCTGTCTGG - Intergenic
990562321 5:56995528-56995550 CCAGAGATCCAAAGAATGTCAGG - Intergenic
990741026 5:58912964-58912986 GAATAGATGAAAAGTCTGTCTGG - Intergenic
992192681 5:74309322-74309344 GAATAGATGAAAAGTCTGTCTGG + Intergenic
996290882 5:121851633-121851655 CCTGCGTTAAAAAGGCTGTCAGG - Intergenic
997971225 5:138403956-138403978 CCAGAGATGAAAAATATCTCAGG + Intronic
999889947 5:155966577-155966599 CCAGAGATTCAAATGCTGGCAGG - Intronic
1001945554 5:175774791-175774813 GCAGAGCTGACAAGGCTGCCAGG - Intergenic
1002313414 5:178328267-178328289 CCAGAGGTGAAAACGCAGTGGGG - Intronic
1004060003 6:12185334-12185356 CCAGAGAGGAAAAAGCTGCACGG + Intergenic
1005061444 6:21780398-21780420 CCAGAGATGAAAATGCTCAAGGG - Intergenic
1006586789 6:35120348-35120370 CCAGGGAAGAACAGGCTGTCAGG + Intronic
1006803652 6:36775077-36775099 GAAGAGAGGGAAAGGCTGTCAGG + Intronic
1007375890 6:41456575-41456597 CCAGAGGAGGGAAGGCTGTCAGG - Intergenic
1007429503 6:41768579-41768601 CCAGAGATCAAAAGGATATAAGG + Intergenic
1008909241 6:56715681-56715703 GAATAGATGAAAAGTCTGTCTGG - Intronic
1008927917 6:56906667-56906689 TCTGAGAGGAAAAGGCTGGCAGG - Intronic
1008988512 6:57575333-57575355 CCAGACATGAAAAGGGAGGCTGG + Intronic
1009177119 6:60473924-60473946 CCAGACATGAAAAGGGAGGCTGG + Intergenic
1009941406 6:70293070-70293092 CCAAAGAAGAAAAGGTTATCAGG - Intronic
1009943121 6:70312557-70312579 GCAGAGATGGAAAGGCAGACAGG + Intergenic
1010749880 6:79606156-79606178 CCAGAGATCAACAGGGTGCCAGG - Intergenic
1011824983 6:91295282-91295304 GAACAGATGAAAAGTCTGTCTGG + Intergenic
1012880537 6:104782529-104782551 CCAGAATTTAAAAGTCTGTCTGG - Intronic
1013503981 6:110780827-110780849 CCAGAGATGAGAAAGCAGACAGG + Intronic
1014380679 6:120737290-120737312 CCAGGGCTGAAAAAGCTGTCTGG - Intergenic
1014507475 6:122277663-122277685 ACAGAGATGAAAAAGCAGGCAGG + Intergenic
1015476394 6:133663354-133663376 CCAAAGATCAGAAGGCTGTAGGG - Intergenic
1018656404 6:166041354-166041376 CCAGAGAGGAAGAGTGTGTCTGG - Intergenic
1020037488 7:4973774-4973796 CCAGAGCTGAAAAGGGTATGGGG - Intergenic
1020162347 7:5781895-5781917 CCAGAGCTGAAAAGGGTATGGGG + Intergenic
1024757817 7:52557032-52557054 CCAAAGAAGAAATGGCTGTTAGG + Intergenic
1026256676 7:68718260-68718282 CCAGAAGAAAAAAGGCTGTCTGG + Intergenic
1027699290 7:81449749-81449771 CCAGAGCTGGATAGACTGTCTGG + Intergenic
1029205856 7:98869247-98869269 CCAGAGAGGAAATGGCAGCCTGG + Intronic
1031421746 7:121561181-121561203 CCAGAGAAGAGAAAGCTGTATGG - Intergenic
1032503413 7:132417231-132417253 CCAGAGATGAAATGGCAGAAAGG + Intronic
1032519076 7:132529096-132529118 CCAGAGATGAACAGATTCTCAGG - Intronic
1035240058 7:157523616-157523638 ACAGAGCTGAGGAGGCTGTCGGG + Intergenic
1036377158 8:8210444-8210466 CAAGGGATGCAAAGGCTGCCGGG - Intergenic
1036388335 8:8302053-8302075 CCAGAGAGGAAAAGACACTCAGG + Intergenic
1036852388 8:12212705-12212727 CAAGGGATGCAAAGGCTGCCGGG + Intergenic
1036873756 8:12455228-12455250 CAAGGGATGCAAAGGCTGCCGGG + Intergenic
1039493224 8:37963404-37963426 CAAAAAATGAAAAGTCTGTCTGG - Exonic
1039990294 8:42481960-42481982 CCAGAGAGTAAGAGGCTGTGTGG - Intronic
1041095219 8:54342944-54342966 CCAGAGATGATATGGCTAACAGG - Intergenic
1043575353 8:81650301-81650323 CTAGAGGTGAAAAGGCTGAGCGG + Intergenic
1047410042 8:124617063-124617085 CAACAGATGGAAATGCTGTCTGG + Intronic
1048180375 8:132189055-132189077 CGGGAGATGACAAGGCTGTGAGG - Intronic
1048704642 8:137139389-137139411 TCAAAGTTGAACAGGCTGTCAGG - Intergenic
1049106483 8:140616928-140616950 CCAGGGATGGACAGGCTGCCTGG - Intronic
1049335211 8:142080636-142080658 CCCCAGATGAAAAGGGTCTCAGG + Intergenic
1050332533 9:4559995-4560017 CCAGATTTGAAAGGGCTGTCTGG - Intronic
1051812704 9:21068238-21068260 GCAGAAATGAAAAGGATGACAGG - Intergenic
1053594467 9:39545877-39545899 GGATAGATGAAAAGTCTGTCTGG + Intergenic
1053852249 9:42300910-42300932 GGATAGATGAAAAGTCTGTCTGG + Intergenic
1054571791 9:66819090-66819112 GGATAGATGAAAAGTCTGTCTGG - Intergenic
1054754178 9:68940294-68940316 GCAGAGATTAAAAGGATGACTGG - Intronic
1056194607 9:84217469-84217491 CCAGAGATCAGAAGGATTTCTGG - Intergenic
1058006997 9:99927130-99927152 CCAGAGAGGAGAAGGCTGCATGG - Intronic
1058844569 9:108944122-108944144 CTAGATATAAAAAGTCTGTCAGG + Intronic
1059492568 9:114681357-114681379 CAAGAAATGAAAAGGCTCTTAGG + Intergenic
1061180312 9:129021622-129021644 CCAGAGATGAAGGGACTGCCCGG - Intronic
1061214696 9:129214807-129214829 CCAGAGATGGACAGGATGGCAGG - Intergenic
1062095266 9:134699874-134699896 ACAGAGGTGAGAAGGCAGTCGGG - Intronic
1185478933 X:432128-432150 CCAGAGCTGAGAAAGCTGCCTGG - Intergenic
1186673695 X:11793665-11793687 GAATAGATGAAAAGTCTGTCTGG - Intergenic
1189692827 X:43634913-43634935 GAATAGATGAAAAGTCTGTCTGG - Intergenic
1189904750 X:45746482-45746504 CAAGAGATGAAAAAGCTGGATGG + Intergenic
1190810573 X:53879526-53879548 CCAGAGATTGAAATGCTGTGAGG + Intergenic
1192034047 X:67544702-67544724 CAAAAGATGAAAAGGCAGTCAGG + Exonic
1192881030 X:75284583-75284605 CCAGAGCTGAACAGACTCTCTGG - Intronic
1196222438 X:113126844-113126866 GAATAGATGAAAAGTCTGTCTGG + Intergenic
1196770847 X:119291838-119291860 CCAGGTTTGAAAAGGCTTTCTGG + Intergenic
1197282641 X:124554971-124554993 TCAGAGAAAAAAAGGCTGTTTGG + Intronic
1201604536 Y:15770895-15770917 CCAGAGATGAAGGGACTGCCCGG + Intergenic
1202051313 Y:20783670-20783692 CCAGACAGAAAGAGGCTGTCAGG - Intergenic