ID: 1125967584

View in Genome Browser
Species Human (GRCh38)
Location 15:43886774-43886796
Sequence ACTAGGCCAAAGGCAGGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125967575_1125967584 18 Left 1125967575 15:43886733-43886755 CCTGGGCATGTTCTTGCATCTGA 0: 1
1: 0
2: 1
3: 11
4: 160
Right 1125967584 15:43886774-43886796 ACTAGGCCAAAGGCAGGACTAGG 0: 1
1: 0
2: 0
3: 23
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125967584 Original CRISPR ACTAGGCCAAAGGCAGGACT AGG Intronic
900189813 1:1348632-1348654 ACACGGGCCAAGGCAGGACTCGG + Intronic
901106155 1:6758220-6758242 CCAAGGCCAGAGCCAGGACTGGG - Intergenic
901968962 1:12892391-12892413 ACTCAGCCAGGGGCAGGACTGGG - Intronic
902016212 1:13309390-13309412 ACTCAGCCAGGGGCAGGACTGGG + Intronic
904094510 1:27966651-27966673 ACAGGGCCACAGCCAGGACTCGG - Exonic
904697925 1:32340820-32340842 AATAGGCAAAAGGCAGGAATAGG + Intergenic
905464597 1:38143363-38143385 ATTTGGCCAAAGGCAGTTCTTGG - Intergenic
906148012 1:43571307-43571329 CATAGGGCAAAGGCAGGGCTTGG - Intronic
906723990 1:48030407-48030429 CCTAGGCCAGAGGCAGGGGTGGG + Intergenic
906849210 1:49229788-49229810 ACTAGGCCAACACCAGGGCTGGG + Intronic
907408126 1:54266245-54266267 ACCAGGGCAAAGGCTGGTCTTGG + Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907854015 1:58283508-58283530 ACAAGGACAAAGGCAGGAACTGG - Intronic
909491694 1:76233451-76233473 ACAAGGCCAAGGGAAGGCCTAGG + Intronic
911180771 1:94858495-94858517 GCCAGGGCAATGGCAGGACTGGG + Intronic
912729780 1:112091928-112091950 ATTAGGAGATAGGCAGGACTGGG + Intergenic
913957306 1:143318156-143318178 AGCAGGCCAAAGGCAGGGCCAGG + Intergenic
914051620 1:144143520-144143542 AGCAGGCCAAAGGCAGGGCCAGG + Intergenic
914127577 1:144823021-144823043 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
915073081 1:153288486-153288508 ACTAGTCCCAAGGCAGTGCTGGG + Intergenic
915484442 1:156210529-156210551 ACTTGGCCCAGGGCAGGGCTGGG - Exonic
916530734 1:165653902-165653924 ACTGCCCCAAAGTCAGGACTAGG - Intronic
1064286858 10:13999072-13999094 AACAGGCCAGAGGCAGGAGTGGG - Intronic
1065649245 10:27870255-27870277 ACTATGCCAAAGAGAAGACTGGG - Intronic
1065901932 10:30215727-30215749 GCAAGGCTAAAGGCAGCACTGGG + Intergenic
1066759425 10:38738774-38738796 GCTAGGGCCAAGGCAGGACCAGG - Intergenic
1067497399 10:46773380-46773402 GCAAGGCCCCAGGCAGGACTTGG - Intergenic
1067597252 10:47567035-47567057 GCAAGGCCCCAGGCAGGACTTGG + Intergenic
1071554726 10:86593261-86593283 GCTAGGACAATGTCAGGACTTGG + Intergenic
1072460571 10:95615038-95615060 AATAGGCAAAAGGCAGGGCGTGG + Intronic
1072909556 10:99487672-99487694 ACTAGACAAAAGGAAGAACTGGG - Intergenic
1075680914 10:124330579-124330601 ACTAAACCAGAGACAGGACTAGG - Intergenic
1077499162 11:2901544-2901566 CCCAGGCCAAGGGCAGGGCTTGG + Intronic
1077563826 11:3283559-3283581 AAGAGTACAAAGGCAGGACTTGG + Intergenic
1077569715 11:3329376-3329398 AAGAGTACAAAGGCAGGACTTGG + Intergenic
1078653010 11:13213335-13213357 GCTAGGGCAAAGGCAGGGCACGG + Intergenic
1079314461 11:19395975-19395997 AGTTGGCCTCAGGCAGGACTTGG + Intronic
1081805458 11:45887579-45887601 ACTGGGCCAGAGGCAGGGCTGGG - Intronic
1081988663 11:47325798-47325820 GCTATGCCAAGGGCAGGACGAGG - Intronic
1083658151 11:64240048-64240070 AGTGGGCCTAAGGCAGGAGTGGG + Intergenic
1084573800 11:69975940-69975962 GCAAGGCCAAGGGCAGGGCTGGG - Intergenic
1084954399 11:72683786-72683808 TGCAGGCCAAAGGCAGAACTGGG + Intergenic
1089257282 11:117200540-117200562 ACTGGCTCGAAGGCAGGACTCGG + Intronic
1089331021 11:117688968-117688990 CCTATGCAAAAGGCAGGTCTCGG + Intronic
1090316034 11:125789336-125789358 ACTAGGCAAAAGCAGGGACTTGG - Intronic
1090465364 11:126928580-126928602 ATCAGGGAAAAGGCAGGACTGGG + Intronic
1090531457 11:127595177-127595199 ATTAGGACAAAGGCAGGATTGGG + Intergenic
1093079885 12:14797782-14797804 ACAAGGCCACAGGCAGCTCTAGG - Intronic
1095194588 12:39298094-39298116 ACTAGGCAAAAGGCAGTGCGAGG + Intronic
1097347351 12:58508113-58508135 ACTAGGCCAAACCCTGTACTAGG + Intergenic
1097622496 12:61957601-61957623 AGCAGGCCAAAGACAGGACTGGG + Intronic
1098040194 12:66346266-66346288 ACCAGGCCAAAGGAAGAGCTAGG - Exonic
1099496826 12:83358643-83358665 TCTATGACAAAAGCAGGACTGGG - Intergenic
1100215214 12:92440882-92440904 CCTAGTCCATTGGCAGGACTTGG + Intergenic
1106668581 13:31880306-31880328 ACTAGGGCTAAGGCAGGAACTGG - Intergenic
1107961834 13:45565870-45565892 ACTAGGTAACAGGCAGGAGTTGG + Intronic
1108113293 13:47101055-47101077 AATAAGCAAGAGGCAGGACTTGG + Intergenic
1114081997 14:19209316-19209338 ACTAGGCAACGGGCAGGAGTTGG + Intergenic
1114150410 14:20032072-20032094 ACCAGGCCAAAGTCAGGAAAAGG - Intergenic
1117189683 14:53277815-53277837 AGAAGGCCATTGGCAGGACTGGG - Intergenic
1118830483 14:69426682-69426704 ACCTGCCCCAAGGCAGGACTTGG - Intronic
1118894795 14:69936667-69936689 ACTTGGCTAAAGGCAGGTCTGGG + Intronic
1119892874 14:78196179-78196201 ACATGGACAAAGGCAGTACTCGG - Intergenic
1120955879 14:90081176-90081198 TCTAGGCCAAAGGCAAAATTTGG + Intronic
1202906478 14_GL000194v1_random:76496-76518 ATTTGGCCCAAGGCAGGACAAGG + Intergenic
1202931063 14_KI270725v1_random:31889-31911 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
1123421368 15:20139789-20139811 AGCAGGCCAAAGGCAGGGCCAGG + Intergenic
1123530594 15:21146329-21146351 AGCAGGCCAAAGGCAGGGCCAGG + Intergenic
1124404638 15:29382566-29382588 GCAAGGTCAAGGGCAGGACTTGG - Intronic
1125967584 15:43886774-43886796 ACTAGGCCAAAGGCAGGACTAGG + Intronic
1129061775 15:72866223-72866245 ACTAGACCAGAGGCTGGACCAGG - Intergenic
1129170615 15:73805316-73805338 AATAGGCCAAAGGCGGGGATGGG + Intergenic
1136723358 16:32340389-32340411 GCTAGGGCCAAGGCAGGACCAGG + Intergenic
1136841702 16:33546467-33546489 GCTAGGGCCAAGGCAGGACCAGG + Intergenic
1137395514 16:48114084-48114106 ACTAGGCCAGAAGAAGAACTAGG + Intronic
1137501562 16:49015282-49015304 ACTGGGACAAAGGCAGGTGTGGG - Intergenic
1137596814 16:49729435-49729457 ACTAGGGCAAAGGGAGGAAAAGG - Intronic
1137776537 16:51059577-51059599 ACTAGTCAAGAGGCAGGAGTGGG - Intergenic
1138471149 16:57237476-57237498 AATAGGCCAGAGGCAGGAGAGGG + Intronic
1141616028 16:85209828-85209850 ACCAGGTCAAAGGCAGGATTAGG - Intergenic
1141824426 16:86468900-86468922 CCCTGGCCAAAGCCAGGACTAGG + Intergenic
1203003074 16_KI270728v1_random:177376-177398 GCTAGGGCCAAGGCAGGACCAGG - Intergenic
1203134679 16_KI270728v1_random:1713782-1713804 GCTAGGGCCAAGGCAGGACCAGG - Intergenic
1203151867 16_KI270728v1_random:1846764-1846786 GCTAGGGCCAAGGCAGGACCAGG + Intergenic
1142638616 17:1272172-1272194 AGGAGGCCAAGGGCAGGGCTAGG + Intergenic
1142749676 17:1979749-1979771 ACTGGGCAAAGGGCTGGACTTGG - Intronic
1143102955 17:4514189-4514211 ACTAGGGCAGAGTCAGGACCAGG - Intronic
1143180274 17:4980189-4980211 TCAGGGTCAAAGGCAGGACTGGG + Exonic
1143531103 17:7503958-7503980 AATGGGCCAAACACAGGACTTGG - Intronic
1143837153 17:9701559-9701581 ACCAGCCCTGAGGCAGGACTGGG + Exonic
1144076406 17:11723385-11723407 ACTAGGCGAATGGCAAGAATAGG - Intronic
1146642325 17:34550643-34550665 ACTGGACCAAAGGCAGACCTAGG - Intergenic
1148447496 17:47746396-47746418 GCAAGGCCAAGGGCTGGACTGGG + Intergenic
1149263056 17:54900222-54900244 TCTAGGACAAAGGCAGGTCGAGG + Intronic
1151933169 17:77245521-77245543 ACCAGGCCAAAGGCTGGTCTCGG - Intergenic
1155493897 18:26424486-26424508 ACAGGGCCAAAGGCAGGAATGGG - Intergenic
1156499094 18:37545613-37545635 GCGAGGCCAGAGGCAGCACTTGG - Intronic
1157038029 18:44000346-44000368 TCTAGGCCTCAGACAGGACTTGG + Intergenic
1157891313 18:51420723-51420745 AGTAGGCCTCAGGCAGGAATTGG - Intergenic
1158906008 18:62012489-62012511 ATTTGGCAAAAGCCAGGACTTGG - Intergenic
1159080104 18:63726940-63726962 ACTAGGTGGAAGGCAGGACTTGG - Intergenic
1163708804 19:18833035-18833057 ACCAGGCCAGAGACAGGATTAGG - Intronic
1165358328 19:35317905-35317927 TGTAGGCCACAGGCAGGACTGGG + Intergenic
1165358342 19:35318011-35318033 TGTAGGCCACAGGCAGGACTGGG + Intergenic
1166103150 19:40583245-40583267 ACAGGGACAAAGGCAGGCCTGGG + Intronic
1166416236 19:42596425-42596447 ACTAGGCCCAGGGAAGGATTGGG + Intronic
1167508210 19:49882213-49882235 ACGAGGCCAAAGGGAGGTCACGG - Intronic
1202691017 1_KI270712v1_random:95944-95966 AGCAGGCCAAAGGCAGGGCCAGG + Intergenic
925165984 2:1716034-1716056 ACAAGGCAACAGGCAGGCCTGGG + Intronic
926448848 2:12977454-12977476 AATGGGCCAAAGACAGGATTGGG + Intergenic
927002632 2:18814348-18814370 TATACCCCAAAGGCAGGACTTGG - Intergenic
927921601 2:26976418-26976440 TCTTGGCCAAAGGGAAGACTGGG - Intronic
928175077 2:29027952-29027974 CCTAGGCCAAGGTCAGGAGTTGG + Intronic
930608248 2:53514485-53514507 AATAGACTAAAGGCTGGACTGGG - Intergenic
933762835 2:85685026-85685048 ACAAGGCCAAAGTCAGGATGTGG - Intergenic
933955377 2:87358007-87358029 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
934239563 2:90254218-90254240 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
934273630 2:91562523-91562545 AGCAGGCCAAAGGCAGGGCCAGG + Intergenic
934322746 2:91983125-91983147 GCTAGGGCCAAGGCAGGACCAGG - Intergenic
934462002 2:94217558-94217580 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
938494585 2:131787267-131787289 ACTAGGCAATGGGCAGGAGTTGG - Intergenic
939820303 2:146948855-146948877 ATTAGGCCATAGGCAGAATTTGG - Intergenic
943300955 2:186199174-186199196 ACTAGGCTACAGGCAGCATTTGG - Intergenic
943831252 2:192465339-192465361 ACTAGGCCAACATTAGGACTGGG + Intergenic
946236410 2:218327087-218327109 AATAGGACACAGGCAGGTCTGGG + Intronic
946317428 2:218926338-218926360 ACTGGGCCTGAGGGAGGACTAGG + Intergenic
948479861 2:238242529-238242551 AGGAGGCTAAAGGGAGGACTAGG + Intergenic
1172163721 20:32886023-32886045 ACTAGGCAAAAGGCCTGAATCGG - Intronic
1173024880 20:39298673-39298695 CCTAGCCCCAAGGCAGGACCAGG - Intergenic
1173080730 20:39864582-39864604 TCTAGGCCAGGGCCAGGACTAGG - Intergenic
1175225209 20:57440607-57440629 ACTTGGCCAGCAGCAGGACTCGG + Intergenic
1176593086 21:8660511-8660533 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
1176625823 21:9091295-9091317 ATTTGGCCCAAGGCAGGACAAGG + Intergenic
1177484923 21:21745224-21745246 ACTAGGTAACAGGCAGGAATTGG + Intergenic
1178180928 21:30160612-30160634 ACTTGGCAAAAGGCAGAACCTGG + Intergenic
1178972694 21:37195045-37195067 ACTAGGGGAAGAGCAGGACTGGG + Intronic
1179606684 21:42520789-42520811 ACCTGGCCAATGCCAGGACTGGG + Intronic
1180275933 22:10637638-10637660 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
1180498776 22:15913354-15913376 ACTAGGCAACGGGCAGGAGTTGG - Intergenic
1180549507 22:16529029-16529051 GCTAGGGCCAAGGCAGGACCAGG - Intergenic
1180604033 22:17042277-17042299 TCCAGTCCAAAGGCAGGAATTGG - Intergenic
1180884046 22:19227190-19227212 ACTAGGCTAAATACAGAACTAGG + Intronic
1180977044 22:19854251-19854273 ACAAGGCCAAAGGCAGCACCTGG + Intronic
1183058790 22:35322857-35322879 ACTGGGACAATGCCAGGACTGGG - Intronic
1183213562 22:36465455-36465477 CCTTGGCCAGAGGCAGGACCCGG - Intergenic
1184200055 22:42962544-42962566 AAGAGGCCCAAGGCAGAACTGGG + Intronic
1184384061 22:44164304-44164326 GCTCAGCCAAAGGCAGTACTTGG + Intronic
1184549320 22:45196135-45196157 ACCAGGCCGAGGGCAGGCCTGGG + Exonic
1184647191 22:45902804-45902826 CCCAGGCCAGAGGCAGGACGTGG - Intergenic
1184681468 22:46074480-46074502 ACATGGACAAAGGCAGGACAGGG - Intronic
950369206 3:12513942-12513964 CCTAAGCCAAGGGCAGGACTGGG + Intronic
956170380 3:66429041-66429063 ACCTCTCCAAAGGCAGGACTGGG + Intronic
957211538 3:77265251-77265273 ACTATGTCAGAGGCAGGAGTAGG + Intronic
958712027 3:97728718-97728740 ACTTGCCCAAAGGCAGAGCTTGG + Intronic
961168403 3:124779347-124779369 AATGAGCCAAAGGCAGTACTGGG + Intronic
961448492 3:126992022-126992044 ACTGGGCCAAGGGCAGGGCAAGG + Intronic
962162993 3:133019339-133019361 ACCAAGCCAAGAGCAGGACTAGG - Intergenic
966156385 3:176920949-176920971 ACAAGGCCAAATGAAGGTCTGGG - Intergenic
967898261 3:194418501-194418523 AATTGGCCAAAGGCATGAATAGG + Intronic
969294798 4:6263482-6263504 ACTGGGACACAGGCAGGCCTGGG + Intergenic
969505885 4:7587543-7587565 ATTAGGCCCAAGGCAGGCCCAGG + Intronic
980321392 4:131282880-131282902 ACTTGGCCAAAGGCAGAAGAGGG - Intergenic
984573603 4:181422285-181422307 TCTAGGCCGAAGGCAGGGCTGGG + Intergenic
986846516 5:11762758-11762780 ACTAGACAGAAGGCAGTACTGGG - Intronic
987731551 5:21780112-21780134 ACTGGGTCATAGGCAGAACTGGG - Intronic
991297982 5:65101672-65101694 ACTAGGTCGGAGGCAGCACTCGG + Intergenic
1000311467 5:160049029-160049051 AGTAGGCAAAAACCAGGACTTGG + Intronic
1003483332 6:6553317-6553339 AATATGCCAAAGGCAAGAATGGG + Intergenic
1006555614 6:34863596-34863618 ACTAGGCACTAGGCAGGAGTGGG - Intronic
1006746446 6:36346139-36346161 ACCAGGCCAAATTGAGGACTAGG + Intergenic
1007026687 6:38583205-38583227 ACTAAGCCAAAGGCTGGGCACGG + Intronic
1010234334 6:73562571-73562593 ACTAGGCCAATGACAGGAATAGG - Intergenic
1011278771 6:85655998-85656020 AGTGGGCAAAAGGCAGGGCTGGG + Intergenic
1015596463 6:134872031-134872053 AATAGGCCAAAGGCCGGGCACGG - Intergenic
1015894906 6:138007824-138007846 GCTAACCCAAAGGCAGGACTGGG + Intergenic
1016858320 6:148694390-148694412 CCTAGGCGTAAGGCAGCACTTGG + Intergenic
1017060917 6:150484234-150484256 ATGGGGCCAAAGGCAGGACTGGG - Intergenic
1017064872 6:150519288-150519310 ACTGGGCCAACCGCATGACTTGG + Intergenic
1017242165 6:152182749-152182771 ACTATGCCTAAGGCTGGCCTTGG - Intronic
1019208578 6:170384732-170384754 AGCAGGCCAAAGGCCAGACTTGG - Intronic
1020576075 7:9929953-9929975 TATAGGCCAAAGGAAGGACCAGG + Intergenic
1021752747 7:23820242-23820264 ACTGGGCCAACTGTAGGACTTGG - Intronic
1022335859 7:29421333-29421355 AGTAGCCCAAAGGCAGGAAATGG - Intronic
1022520068 7:31000494-31000516 GCTGAGCCAGAGGCAGGACTAGG - Intergenic
1023834682 7:44061173-44061195 GCTTGGCCACAGGCAGGGCTTGG - Exonic
1025706005 7:63864761-63864783 AGAAGGCTAAAGGCAGGAATGGG + Intergenic
1026306071 7:69143033-69143055 ACTATGGAAAAGGCAAGACTTGG + Intergenic
1026764519 7:73151950-73151972 ACAAGGCTAAAGGCAAGATTTGG - Intergenic
1027040989 7:74961713-74961735 ACAAGGCTAAAGGCAAGATTTGG - Intergenic
1027082649 7:75240659-75240681 ACAAGGCTAAAGGCAAGATTTGG + Intergenic
1028024744 7:85822296-85822318 ACTTGGGCAAAGGCATCACTGGG + Intergenic
1028893054 7:96010160-96010182 ACTAGGTCAAAAGCAAGAATAGG + Intronic
1029187195 7:98747716-98747738 ACTAGGTCAAAGGCAGATGTGGG + Intergenic
1030236180 7:107265193-107265215 ACTTGACCAAAGGAAGGATTTGG + Intronic
1031093363 7:117389604-117389626 ACCAGGCCAAAGTCAGGATGAGG + Intronic
1033207623 7:139436458-139436480 ACTAGTCCCAAGGAAGGACTGGG - Intergenic
1037718389 8:21419342-21419364 ACTAGGCAAAGGGGAGGACTGGG - Intergenic
1038325039 8:26566686-26566708 ACGAGGCCTAAGACAGGACCTGG + Intronic
1040455363 8:47592620-47592642 ACTAGACCAGAGGCCGAACTCGG - Intronic
1041009640 8:53529358-53529380 ACGAGGCCAGAGGCAGGAGAAGG + Intergenic
1041023048 8:53657660-53657682 ACGAGGCCAAAGGCTGATCTGGG + Intergenic
1047275594 8:123402485-123402507 AGTAGGCCAGAGGCAGGGCCAGG - Intronic
1048440823 8:134457835-134457857 CCAAGGCCACAGGCAGGAGTGGG + Intergenic
1049752627 8:144292284-144292306 ATTAGGAGAAAGTCAGGACTTGG + Intronic
1050039569 9:1475251-1475273 ACTAGTCCAAAGGTACTACTGGG - Intergenic
1052955547 9:34250916-34250938 ACCAAGCCAAACGCAGGCCTCGG - Intronic
1053692479 9:40593241-40593263 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
1054272338 9:63044292-63044314 AGCAGGCCAAAGGCAGGGCCAGG + Intergenic
1054303721 9:63394159-63394181 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
1054402499 9:64720669-64720691 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
1054436109 9:65205000-65205022 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
1054494283 9:65816687-65816709 AGCAGGCCAAAGGCAGGGCCAGG + Intergenic
1057044240 9:91872565-91872587 ACCAGCCCCAAGGTAGGACTTGG - Intronic
1058594624 9:106602133-106602155 ACAAAGCCAAAGGCAGGACAAGG - Intergenic
1059806510 9:117806850-117806872 ACTAGACTAAAGGCAGGATTTGG - Intergenic
1060265437 9:122109155-122109177 ACCAGGCCAAAGCCAGGCCCAGG - Intergenic
1060269480 9:122130729-122130751 ACCAGGCCAGATGCAGAACTGGG - Intergenic
1060563937 9:124572140-124572162 ACGAGGCAAAAGGCAGAGCTGGG + Intronic
1061303289 9:129718475-129718497 ACTAGGCCAGAGGCTGTACTGGG - Intronic
1061722482 9:132561372-132561394 ACAAGGCAAAAGGGAGGATTTGG - Intronic
1061848415 9:133400852-133400874 AGCAGGCAAAAGGCAGGCCTGGG - Intronic
1062027084 9:134345511-134345533 CCAAGGCCACAGGCAGGACGGGG + Intronic
1203748996 Un_GL000218v1:61716-61738 ATTTGGCCCAAGGCAGGACAAGG + Intergenic
1203623129 Un_KI270749v1:139318-139340 AGCAGGCCAAAGGCAGGGCCAGG - Intergenic
1189291286 X:39887717-39887739 AGGAGGCCAAAGCCTGGACTAGG + Intergenic
1194274861 X:91866283-91866305 GCAAGGCCTAAGGCAGAACTGGG - Intronic
1195666306 X:107434142-107434164 CCTAGGACAAAGGCAGGACATGG + Intergenic
1198744599 X:139876929-139876951 TCTATGCCATATGCAGGACTGGG + Intronic
1200592103 Y:5087684-5087706 GCAAGGCCTAAGGCAGAACTGGG - Intronic
1201190244 Y:11438301-11438323 GCTAGGGCCAAGGCAGGACCAGG - Intergenic