ID: 1125968064

View in Genome Browser
Species Human (GRCh38)
Location 15:43890139-43890161
Sequence CTGTGTGTGTATGAGATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 2, 3: 78, 4: 565}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125968064_1125968067 28 Left 1125968064 15:43890139-43890161 CCATCAATCTCATACACACACAG 0: 1
1: 0
2: 2
3: 78
4: 565
Right 1125968067 15:43890190-43890212 GACAAGCACACAGATCACCTAGG 0: 1
1: 0
2: 4
3: 38
4: 435
1125968064_1125968065 -5 Left 1125968064 15:43890139-43890161 CCATCAATCTCATACACACACAG 0: 1
1: 0
2: 2
3: 78
4: 565
Right 1125968065 15:43890157-43890179 CACAGTACAATAATGCCAATTGG 0: 1
1: 0
2: 0
3: 4
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125968064 Original CRISPR CTGTGTGTGTATGAGATTGA TGG (reversed) Intronic
900293791 1:1938455-1938477 CTGTGTGTGTGTGAGCCTGTGGG - Intronic
900828497 1:4946159-4946181 ATGTGTGTGCATGGGAGTGAGGG + Intergenic
901293692 1:8144595-8144617 GTGTGTGTGTGTGAGATGGATGG + Intergenic
902951260 1:19884381-19884403 CTGTGTGTGTATGGGGGTGTGGG - Intronic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903184440 1:21621408-21621430 CTGTGTGTGTGTGCGGGTGAGGG - Intronic
903752791 1:25638171-25638193 CTGTGTGTGTATGCGTATAACGG - Intronic
904196212 1:28787576-28787598 GTGTGTGTGTGTGAGATACAGGG - Intergenic
905032305 1:34894309-34894331 CTGTTTGTGTTTCAGATTTAAGG - Intronic
905127923 1:35728915-35728937 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
905232025 1:36520505-36520527 CTGTGTGTGTATGTGTGTTAGGG + Intergenic
905593385 1:39184750-39184772 CTGTGTGATTATGAGGTTGGAGG + Intronic
905733900 1:40313570-40313592 CAGGGTGTGGATGAGTTTGAAGG + Intronic
906143206 1:43545799-43545821 CTGTGTGTGTTTGTGTTGGAGGG + Intronic
906237434 1:44220422-44220444 CTGTGCGAGTCTGAGACTGAGGG + Intronic
907325101 1:53632678-53632700 ATGAGTGTGAATGAGACTGAGGG + Intronic
908237969 1:62165739-62165761 ATGTGTGTGTGTGTGTTTGACGG + Intergenic
908653058 1:66357653-66357675 CAGTGGGTGTATGTGTTTGAGGG + Intronic
908999760 1:70204720-70204742 GTGTGTGTGTAAGAGAGAGAGGG - Intronic
909497414 1:76293854-76293876 GTGTGTGTGTATGTGTGTGAGGG + Intronic
911161633 1:94687529-94687551 CTGTGTGTGTATAAAATACAAGG + Intergenic
911284024 1:95967960-95967982 CTGAATGTGTATGAAAATGAGGG + Intergenic
911556367 1:99349882-99349904 CTATGTGTCAATGAGATTGTCGG + Intergenic
912423248 1:109562429-109562451 GTGTGTGTGTATAAAATTTAGGG + Intronic
912465031 1:109866531-109866553 CTGTGTGTGTATGGGGATGGGGG + Intergenic
914004360 1:143719555-143719577 GTGTGTGTGTATGAGAGACAGGG - Intergenic
914902700 1:151719907-151719929 CTGTGTGTGTTTGAGTGTGTAGG + Intronic
914972334 1:152319326-152319348 GTGTGTGTGTGTGTGTTTGAAGG + Intronic
915788879 1:158646110-158646132 CTGTGTGTGTATGTGTATGTTGG - Intronic
916111164 1:161459244-161459266 CTGAGTGTGTGTGTGAGTGAAGG - Intergenic
916876241 1:168972691-168972713 GTGTGTGTGTTTGAGAGAGAGGG - Intergenic
916897559 1:169181352-169181374 GTGTGTGTGTAGGAATTTGAGGG - Intronic
917606743 1:176638962-176638984 GTGTGTGTGTATGTGTTTGTAGG + Intronic
918003151 1:180517146-180517168 CTGTGTGTGTGTGTGTGTGATGG - Intergenic
918537878 1:185594456-185594478 GTGTGTGTGTATGTGTTTTAAGG - Intergenic
919768887 1:201144567-201144589 CTGTGTATGTAAGAGATTCGTGG - Intronic
920442974 1:205993805-205993827 CTGTGTGTGTAGGACATGGGAGG + Intronic
920814246 1:209316018-209316040 CTGTGTGTGTATGTGTTTTATGG + Intergenic
921109992 1:212026458-212026480 TTGTGTGTGTAAGAGGGTGAAGG - Intronic
921796019 1:219345875-219345897 GTGTGTGAGTATCACATTGAGGG - Intergenic
922581508 1:226701960-226701982 CTGTGTGTGCATGGGACTTAGGG - Intronic
923225485 1:231935275-231935297 CTTTGTATATATGAGATTGTTGG - Intronic
1063518862 10:6722840-6722862 GTGTGTGTGTGTGTGGTTGAGGG + Intergenic
1063545351 10:6975929-6975951 GTGTGTGTGTGTGTGTTTGAGGG - Intergenic
1063893908 10:10659195-10659217 CTGTTTCTTTATGAAATTGAGGG - Intergenic
1063934247 10:11060674-11060696 CTGTGTCTGTCTGAAATTGTCGG + Intronic
1064162794 10:12960335-12960357 CTGTGTGTGTTTGGGAGAGATGG + Intronic
1064297925 10:14095036-14095058 ATGTGTGTGTATGAACATGAAGG + Intronic
1064784534 10:18879319-18879341 ATGTTTTTGGATGAGATTGATGG + Intergenic
1066020302 10:31292611-31292633 CTCTGTGTGTATGCCATTGTGGG - Intergenic
1066198220 10:33122379-33122401 CTGTTTGTTTATGAGATTTCAGG + Intergenic
1066374240 10:34843223-34843245 GTGTGTGTGTATGTGTGTGATGG + Intergenic
1068004025 10:51371414-51371436 CTGTGTGTGTGTGAGTCTGAGGG + Intronic
1069655885 10:70088133-70088155 CTGTGTGTGTGTGAGTGTGCAGG - Intronic
1069655888 10:70088190-70088212 CTGTGTGTGTGTGAGTGTGCAGG - Intronic
1069655891 10:70088247-70088269 CTGTGTGTGTGTGAGTGTGCAGG - Intronic
1070123539 10:73601453-73601475 GTGTGTGAGTATCAGGTTGAAGG - Intronic
1070354052 10:75621753-75621775 CTTTGACTGTATTAGATTGAGGG + Intronic
1070663965 10:78330451-78330473 ATGTGTATGTTTAAGATTGAGGG - Intergenic
1072044413 10:91640236-91640258 GTGTGTGTGTGTGTGAGTGAGGG - Intergenic
1073488404 10:103836535-103836557 GTGTCTGTATATGAGTTTGAAGG - Intronic
1073660505 10:105470892-105470914 GTGTGTGTGTGTAAGATTCAGGG - Intergenic
1073753178 10:106552755-106552777 ATGTGTGTGTTTGAGAGTGGAGG - Intergenic
1074247330 10:111708081-111708103 ATGTCTCTGTATGAGATTGTTGG + Intergenic
1074913654 10:117935636-117935658 CTGTGTGTGTAAGGGACAGAGGG - Intergenic
1076014551 10:127017216-127017238 CTGTGTGTGTCTGTGTTTAATGG - Intronic
1076405209 10:130207497-130207519 GTGTGTGTGTGTGAGATTGTGGG - Intergenic
1076405241 10:130207802-130207824 TTGTGTGTGTGTGAGATGGTGGG - Intergenic
1078476944 11:11638647-11638669 GTGTGTGTGTGTGAGAGAGAGGG - Intergenic
1078535015 11:12165951-12165973 CTGTGTTTGGATAAGAATGAGGG + Intronic
1078831967 11:14986157-14986179 TTTTGTGTGTATGAGTTTGTTGG + Intronic
1079449145 11:20584341-20584363 CAGTATGTGTCTGAGATTAAGGG - Intergenic
1079646789 11:22873218-22873240 CTGTATGTGTATGAGTTTACAGG + Intergenic
1080305309 11:30828705-30828727 GTGTGTGTGTATGTGGTGGAGGG - Intergenic
1081107522 11:39088969-39088991 GTGTGTGTGTATAAGAAAGAGGG - Intergenic
1081467258 11:43332679-43332701 GTGTGTGTATATGAGAGTGAGGG - Intronic
1081775339 11:45672230-45672252 GTGTGTGTGTAAGAGACAGAGGG + Intergenic
1083072389 11:59998859-59998881 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1083202842 11:61130906-61130928 CTGCTTGTGAATGAGATTCAAGG + Exonic
1084702712 11:70797820-70797842 GTGTGTGTGTATGAGAGTGGAGG - Intronic
1084708507 11:70829795-70829817 AGGTGTGTGCATGAGACTGATGG - Intronic
1085055957 11:73403944-73403966 CTGTGTGGGGATCAGATGGAGGG + Intronic
1085539904 11:77257540-77257562 GTGTGTGTGTAGGAGAGGGAGGG - Intronic
1085690678 11:78661479-78661501 CTGTGTGTGGATGAGCTCGTAGG + Exonic
1085820553 11:79788608-79788630 CAGTGTGTGTAAAAGATTTAGGG - Intergenic
1087017749 11:93571151-93571173 CTTTGAGTGAATGAGATTCAAGG - Intergenic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1087914598 11:103795391-103795413 CTGTGTGTGCGTGAGAGCGAGGG - Intergenic
1089398092 11:118148886-118148908 GTGTGTGTGTGTGAGAGTGGGGG + Intronic
1090654006 11:128828759-128828781 CAATGTGTGTCCGAGATTGAAGG + Intergenic
1090743252 11:129685962-129685984 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1091150762 11:133326464-133326486 GTGTGTGTGTATGTGTATGAGGG + Intronic
1091196966 11:133739323-133739345 GTGTGTGTGTATGTGAGTGTGGG + Intergenic
1092756199 12:11765852-11765874 AAGTTTGTGTATGAGACTGAGGG + Intronic
1095795430 12:46213854-46213876 ATGTGTGTGTTTGATGTTGAAGG - Intronic
1095921859 12:47539831-47539853 CTGTGTTTATGTGAGACTGAGGG - Intergenic
1096477863 12:51919395-51919417 GTGTGTGTGTTTGAGAGTCAGGG + Intronic
1096539883 12:52301088-52301110 GTGTGTGTGTGTGAGATGGTGGG + Intronic
1096668618 12:53184187-53184209 GTGTGTGTGTGTGTGAGTGACGG + Intronic
1096688848 12:53307160-53307182 CTGGGTCAGTATGAGATGGAAGG - Intronic
1096819846 12:54225442-54225464 CTGTGTGTATATAAGTTGGAAGG - Intergenic
1097636072 12:62123678-62123700 GTGTGTGTGTGTGAGAGAGAGGG - Intronic
1097906867 12:64929863-64929885 GTGTGTGTGTGTGTGTTTGATGG + Intergenic
1097995927 12:65888007-65888029 GTGTGTGTGTATGAGAGAGATGG - Intronic
1098314551 12:69179577-69179599 GTGTGTGTGTGTGTGTTTGAAGG - Intergenic
1098785651 12:74750883-74750905 CTGTGTGTTTTTCAAATTGAAGG + Intergenic
1099307523 12:80976434-80976456 GTGTGTGTGTGTGAGAGAGAGGG + Intronic
1099448733 12:82783312-82783334 GTGTGTGTGTCTGAGAGAGAGGG + Intronic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1100500752 12:95171871-95171893 CAGTGTGTGTATGAGTTTGGGGG - Intronic
1100644459 12:96514415-96514437 CTGAGTGTGAATTAAATTGAGGG + Intronic
1100942697 12:99741200-99741222 GTGTGTGTGTGTGTGTTTGACGG - Intronic
1102014456 12:109638616-109638638 ATGTGTGTGTATGGGATGGGAGG + Intergenic
1102483679 12:113241796-113241818 GTGTGTGTGTATGAGACAGCAGG + Intronic
1102842165 12:116136444-116136466 GTGTGTGTGTATGAGAGAGAGGG + Intronic
1103851813 12:123938338-123938360 GTGTGTGTGTGTGAGAGAGACGG - Intronic
1104607005 12:130197211-130197233 CTCTGTGTGTGTGAGAGTGAGGG + Intergenic
1105273635 13:18901184-18901206 GTGTGTGTGTGTGAGAGAGATGG - Intergenic
1105765820 13:23558164-23558186 TTGTATGTGTATGTGTTTGAGGG + Intergenic
1106134725 13:26965535-26965557 GTGTGTGTGTGTGAGAGAGATGG - Intergenic
1106318771 13:28618920-28618942 CTCTGTGTGTGTGAGAGAGAAGG - Intergenic
1106331475 13:28743500-28743522 GTGTGTGTGTGTGAGATACAGGG + Intergenic
1107057652 13:36124527-36124549 CAGTGTATGTATGTGATTCAAGG - Intronic
1107724492 13:43284804-43284826 GTGTGTGTGTAAGAGAGAGAGGG + Intronic
1107796260 13:44055187-44055209 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1107855361 13:44610315-44610337 ATATGTGTGTATGAGAGAGAGGG + Intergenic
1108106976 13:47021147-47021169 CTGTGTGTGTCTGATATTCTTGG + Intergenic
1108209613 13:48124988-48125010 GTGTGTGTGTTTGTGAGTGATGG - Intergenic
1108529449 13:51315307-51315329 GTGTGTGTGTAGGGGGTTGAGGG - Intergenic
1108784748 13:53883143-53883165 GTGTGTGTGTTTGAGAAAGAGGG - Intergenic
1109220405 13:59635828-59635850 CTGTGTGGGTAAGTGGTTGATGG - Intergenic
1109755549 13:66754453-66754475 GTGTGTGTGTGTGACATTGTAGG + Intronic
1111548061 13:89770026-89770048 CTGTGTGTGTTTGTGGATGATGG - Intergenic
1111603033 13:90498539-90498561 GTGTGTGTGTGTGAGAGAGAGGG - Intergenic
1111695593 13:91619632-91619654 CTGTGTGTGTGTGACATTCATGG - Intronic
1111827455 13:93285654-93285676 GTGTGTGTGTATGTGTTTGGTGG + Intronic
1112717761 13:102206122-102206144 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
1112766173 13:102746555-102746577 CTGACTGTCTCTGAGATTGATGG + Exonic
1113014784 13:105816790-105816812 TTGTGTGAGTATGAGATAGCTGG + Intergenic
1113065418 13:106369039-106369061 CTGTGTGTGCATGAGTTTGTGGG - Intergenic
1113221229 13:108104927-108104949 GTGTGTGTGTGTGTGATTGAAGG - Intergenic
1113235791 13:108271437-108271459 GTGTGTGTGTGTGTGATAGAAGG - Intronic
1114168460 14:20246435-20246457 CTGTGTCTTTATGTGGTTGAAGG - Intergenic
1114415477 14:22540169-22540191 CTGTGAGTGTATGAGGGTCATGG + Intergenic
1114666379 14:24379679-24379701 TTGTGTGTGTGTGAGAGAGAGGG + Intergenic
1114788302 14:25626268-25626290 CTGTGTGTGTATGTGTGTGTTGG + Intergenic
1114928878 14:27442317-27442339 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1115368777 14:32588532-32588554 TTGTGTGTGTATGAGTTTTGAGG + Intronic
1115762586 14:36590207-36590229 GTGTGTGTGTATGTGATTTTGGG + Intergenic
1117208733 14:53472852-53472874 CTCTGTCTGTATCAGTTTGAAGG + Intergenic
1118373626 14:65158305-65158327 GTGTGTGTGTGTGAGATGGTAGG + Intergenic
1118482346 14:66179861-66179883 CTGTGTCTGGATGACATTGCTGG - Intergenic
1118507171 14:66426174-66426196 CTGAGTGTGTATTAAATTGCTGG - Intergenic
1118857926 14:69638462-69638484 TTGTGTGTGTGTGGGATTGAAGG + Intronic
1118906404 14:70026929-70026951 ATGTGTGTGTATGAGTGTGATGG + Intronic
1119327673 14:73771053-73771075 CTGTGTGTGTGTGTGTTTGGAGG - Intronic
1119366943 14:74100993-74101015 TTGTGTGTGTTTAAGATTGGGGG + Intronic
1119580255 14:75772585-75772607 GTGTGTGTGAATCAGAATGATGG + Intronic
1119624407 14:76159756-76159778 CTGTGTGTATTTGTGTTTGAGGG - Intronic
1120131406 14:80811695-80811717 GTGTGTGTGTTTGAGAGTGTGGG + Intronic
1120313514 14:82861777-82861799 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1120747774 14:88167314-88167336 CTGTGTGTGTATGTGTGTGTGGG - Intergenic
1120945245 14:89988430-89988452 CTGTATGTTAATGAGACTGATGG - Intronic
1120964527 14:90155756-90155778 CTGTGGGTGGATCAGATTGGAGG + Intronic
1121031079 14:90659258-90659280 GTGTGTGTGTTTGAGAGAGAGGG + Intronic
1121569766 14:94938873-94938895 GTGTGTGTGTGTGTGGTTGATGG + Intergenic
1122216173 14:100206105-100206127 CTGTGTGTGTGTGTGATCCATGG + Intergenic
1122725487 14:103748054-103748076 GTGTGTGTGTATGTGATTTAAGG - Intronic
1123079103 14:105683110-105683132 GTGTGGGTGTGTGAGAGTGAGGG + Intergenic
1202846031 14_GL000009v2_random:176690-176712 GTGTGTGTGTATGAAATTGTAGG + Intergenic
1202915489 14_GL000194v1_random:167294-167316 GTGTGTGTGTATGAAATTGTAGG + Intergenic
1202877248 14_KI270722v1_random:15758-15780 GTGTGTGTGTATGAAATTGTAGG - Intergenic
1123989043 15:25669702-25669724 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1124807613 15:32901740-32901762 GTGTGTGTGTATGAGAGAGAGGG - Intronic
1124870980 15:33542285-33542307 CTGTGTGAGTAGGATATTGATGG + Intronic
1124912281 15:33933484-33933506 GTGTGTGTGTGTGTGATTGTTGG - Intronic
1124968735 15:34462996-34463018 TTGTGTGTGTATGTGTGTGACGG - Intergenic
1125029602 15:35063083-35063105 GTGTGTGTGTATGTGTGTGACGG + Intergenic
1125444970 15:39744770-39744792 GTGTGTGTGTGTGTGACTGAGGG - Intronic
1125968064 15:43890139-43890161 CTGTGTGTGTATGAGATTGATGG - Intronic
1126946371 15:53825498-53825520 CAGTGTGTGCTTGACATTGATGG + Intergenic
1127976683 15:64002705-64002727 GTATCTGTGTGTGAGATTGATGG - Intronic
1128037843 15:64542112-64542134 GTGTGTGTGTGTGAGAGAGATGG - Intronic
1128241755 15:66106048-66106070 CATTGTGGGAATGAGATTGATGG + Intronic
1128430608 15:67589809-67589831 GTGTGTGTATAAGAGATAGATGG + Intronic
1128703947 15:69824861-69824883 CTGTGTGTGTACTAGCTTCATGG + Intergenic
1128836505 15:70813156-70813178 CTGTGTGTGTATGCGCATGCAGG - Intergenic
1129166494 15:73781177-73781199 CTGTGTGAGGCTGACATTGATGG - Intergenic
1129856010 15:78825785-78825807 GTGTGTGTGTGTGTGTTTGATGG - Intronic
1130261430 15:82356975-82356997 TTGTGTGTGTGTGTGATTGTGGG + Intergenic
1130279806 15:82512036-82512058 TTGTGTGTGTGTGTGATTGTGGG - Intergenic
1130336310 15:82959832-82959854 CTGGGCTTGTATGAGATTTAGGG + Intronic
1130471180 15:84228222-84228244 TTGTGTGTGTGTGTGATTGTGGG - Intergenic
1130478674 15:84342792-84342814 TTGTGTGTGTGTGTGATTGTGGG - Intergenic
1130493096 15:84445339-84445361 TTGTGTGTGTGTGTGATTGTGGG + Intergenic
1130535497 15:84782567-84782589 CTGTGTGTGCATTAGTTTGATGG + Intronic
1130593474 15:85232859-85232881 TTGTGTGTGTGTGTGATTGTGGG - Intergenic
1130758330 15:86790337-86790359 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
1132092879 15:98959994-98960016 GTGTGTGTGTGTGAGAGTGATGG + Exonic
1132242785 15:100272584-100272606 CTCTGTGTGTGTAAGATTTAGGG + Intronic
1132746803 16:1439581-1439603 CTTTGCGTGTATGAGATGCAGGG - Intronic
1134832200 16:17332555-17332577 GTGTGTGTGTATGTGTGTGATGG - Intronic
1135294700 16:21269267-21269289 ATGTGTGTGTATGAAAGGGATGG - Intronic
1137731345 16:50693041-50693063 GTGTGTGTGTATGTGAGTGTTGG + Intergenic
1137990722 16:53151980-53152002 GTGTGTGTGTGTGTGATTGTGGG + Intronic
1138329038 16:56198313-56198335 CTGTGTGTGAATGAGAGGGATGG - Intronic
1138586456 16:57973425-57973447 GTGTGTGTGTGTGAGACTTAGGG + Intergenic
1138885891 16:61079047-61079069 GTGTGTGTGGATGACATTCAAGG - Intergenic
1139184240 16:64786488-64786510 CTGTGTGTGTATGAAAGACAAGG - Intergenic
1139834968 16:69830861-69830883 CTGTGTGTGTCTGAGTTTCAGGG + Intronic
1140209898 16:72961543-72961565 CTGAGTGTGAATGAGATGGTGGG - Intronic
1140895247 16:79318944-79318966 GTGTGTGTGTGTGAGTTTCATGG - Intergenic
1141091861 16:81135862-81135884 GTGTGTGTGTAAGAGAGAGATGG - Intergenic
1142521939 17:510969-510991 CGGTGTGGGTATGAGGTTGTGGG + Exonic
1143442344 17:6984949-6984971 GTGTGTGTGTATGATTTTGATGG - Intronic
1144207840 17:12991687-12991709 CGGTGTGCATTTGAGATTGACGG - Intergenic
1146225591 17:31063199-31063221 CTCTGTGTGTGTGTGTTTGATGG + Intergenic
1146529747 17:33598472-33598494 GTGAGTGTGCATGAAATTGAAGG + Intronic
1146581672 17:34044093-34044115 GTGTGTGTGTGTGTGATTCAAGG - Intronic
1146933570 17:36795367-36795389 CTGTGGGTGGATGATAATGATGG - Intergenic
1147405073 17:40205611-40205633 GTGTGTGTGTATGTGTGTGATGG - Intergenic
1147678250 17:42222200-42222222 CTGTGTGTGTGTGTGTTTGGAGG + Intronic
1147709655 17:42453652-42453674 CTGTGAGTGTTTAAGATTAAAGG - Intergenic
1148033164 17:44636810-44636832 CTCTGTGTGTGTGTGACTGAAGG + Intergenic
1149313465 17:55418498-55418520 TTGTGTGTGTGTGAGATTCGGGG - Intronic
1150314258 17:64155563-64155585 GTGTGTGTGTATGTGGTTGTTGG - Intronic
1150457702 17:65320843-65320865 CTGTGTGTGGCTGACATTGTTGG + Intergenic
1150996749 17:70327142-70327164 GTGTGTGTGTATGAGTTTCTGGG + Intergenic
1151388712 17:73771263-73771285 GTGTGTGTGTATGTGTTTGTAGG + Intergenic
1151613994 17:75196173-75196195 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1151924207 17:77182054-77182076 CTGTGTATAAATGAGTTTGAGGG + Intronic
1152532406 17:80926728-80926750 CTGTGTCTGTATGAGAAGCACGG - Intronic
1152857128 17:82671680-82671702 GTGTGTGTGTTTTAGAGTGACGG - Intronic
1152857153 17:82671843-82671865 GTGTGTGTGTTTTAGAGTGACGG - Intronic
1152928458 17:83098562-83098584 CTCTGTGTGTGTGAGAGAGAGGG + Intergenic
1153073258 18:1131526-1131548 CTGTGTGTGTAGGAGGATGGAGG + Intergenic
1155234691 18:23807490-23807512 CTGTGTGTGTATGTGTGTGTAGG + Intronic
1155255396 18:23992920-23992942 CTGTGTGTGTAGGTGCTGGAGGG - Intronic
1155802927 18:30131717-30131739 GTGTGTGTGTATAAAATTGTGGG + Intergenic
1157041454 18:44044425-44044447 TTGTGTGTGTATGTGCGTGATGG - Intergenic
1157380686 18:47212957-47212979 TTGTGTGTGTAAGAGAGAGAAGG - Intronic
1158331967 18:56372530-56372552 GTGTGTGTGTATGAGAGAGAGGG - Intergenic
1159324395 18:66895542-66895564 CTGTGTGTGTGTGAGAGAGAGGG + Intergenic
1159949280 18:74468645-74468667 CTCTGTGTGGAGGAGATGGAGGG + Intergenic
1160157462 18:76444446-76444468 CTTAGTGTGTGTGAGATTGTAGG - Intronic
1160623349 18:80186545-80186567 CTGTGTGTGCATGTGTGTGAGGG - Intronic
1161897890 19:7096402-7096424 TTGTGTTTGTAAGTGATTGAGGG - Intergenic
1162396323 19:10419883-10419905 CTGTGTGTGTCTGTGGGTGAAGG - Intronic
1162775415 19:12975902-12975924 CTGTGTGTCTAGGAGTTTGGTGG + Intergenic
1164024483 19:21338751-21338773 TTGTGGGTTTATGAGAATGAGGG - Intergenic
1164227302 19:23257141-23257163 GTGTGTGTGTGTGAGATTCAGGG + Intergenic
1164257434 19:23541150-23541172 CTGTGTCTGTGTGAAATTCAGGG + Intronic
1164294531 19:23898088-23898110 CTGTGTCTGTGTGAAATTCAGGG - Intergenic
1164565102 19:29320172-29320194 CTGTGTGTGTATGTGTGTGTGGG - Intergenic
1164999083 19:32745802-32745824 GTGTGTGTGTGTGAGAGAGAAGG + Intronic
1165639470 19:37371869-37371891 GTGTGTATATATGAGATTGTGGG + Intronic
1165968762 19:39607320-39607342 CAGTGTGTGTCTGCAATTGAGGG + Exonic
1167312993 19:48747913-48747935 GTGTGTGTGTAAGAGAGTGGAGG - Intergenic
1167559059 19:50214622-50214644 CTGTGTGTGAATTTGAATGAAGG - Intronic
1168231419 19:55034706-55034728 GTGTGTGTGTGTAAGAATGAGGG - Intronic
1168308604 19:55450033-55450055 TTGTGTGTGTTTGAGAGAGAAGG + Intergenic
1168477624 19:56688575-56688597 GTGTGTGTGTGTGTGATTGAAGG + Intergenic
1168482952 19:56736900-56736922 GTGTGTGTGTGTGTGATTGAAGG + Intergenic
925056112 2:858631-858653 CTGTGTGTGTGTGTGTGTGAAGG + Intergenic
925503397 2:4532414-4532436 GTGTGTGTGTGTGAGAGAGATGG + Intergenic
926591693 2:14746761-14746783 GTGTGTGTGTATGAGAGTGTAGG - Intergenic
926617279 2:15009591-15009613 GTGTGTGTGTATGATGTTGCAGG - Intergenic
927054109 2:19354380-19354402 GTGTGTGTGTGTGAGATTCAGGG - Intronic
927064066 2:19452195-19452217 ATGTATGTGTATGAGAATGTGGG - Intergenic
927100454 2:19783883-19783905 GTGTGTGTGTGTGTGTTTGAAGG - Intergenic
928193780 2:29197722-29197744 CTGTGTGTGTGTGTGAATGTGGG - Intronic
928564264 2:32527633-32527655 CTGTGTGTGTGTGACTTTGAAGG + Intronic
928611971 2:32999860-32999882 GTGTGTGTGTGAGAGATCGAGGG + Intronic
928877082 2:36052624-36052646 CAATGTCTGTATGAGATTGATGG - Intergenic
929901873 2:46011757-46011779 ATGTGTGTGTAAGAGAGAGATGG - Intronic
930371056 2:50501618-50501640 CTGTGTGTGTATGTCCTTTATGG - Intronic
930589600 2:53311775-53311797 GTGTGTGTGTATGAGAGAGAAGG - Intergenic
930880921 2:56269347-56269369 GTGTGTGTGTGTGTGTTTGAAGG + Intronic
930931584 2:56890333-56890355 GTGTGTGTATATGAGATTGCTGG + Intergenic
931093378 2:58911878-58911900 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
931168382 2:59775987-59776009 GTGTGTGTGTGTGTGTTTGAGGG - Intergenic
931798915 2:65739795-65739817 CTGTGTTTGTATGTGATTTAAGG + Intergenic
931901546 2:66794717-66794739 GTGTGTGTGTATGTGCTTGAGGG + Intergenic
931991668 2:67796683-67796705 GTGTGTGTGTATGTGCGTGATGG - Intergenic
932163869 2:69488164-69488186 GTGTGTGTGTGTGTGTTTGAGGG + Intronic
932360624 2:71102622-71102644 ATGTGTTTGTATGTGCTTGATGG - Intergenic
932834722 2:75025637-75025659 CTGTGTTTATGTGAGATAGAGGG + Intergenic
933135914 2:78735028-78735050 ATATATGTGTATGAGATAGAAGG - Intergenic
933216014 2:79630771-79630793 ATGTGTGTGTCTGGAATTGATGG - Intronic
933429532 2:82157872-82157894 GTGTGTGTGTATGTGTCTGAAGG - Intergenic
933438988 2:82285587-82285609 GTGTGTGTGTGTGAGCTTAATGG + Intergenic
933620832 2:84539305-84539327 TTGTGTGTGCATGTGTTTGAAGG - Intronic
933819175 2:86094192-86094214 ATGTGTGTGTATGGGAGGGAGGG + Intronic
934607200 2:95705276-95705298 GTGTGTGTGTGTGAGAAGGATGG - Intergenic
935344667 2:102095212-102095234 CTGTGTGTATGTGATAGTGATGG + Intronic
935470015 2:103447741-103447763 CTGTGTGTCTCAGAAATTGATGG - Intergenic
935521563 2:104112354-104112376 CTGTGTGTGTGTAATATTTAGGG + Intergenic
936062041 2:109301292-109301314 CTGTGTGTGTATGTGGTGGGGGG + Intronic
936239834 2:110777786-110777808 CTGTGTGTATGTGGGGTTGAGGG + Intronic
936468669 2:112777445-112777467 TTGTGTGTGTGTGTGTTTGAGGG + Intronic
936771043 2:115913762-115913784 GTGTGTGTGTTTGAGAATGAGGG + Intergenic
937076031 2:119107590-119107612 GTGTGTGTGTGTGTGTTTGAAGG + Intergenic
937237112 2:120437673-120437695 CTCTGTGTGTGGGGGATTGAAGG - Intergenic
937485316 2:122309210-122309232 CTGTGTGTGTTTGTGGGTGAGGG - Intergenic
939415167 2:141886921-141886943 GTGTGTGTGTATGTGTGTGAGGG + Intronic
939860075 2:147409336-147409358 GTCTGTGTGTATGTTATTGATGG - Intergenic
940009187 2:149037437-149037459 GTGTGTGTGTGTGTGAGTGAAGG + Intergenic
941079187 2:161040704-161040726 CTGTGTGTGTGTGTGTTTGGAGG + Intergenic
941624716 2:167818701-167818723 CTGTGTGAGGAGGAGATTCAAGG - Intergenic
942311921 2:174664128-174664150 GTGTGTGTGTGTGAGAGAGAGGG - Intronic
942706039 2:178773725-178773747 TTGTGTGTGTATGATTTTGCAGG - Exonic
943225002 2:185161574-185161596 ATGTGTGTGGATGAGAGGGAGGG + Intergenic
944185260 2:196940889-196940911 GTGTGTGTGTGTGAGTTTGTTGG - Intergenic
944355199 2:198779098-198779120 CTGTGGCTCTATGGGATTGACGG - Intergenic
945812662 2:214567535-214567557 GTGTGTGTGTATGTGGATGAAGG - Intronic
945897894 2:215505083-215505105 TTGTCTGTGGATGAGATAGAAGG - Intergenic
946182421 2:217956639-217956661 CTGTGTGTGTGTGAGTGTGTGGG - Intronic
946673906 2:222136713-222136735 GTGTGTGTGTGTGTGATGGAGGG + Intergenic
946739134 2:222784849-222784871 CTGTGTGTGTGTTAGAGGGAAGG - Intergenic
947017860 2:225641416-225641438 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
948482592 2:238259552-238259574 TTGTGTGTGTGTGTGAGTGAAGG + Intronic
1169523659 20:6400099-6400121 GTGTGTGTATGTGAAATTGAAGG + Intergenic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1171266229 20:23774223-23774245 CTGTGTGTGCATGAAACTGGTGG - Intergenic
1171275983 20:23856870-23856892 CTGTGTGTGCATGAAACTGATGG - Intergenic
1171290505 20:23980321-23980343 TTGTGTGTGTATGAGTGTGTGGG - Intergenic
1171447028 20:25212190-25212212 CAGTGTGTGCATGAAAGTGAAGG - Intronic
1172050143 20:32110714-32110736 CTGTGTGTGGATGAGGGTGGAGG + Intronic
1172256319 20:33520931-33520953 GTGTGTGTGTATGTGATGGCAGG - Intronic
1173171183 20:40725193-40725215 CTGTGTTTGTGTGCGAGTGAAGG + Intergenic
1173522691 20:43711420-43711442 CTGTGTGTGTGTGGGACTGTGGG - Intronic
1174018505 20:47509449-47509471 GTGTGTGTGTGTGAGAGAGAGGG + Intronic
1174372173 20:50098394-50098416 CTGTGTGAGGATGAGAGTGAAGG + Intronic
1174654627 20:52160374-52160396 CTGTGTGTGTATGTGTTTGAAGG - Exonic
1174657807 20:52186237-52186259 CTGTGTGTGTAGGTGTTTGTGGG + Intronic
1174998562 20:55600357-55600379 GTGTGTGTGTTTCAGGTTGAGGG - Intergenic
1175932745 20:62500419-62500441 CTGTGTGTCCATGAGTGTGAGGG + Intergenic
1176049728 20:63112108-63112130 GTGTGCGTGTGTGAGATAGAGGG + Intergenic
1176634841 21:9181942-9181964 GTGTGTGTGTATGAAATTGTAGG + Intergenic
1176638522 21:9273202-9273224 GTGTGTGTGTATGAAATTGTAGG - Intergenic
1177240488 21:18449852-18449874 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
1178429616 21:32507628-32507650 CTGTGTGTGCATGGGTTTGCAGG + Intronic
1178476515 21:32942083-32942105 CCGTGTGTGTGCGAGATGGAGGG - Intergenic
1178727120 21:35063452-35063474 GTGTGTGTGTCTGAGTTTGTGGG - Intronic
1179393201 21:41012388-41012410 CTGTGTGTGTGTGAGCGTGAGGG - Intergenic
1179467330 21:41585075-41585097 CGGTGTGTGTATGTGTGTGAGGG - Intergenic
1179646619 21:42779857-42779879 GTGTGTGTGTGTGAGCTTGGCGG - Intergenic
1180370446 22:12030213-12030235 GTGTGTGTGTATGATATTGTAGG + Intergenic
1180371827 22:12046037-12046059 GTGTGTGTGTATGAAATTGTAGG - Intergenic
1180422564 22:12880699-12880721 GTGTGTGTGTATGAAATTGTAGG - Intergenic
1181868183 22:25876036-25876058 GTGTGTGTGTATGTGTTTTAAGG + Intronic
1182494446 22:30695921-30695943 CATTGTGTGTTTGGGATTGAGGG + Intronic
1182733787 22:32516157-32516179 CTGTGTGTGTGAGAAAATGAGGG + Intronic
1182931814 22:34181572-34181594 GTGTGTGTGTATGCGTGTGATGG + Intergenic
1184320424 22:43738357-43738379 ATATATGTGTATGTGATTGATGG - Intronic
1184426766 22:44413527-44413549 CTGTTTGTTTTTGATATTGAAGG + Intergenic
1184442858 22:44529029-44529051 GTGTGTGTGTGAGAGATTGCGGG - Intergenic
1184608616 22:45588498-45588520 CTGTGTGTGTATAAGAAGCAAGG - Intronic
1184679722 22:46063798-46063820 CTATGTGTGTATGAGTATGAAGG + Intronic
950325635 3:12107021-12107043 GTGTGTGTGTGTGTGTTTGAGGG + Intronic
950485971 3:13274169-13274191 ATGTTTGTGGATGAGATTCACGG - Intergenic
950545700 3:13636788-13636810 ATGTGTGTGTATGAGGAAGAGGG - Intronic
953364727 3:42334091-42334113 CTGTGTGTGTATGTTTATGAAGG - Intergenic
954334563 3:49908809-49908831 CAGTGTCTGTATGTGAGTGAGGG + Intronic
954954756 3:54509303-54509325 GTGTGTGTGTTTGAGAGAGAGGG + Intronic
954968459 3:54631197-54631219 GTGTGTGTGTGTGTGTTTGATGG - Intronic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
955847806 3:63185490-63185512 GTGTGTGTGTGTGTGAGTGAAGG - Intergenic
956105184 3:65809991-65810013 GTGTGTGTGTGTGAGAGAGAGGG - Intronic
956105847 3:65818121-65818143 TTGTGTGTGTATGTGTTTTAAGG - Intronic
956289093 3:67642940-67642962 GTGTGTGTGTGTGAGAGAGATGG + Intronic
956454859 3:69410396-69410418 GTGTGTGAGTATGAGTATGAGGG + Intronic
956551430 3:70464248-70464270 ATGTGTGTGTATGTGTTTTAGGG + Intergenic
957102331 3:75843902-75843924 GTGTGTGTGTATGAAATTGCAGG + Intergenic
957790999 3:84941135-84941157 CTGTGTGTGTTTGTGTGTGACGG - Intergenic
957862250 3:85969107-85969129 CTATGTGAGAAAGAGATTGAAGG - Intronic
958846082 3:99266420-99266442 GTGTGTGTGTATGACTTTAATGG + Intergenic
959334493 3:105046609-105046631 TTGTGTGTGTGTGAGAGAGAAGG - Intergenic
959974825 3:112446930-112446952 ATGTGTGTGTGTGAGATTATAGG - Intergenic
960348788 3:116568278-116568300 CTGTGTGTGTATGTGTTTCTTGG - Intronic
960368532 3:116805682-116805704 CTGTGTGTGTATGGGGATGGGGG - Intronic
960842469 3:121974134-121974156 CTGTGTGTGTTAGACATTGAAGG - Intergenic
961522557 3:127475439-127475461 GTGTGTGTGTGTGTGAGTGATGG - Intergenic
961848697 3:129793160-129793182 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
962092854 3:132263303-132263325 GTGTGTGTGTGTGAGTGTGAGGG - Intronic
963332011 3:143925127-143925149 CTGTGTGTGTATGTGAATGTGGG - Intergenic
964110441 3:153081979-153082001 GTGTGTGTGTGTGAGAATGATGG - Intergenic
964325501 3:155541805-155541827 GTGTGTGTGTAACAAATTGAAGG - Intronic
964411136 3:156398997-156399019 CTTGGTGGGTAGGAGATTGATGG - Intronic
965459571 3:168945458-168945480 CTGTGTGTGTATGTGGTTGGGGG + Intergenic
965867698 3:173225553-173225575 GTGTGTGTGTGTGAGTTTCAGGG + Intergenic
965871053 3:173265839-173265861 ATGTGTGTGTATGTGCATGAAGG - Intergenic
965973570 3:174592904-174592926 ATGTGTGTGTGTGAGAGAGAGGG + Intronic
966322261 3:178714134-178714156 CTGTGTGTGTGTGTGACTGAAGG - Intronic
967186445 3:186948571-186948593 CTGTGTGTGTATGTGGTCGTTGG + Intronic
967422167 3:189285387-189285409 CTGTGTGTTTTAGAGATGGAAGG + Intronic
967439723 3:189492527-189492549 CTGTGTGTGTTTGGGATACAGGG - Intergenic
967782491 3:193455410-193455432 TTGTGTGTGTGTGTGATTGTTGG - Intronic
1202748373 3_GL000221v1_random:131819-131841 GTGTGTGTGTATGAAATTGTAGG + Intergenic
968845186 4:3037091-3037113 GTGTGTGTGTGTGAGAAAGAGGG + Intronic
968889857 4:3362793-3362815 GTGTGTGAATATGAGAGTGAGGG + Intronic
968960703 4:3741952-3741974 CTGTGTGTGTGTGTGGTTGCAGG - Intergenic
970056851 4:11983491-11983513 CTGTGTGAGACTGAGATTGCAGG - Intergenic
970522631 4:16901018-16901040 GTGTGTGTGTATGTGACAGAGGG - Intergenic
971423611 4:26495435-26495457 CTGTGTGTGTCTCAGAGAGAGGG - Intergenic
971473177 4:27049097-27049119 GTGTGTGTTAATGAGATTAATGG + Intergenic
971848762 4:31956151-31956173 GTGTGTGTGTATGTGTTTGTTGG - Intergenic
973299356 4:48562631-48562653 ATGTGTGTGTATGTGTATGAAGG - Intronic
973316349 4:48764677-48764699 CTGTATGTGAAAGAAATTGAAGG + Intronic
973976249 4:56265434-56265456 GTGTGTGTGTATGAAATATATGG + Intronic
974738825 4:65977945-65977967 ATGTGTGTGTGTGTGTTTGACGG + Intergenic
975042241 4:69760668-69760690 ATGTGTGTGTGTGTGATTGTGGG - Exonic
976128496 4:81858543-81858565 CTGTGGGTTTATGGGAATGACGG - Intronic
976977336 4:91181056-91181078 CTGTGGGTTTATGGGAATGAGGG - Intronic
977132967 4:93266469-93266491 CTGTGTGTGTATGTGTGTGTGGG - Intronic
978144168 4:105352516-105352538 GTGTGTGTATATGTGTTTGAAGG - Intergenic
978645515 4:110926329-110926351 CTGTGTGTGTGTGGTATTGGGGG - Intergenic
979854430 4:125613381-125613403 CTGTGTGTGTATGTGTATGTGGG - Intergenic
980097436 4:128505983-128506005 CTGTGTGTGTGTATGATTGGGGG + Intergenic
980104026 4:128570156-128570178 GTGTGTGTGTGTGTGGTTGAGGG - Intergenic
980198529 4:129623698-129623720 CTGTGTTTTTATGAGACAGATGG + Intergenic
980263658 4:130487475-130487497 CTGTGTGCTTATGTGATGGAAGG - Intergenic
980664411 4:135910758-135910780 GTGTGTGTGTGTTAAATTGAAGG - Intergenic
981755873 4:148141437-148141459 GTGTGTGTGTGTGAGAGAGAGGG - Intronic
982635653 4:157893599-157893621 GTGTGTGTGTATGAGAGAGAGGG + Intergenic
983280132 4:165670321-165670343 CTGTGTGTGTATGTGTGTGTAGG + Intergenic
983330040 4:166314741-166314763 GTGTGTGTGCTTGAGAGTGAGGG + Intergenic
984564320 4:181309494-181309516 GTGTGTGTGTGTGAGATGGTGGG + Intergenic
985006764 4:185541947-185541969 GTGTGTGTGTGTGAGAGAGAGGG + Intergenic
985095195 4:186406382-186406404 GTGTGTGTGTGTGAGAGTGTGGG - Intergenic
1202753410 4_GL000008v2_random:31616-31638 GTGTGTGTGTATGAAATTGTAGG - Intergenic
986394983 5:7320464-7320486 CTGTGTTTTTCTCAGATTGATGG - Intergenic
986716822 5:10530846-10530868 GTGTGTGTGTATGAGAGTGTTGG + Intergenic
986901404 5:12438483-12438505 GTGTGTGTGTTTGAGATTGATGG + Intergenic
987067200 5:14301585-14301607 GTGTATGTGTATCAGAGTGAGGG + Intronic
987261404 5:16207544-16207566 CTGTATGTTTATGTAATTGAGGG - Intergenic
988448592 5:31316108-31316130 CTGTGCATGAATGAGAATGAAGG + Intronic
988485383 5:31664413-31664435 GTGTCTGTGTATGAGTGTGATGG - Intronic
988700761 5:33672295-33672317 CTGTGTGTATATGAGTATGTGGG - Intronic
988890267 5:35609095-35609117 GTGTGTGTGTGTGTGATTAAAGG - Intergenic
989610492 5:43286147-43286169 ATGTGTGTGAATGATTTTGAGGG - Intergenic
989815878 5:45737126-45737148 GTGTGTGTGTATGTGTTTGTTGG + Intergenic
990123707 5:52487804-52487826 CTATGTGTGAATTAGATTCAAGG + Intergenic
990854398 5:60247722-60247744 GTGTGTGTGTGTGAGAGAGAGGG - Intronic
992257029 5:74931292-74931314 TTGTGTGTGTGTGAAACTGATGG - Intergenic
992299522 5:75364007-75364029 CTGTGTGTGTGTGTGTTGGAAGG + Intergenic
993075103 5:83219577-83219599 CTGTCTGTGCATTAGATTGGAGG + Intronic
993359396 5:86955381-86955403 CTGTGTTTGGAGGAGAATGAGGG + Intergenic
994025010 5:95072099-95072121 GTGTGTGTGTGTGTGATTGGAGG + Intronic
994121370 5:96117424-96117446 GTGTGTGTGTGTGAGACTCAGGG + Intergenic
994848194 5:105017964-105017986 AAGTGTGTTTATGAGAATGAAGG + Intergenic
995182666 5:109243714-109243736 GTGTGTGTATATGAGCTGGATGG - Intergenic
995461008 5:112402995-112403017 GTGTGTGTGTGTGAGCTAGAGGG - Intronic
995730115 5:115229819-115229841 CTGAGTCTCTATGAGATGGAGGG - Intronic
995870796 5:116741269-116741291 CAGTGTGTGTGTGATAGTGATGG + Intergenic
996108183 5:119531601-119531623 GTGTGTGTGTAAGAGATGTAGGG + Intronic
996225528 5:120989506-120989528 GTGTGTGTGTATGAGTGTGTTGG - Intergenic
996593529 5:125175540-125175562 GTGTGTGTGTGTGAGTGTGACGG - Intergenic
996832747 5:127757837-127757859 GTGTGTGTGTGTGTGTTTGAAGG + Intergenic
996975421 5:129427780-129427802 CTGTGTGTGTATGTATGTGAGGG + Intergenic
998047560 5:139001551-139001573 CTGTGTGTGTATGTGGTAGGGGG + Intronic
998323558 5:141256835-141256857 GTGTGTGTGTGTGTGAGTGATGG - Intergenic
998578738 5:143347315-143347337 CTGTGTGTGTTTCACATAGAAGG - Intronic
998649393 5:144100842-144100864 CTGTGTGTGTATGCAACAGAAGG - Intergenic
999041943 5:148423742-148423764 TTGAGTTTGTATGAGTTTGATGG + Intronic
999596257 5:153208153-153208175 CTGTGTGTGTGTGCTAATGATGG + Intergenic
999911394 5:156204461-156204483 GTGTGTGTGTATGAGTGTGTTGG - Intronic
1000051174 5:157564082-157564104 CTGTGTATGTGTGAGATTAAGGG - Intronic
1000367380 5:160504414-160504436 CTGTGTGTGTATGTGTGTGTGGG + Intergenic
1000531394 5:162425216-162425238 CTCTGTGTTTATGAGCTTTAAGG - Intergenic
1001132581 5:169076931-169076953 GCGTGTGTGTATGAGAGAGAGGG - Intronic
1002095917 5:176830976-176830998 GTGTGTGTGTGTGAGATGGGAGG + Intronic
1002226988 5:177730495-177730517 CTCTGTGTGTTTGACATTAATGG + Intronic
1002394937 5:178945434-178945456 TTGTGTGTGTATGTGAATGTGGG + Intronic
1002821715 6:731582-731604 CTGTGCCTGCATGAGATGGATGG - Intergenic
1002900072 6:1403822-1403844 CTGTGTGTGTCTGTGAGTGTGGG - Intergenic
1003557437 6:7153060-7153082 GTGTGTGTGTGTGACAGTGAAGG + Intronic
1004317935 6:14606992-14607014 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1004481151 6:16020454-16020476 GTGTGTGTGTCTGTGTTTGAGGG - Intergenic
1004518929 6:16344188-16344210 CGGTGTGTGGATGAGAATGTTGG - Intronic
1004747291 6:18523578-18523600 GTGTGTGTGTGTGTGAATGAGGG + Intergenic
1004916459 6:20337422-20337444 CTGTGTGTGGTAGAGATTTATGG + Intergenic
1005179004 6:23082234-23082256 GTGTGTGTGTGTGTGATTGGGGG + Intergenic
1005423763 6:25679488-25679510 GTGTGTGTGCAGGGGATTGAAGG + Intronic
1007035280 6:38667470-38667492 TTGTGGGTTTATGAGAATGAGGG + Intergenic
1007364452 6:41381591-41381613 CAGTTTGTGCATGAGATTGCAGG + Intergenic
1008063801 6:47026419-47026441 CTTTGTAAGTGTGAGATTGAGGG - Intronic
1008768400 6:54948452-54948474 ATGTTTGTGTATGAGCTTGAAGG + Intergenic
1008800514 6:55363302-55363324 GTGTGTGTGTATCAGAGTAAAGG - Intronic
1008892811 6:56514614-56514636 GTGTGTGTGTATGCGCATGAGGG - Intronic
1008964334 6:57299092-57299114 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1009409901 6:63354186-63354208 CTGTGTTTTCATGATATTGATGG - Intergenic
1009659653 6:66594274-66594296 TTGTGTGTGTGTGAGAGAGAGGG - Intergenic
1009939238 6:70270267-70270289 CTGTTTGTGTCTGAGAGTCAGGG - Intronic
1010489306 6:76454121-76454143 GTGTGTGTGTGTGAAATTAATGG + Intergenic
1010739146 6:79479478-79479500 GTGTGTGTGTATGTACTTGATGG - Intergenic
1011324533 6:86135176-86135198 CTGTGTGTGTATTTTATAGATGG - Intergenic
1011350943 6:86423225-86423247 ATGTGTATGTATGGGGTTGAGGG + Intergenic
1012067619 6:94568534-94568556 GTGTGTGTGTAAGAGATAGAGGG - Intergenic
1012330218 6:97976091-97976113 CTTTGTGTGTATGTGTTAGAAGG - Intergenic
1012416493 6:99019249-99019271 CTGTGAGGGGATGAGAGTGAAGG - Intergenic
1013058826 6:106612058-106612080 CTGCTTCTGTATAAGATTGAAGG - Intronic
1014335851 6:120135417-120135439 TTTTGTATGTATGAAATTGATGG - Intergenic
1014503410 6:122222801-122222823 CTGTTTATGTATGATACTGATGG - Intergenic
1014606975 6:123487783-123487805 CTTTGTTTGTATGTGAATGAAGG - Intronic
1014616438 6:123606420-123606442 TTGTGTGTGTATGTGTGTGATGG + Intronic
1015190994 6:130472242-130472264 CTGTGTGTGTATGGGTGTGGTGG - Intergenic
1015359695 6:132324942-132324964 GTGTGTGTGTTTGTGAGTGAAGG - Intronic
1015713288 6:136164495-136164517 GTGTCTGTTTATGAGATGGATGG - Intronic
1016192167 6:141283253-141283275 TTTTGTGTGTATGTGACTGATGG + Intergenic
1016320892 6:142844760-142844782 GTGTGTGTGCATTGGATTGACGG - Intronic
1016633019 6:146254026-146254048 GTGTGTATGTATAAGTTTGAGGG + Intronic
1017501318 6:155025815-155025837 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
1017858934 6:158377204-158377226 CTGTGTGTGTAAGACAGTGCTGG - Intronic
1019073956 6:169371731-169371753 ATGTGTGTGTCTGAGAGAGAGGG - Intergenic
1019217464 6:170453013-170453035 GTGTGTGTGTATGTGTGTGAGGG + Intergenic
1019886486 7:3910439-3910461 CTGTGTGTGTATGTGTGTGCCGG + Intronic
1021070820 7:16237800-16237822 CTGAGTGTGTCTGAAACTGAAGG - Intronic
1021260169 7:18446165-18446187 GTGTGTGTGTCTGAGAGTGTGGG - Intronic
1021457695 7:20847415-20847437 CTGTGATTGGATGAGATTTAGGG - Intergenic
1022362467 7:29675269-29675291 CTGTGTGTGTCTGGGATTACAGG - Intergenic
1022411210 7:30139896-30139918 CTGTGTGTGGAGGAAATTCAAGG + Intronic
1022428824 7:30295087-30295109 GTGTGTGTGTGTGTGATTGCAGG + Intronic
1023847223 7:44129213-44129235 CTGTGTGTGTATGTGCATGTGGG - Intergenic
1024305811 7:47928818-47928840 ATGTGTGTGCATGAGCTTGAAGG + Intronic
1024529886 7:50382924-50382946 CTGTGTGTGTATGTGCATGGGGG - Intronic
1025035413 7:55590243-55590265 CTGTGGGTGTTTGAGGGTGAGGG + Intergenic
1026414015 7:70158318-70158340 CTGTGTAAGCATGAGATTGGAGG + Intronic
1028272829 7:88814441-88814463 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
1029974877 7:104823693-104823715 CTGTGAATGAATGAGCTTGACGG + Intronic
1030787260 7:113677497-113677519 GTGTGTGTGTGTGAGATGGATGG - Intergenic
1030969315 7:116034645-116034667 GTGTGTGTGTAACAGATAGAAGG - Intronic
1031804318 7:126290347-126290369 GTGTGTGTGTGTGTGATTGTTGG - Intergenic
1032086692 7:128887452-128887474 GTGTGTGTGTATGTGGTTGTGGG - Intronic
1032086727 7:128887734-128887756 GTGTGTGTGTATGAGAGTGTGGG - Intronic
1032458595 7:132092868-132092890 CTGTTTGTGTAGGAGATTTTGGG + Intergenic
1033400996 7:141025435-141025457 GTGTGTGTGTGTGTGTTTGAAGG + Intergenic
1033476718 7:141699909-141699931 GTGTGTGTGTGTGTGAGTGATGG - Intronic
1033492935 7:141862245-141862267 CTGTGTGTTGGTGAGAGTGAGGG - Intergenic
1033557723 7:142503291-142503313 CTGTGAGGGAAGGAGATTGAAGG - Intergenic
1033560178 7:142523348-142523370 CTGTGAGGGAAGGAGATTGAAGG - Intergenic
1033589950 7:142800954-142800976 CTGTGTATGTGTGAGAGAGAAGG - Intergenic
1033807132 7:144967297-144967319 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1033953484 7:146814176-146814198 CTGAGTTTGAATGAGACTGATGG + Intronic
1035336459 7:158131730-158131752 ATGTGTGTGTATGAGTGTGTTGG - Intronic
1035336498 7:158132654-158132676 CTGTGTGTATATGAGTGTGTAGG - Intronic
1035993863 8:4523516-4523538 GTGTGTGTGTGTGAGAGAGAAGG - Intronic
1036012206 8:4738913-4738935 GTGTGTGTGTATGTGTTAGAAGG + Intronic
1036589584 8:10156441-10156463 ACGTGTGTGTATGAGAGAGAGGG + Intronic
1036753119 8:11455664-11455686 CTGTGTGTGAATGTGAGTGTGGG + Intronic
1036753201 8:11456098-11456120 CTGTGTGTGTGTGTGAATGTGGG + Intronic
1036753206 8:11456135-11456157 CTGTGTGTGTGTGTGAATGTGGG + Intronic
1036753213 8:11456172-11456194 CTGTGTGTGTGTGTGAATGTGGG + Intronic
1037193271 8:16153638-16153660 CTGTGAATGTATGAAATAGAAGG - Intronic
1037588151 8:20292225-20292247 CCCAGTGTGTCTGAGATTGAGGG + Intronic
1037764972 8:21767105-21767127 GTGTGTGTGTATGTGATGTATGG - Intronic
1037915444 8:22770161-22770183 CTTTGTGTGAATGAGAAAGAAGG + Intronic
1038183768 8:25253417-25253439 ATGTGTGTGCATGGGATGGAAGG - Intronic
1039362686 8:36897174-36897196 CTGTGTGTGTGTGTGTTTGGTGG + Intronic
1039427007 8:37494401-37494423 GTGTGTGTGTGTGAGACTGTAGG + Intergenic
1040609391 8:48967608-48967630 CTGTGTGTTTATGGTAATGAGGG + Intergenic
1043764103 8:84107153-84107175 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1043845731 8:85161376-85161398 CTGTATGTGTATTAGTTTGCTGG - Intergenic
1044063795 8:87673263-87673285 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1044203703 8:89466952-89466974 CTTTGTGTGAATGAATTTGAGGG - Intergenic
1044501829 8:92966387-92966409 GTGTGTGTGTGTGAGATGGGAGG - Intronic
1044512848 8:93103384-93103406 GTGTGTGTGTATGTGTGTGATGG - Intergenic
1044545859 8:93458566-93458588 GTGTGTGTGTGTGTGCTTGAGGG - Intergenic
1044845686 8:96378387-96378409 GTGTGTGTGTGTGAGAGAGAAGG - Intergenic
1045160575 8:99538523-99538545 CTGAGTGTGTGTGTGTTTGAGGG + Intronic
1045318473 8:101063478-101063500 GTGTGTGTGTGTGAGATAGCGGG + Intergenic
1045552743 8:103187130-103187152 GTGTGTGTGTATGGGATGGGAGG - Intronic
1046248256 8:111594266-111594288 GTGTGTGTGTATGTGTATGATGG - Intergenic
1046377637 8:113407584-113407606 TTGTGTGTGTATGAGGTTAGGGG + Intronic
1046427919 8:114079961-114079983 TTGTGTGTGTATGAGAGAGAGGG + Intergenic
1046479805 8:114800957-114800979 TTGTGGGTTTATGAGAATGAGGG + Intergenic
1046484483 8:114868364-114868386 CTCTGTGTGAAAGAGATTGATGG - Intergenic
1046583442 8:116122335-116122357 GTGTGTGTGTAAGAGAAGGATGG + Intergenic
1047138115 8:122104220-122104242 CTGTGTGTGTGTGTGTGTGACGG - Intergenic
1047371859 8:124262539-124262561 GTGTGTGTGTATGTGAGTGTTGG - Intergenic
1047835026 8:128680051-128680073 GTGTGTGTGTCTAAGATTCAAGG - Intergenic
1048383972 8:133893932-133893954 CTGTGTGTGTGTGTGCTTGTGGG - Intergenic
1048579965 8:135722677-135722699 GTGTGTGTGTGGGATATTGAGGG + Intergenic
1051149012 9:14060564-14060586 GTGTGTGTGTATGTGATGGGTGG + Intergenic
1052104151 9:24491492-24491514 TTGTGAGTGAATGAGAGTGATGG + Intergenic
1052582746 9:30380939-30380961 CTGTGGGTGTATGTGTTTGGGGG - Intergenic
1053480624 9:38414024-38414046 GTGTGTGTGTGTGAGAAAGAGGG - Intronic
1053488772 9:38483777-38483799 GCGTGTGTGTATGTGAGTGATGG + Intergenic
1053586453 9:39464190-39464212 ATGTGCGTGGATGAGGTTGACGG - Intergenic
1054579853 9:66901044-66901066 ATGTGCGTGGATGAGGTTGACGG + Intronic
1054704233 9:68446569-68446591 CTGTGTGTATATGTGTTTAATGG + Intronic
1056311795 9:85348412-85348434 CTATATGTCTATGAGAATGAGGG + Intergenic
1056316845 9:85398463-85398485 GTGTGTGTGTGTGTGTTTGAGGG - Intergenic
1056318328 9:85413422-85413444 CTGTGAGTGTATGTGAAAGAAGG + Intergenic
1056577857 9:87869523-87869545 GTGTGTGTGTGTGAGAGAGAAGG - Intergenic
1056794741 9:89650169-89650191 GTGTGTGTGTGTGAGAGAGAGGG + Intergenic
1057579126 9:96270235-96270257 GTGTGTGTGTATGTGTTTGGGGG - Intronic
1058725580 9:107800546-107800568 CTGTGTTTTTAAGAGATTGCTGG + Intergenic
1058932222 9:109732494-109732516 TTGTTTGTTTATTAGATTGATGG + Intronic
1059694767 9:116720622-116720644 GTGTGTGTGTGTGAGAGAGAGGG - Intronic
1060011187 9:120044124-120044146 GTGTGTGTGTGTGAGAGAGAGGG - Intergenic
1060231003 9:121825219-121825241 GTGTGTGTGTGTGAGATGGTCGG + Intronic
1060406925 9:123377463-123377485 CTGTGTGTCTATGACTGTGATGG + Exonic
1061360665 9:130140165-130140187 CCGTGTGTGTTTGAGATGCAGGG + Intronic
1061589041 9:131586519-131586541 GTGTGTGTGTGTGTGTTTGACGG - Intronic
1061589057 9:131586789-131586811 GTGTGTGTGTGTGTGTTTGACGG - Intronic
1062106820 9:134759721-134759743 GTGTGTGTGTATGAGTGTGGGGG - Intronic
1203757620 Un_GL000218v1:149242-149264 GTGTGTGTGTATGAAATTGTAGG + Intergenic
1203361224 Un_KI270442v1:220468-220490 CTGTGGGTGTATGGGATTTCTGG - Intergenic
1203717012 Un_KI270742v1:161909-161931 GTGTGTGTGTATGAAATTGTAGG + Intergenic
1203534200 Un_KI270743v1:16325-16347 GTGTGTGTGTATGAAATTGTAGG - Intergenic
1203651238 Un_KI270751v1:125498-125520 GTGTGTGTGTATGACATTGTAGG + Intergenic
1185483595 X:466164-466186 CTGTGTGTGTCAGAGACAGAGGG + Intergenic
1185487222 X:491318-491340 CTGTGTGTTTGTGAGCTTGGAGG - Intergenic
1185993488 X:4917283-4917305 GTGTGTGTGTGTGTGAATGAGGG - Intergenic
1186099485 X:6140435-6140457 CTGTGTGTGAATGCTATTGAAGG - Intronic
1186568077 X:10685865-10685887 GTGTGTGTGTATGAGTATGTGGG - Intronic
1186613995 X:11167337-11167359 GTGTGTGTGTGTGTGATGGAGGG + Intronic
1187715477 X:22098158-22098180 CTGTGTGTATGTGAGAGTGAGGG + Intronic
1188535128 X:31188650-31188672 CTGTGTGTGCATGACATAGAAGG - Intronic
1188913516 X:35880303-35880325 CTGTGGGTGAATCAGATTTAAGG + Intergenic
1189499184 X:41539111-41539133 CTGTGTGTGTGGGAGTTAGAGGG + Intronic
1189549228 X:42076027-42076049 CTGTGTGTGTATGTGTGTGTGGG + Intergenic
1189732648 X:44037576-44037598 CTTTTTGTATATGATATTGATGG - Intergenic
1190372122 X:49752891-49752913 CACTGTGTGTATGAGATTGTAGG - Intergenic
1190637373 X:52449450-52449472 CTGTGTTTGTAGGATTTTGAAGG - Intergenic
1190709286 X:53054784-53054806 CTGTGTGTGTAAGAGAGTGTGGG + Intronic
1191931847 X:66382232-66382254 CTGTTTTTGGATGAGATTCATGG + Intergenic
1192859258 X:75048369-75048391 ATGTGTTTGTATGGGGTTGAGGG + Intergenic
1193264303 X:79450490-79450512 GTGTGTGTGTATAAAATTGATGG + Intergenic
1194652717 X:96534368-96534390 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1194972912 X:100363875-100363897 GTGTGTGTGTGTGAGAGAGAGGG + Intronic
1195680510 X:107542607-107542629 CTCTGTGGGAATGAGATTGCTGG + Intronic
1195997398 X:110744948-110744970 GTGTGTGTGAATGAGAGAGAGGG - Intronic
1196929478 X:120667003-120667025 GTGTGTGTGTATGTGTGTGATGG - Intergenic
1197232938 X:124025951-124025973 CTGTGTGTGTGTGAGATCTTAGG - Intronic
1197327523 X:125112158-125112180 GTGTGTGTGTGTGTGAGTGAGGG + Intergenic
1197599389 X:128509812-128509834 CTGTGTGAGTCAGTGATTGAGGG - Intergenic
1197770838 X:130088265-130088287 CTGTGAGTGGAGGAGATGGAGGG + Intronic
1198772569 X:140146428-140146450 CTGTGTGTGTATGTGGTTTTAGG - Intergenic
1198970974 X:142279549-142279571 TTGTGTGTGTGTGTGTTTGATGG + Intergenic
1199295659 X:146155386-146155408 GTGTGTGTGTATTACATTTAGGG + Intergenic
1199535265 X:148895589-148895611 GTGTGTGTGTAAGAGAGGGAGGG + Intronic
1199782886 X:151079630-151079652 GTGTGTGTGTATGAGTGTGTTGG + Intergenic
1200367271 X:155680176-155680198 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1201171194 Y:11266845-11266867 GTGTGTGTGTATGAAATTGTAGG + Intergenic