ID: 1125972698

View in Genome Browser
Species Human (GRCh38)
Location 15:43924806-43924828
Sequence CCATTCTCCGCACAGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125972693_1125972698 18 Left 1125972693 15:43924765-43924787 CCTTCTAACTGATCTTCTGCCTT 0: 1
1: 1
2: 2
3: 32
4: 296
Right 1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1125972692_1125972698 24 Left 1125972692 15:43924759-43924781 CCAGAGCCTTCTAACTGATCTTC 0: 1
1: 0
2: 3
3: 24
4: 176
Right 1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1125972691_1125972698 30 Left 1125972691 15:43924753-43924775 CCACTGCCAGAGCCTTCTAACTG 0: 1
1: 0
2: 7
3: 28
4: 272
Right 1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1125972694_1125972698 -1 Left 1125972694 15:43924784-43924806 CCTTTGCTCTTGCCCTTTCAGTC 0: 1
1: 0
2: 0
3: 28
4: 615
Right 1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125972698 Original CRISPR CCATTCTCCGCACAGCAATG AGG Intronic
900489739 1:2941911-2941933 GCAGTCTCCTCACAGCCATGTGG + Intergenic
909547394 1:76863019-76863041 CTATTCTCAGCACAGCAGTCAGG + Intergenic
915847278 1:159279617-159279639 GCTTTCTGCTCACAGCAATGGGG - Intergenic
921157662 1:212450800-212450822 ACATTCTCCCCACAGCCCTGAGG + Intergenic
923314565 1:232767393-232767415 GCATTCCCTCCACAGCAATGTGG + Intergenic
1064720327 10:18222273-18222295 CCATTGTCCCCTTAGCAATGGGG - Intronic
1065342045 10:24716701-24716723 CTGTTCTCCACACAGCAATCAGG - Intronic
1066325607 10:34354898-34354920 CCATTCTCTGCACTGCAGTCAGG - Intronic
1067526459 10:47042222-47042244 CCCTTCTCAGCACAGCATGGAGG - Intergenic
1070449164 10:76540828-76540850 CCATTTTCAGTACAACAATGAGG - Intronic
1070457859 10:76634619-76634641 AAACTCTCAGCACAGCAATGAGG - Intergenic
1072314003 10:94184171-94184193 CCATTCTCCACCCAACAATCGGG + Intronic
1075907151 10:126091461-126091483 CCACTCTCTGGACAGGAATGTGG + Intronic
1076668151 10:132104551-132104573 GCATCCTCAGCACTGCAATGAGG + Intergenic
1076771942 10:132670557-132670579 CCACTCTCCCCCCAGCAAGGAGG - Intronic
1080204005 11:29707884-29707906 CCATTCTCAGTACAGGATTGAGG + Intergenic
1082303357 11:50539061-50539083 CCATTCTCTGAATAGAAATGTGG - Intergenic
1083628843 11:64085630-64085652 CCAGCCTCCCCACAGCCATGTGG - Intronic
1088085342 11:105971613-105971635 CCATTTTCCCCACATAAATGTGG - Intronic
1089034522 11:115373074-115373096 GCATTCTGCTCAAAGCAATGAGG + Intronic
1096236661 12:49932934-49932956 CCTTTGTCAGCACAGCCATGAGG - Intergenic
1098280175 12:68854704-68854726 CCATCGTCCACACAGCACTGGGG - Exonic
1102794094 12:115673452-115673474 CTATTCTCCACACAGCAGTCAGG + Intergenic
1104144803 12:126022552-126022574 GCATTCTATGCCCAGCAATGTGG - Intergenic
1104657307 12:130582869-130582891 ACATTCTCCACACAGCTTTGTGG - Intronic
1106023854 13:25939504-25939526 CTTTTCTCATCACAGCAATGCGG + Intronic
1106365390 13:29074143-29074165 CCCTTCTTCTGACAGCAATGTGG - Intronic
1106934681 13:34704950-34704972 CCATTCTGCACACAGCAACCAGG - Intergenic
1109657559 13:65413517-65413539 CCCTTCTCAGCAAAGCAATCTGG - Intergenic
1117881107 14:60314459-60314481 CCATTCCACACTCAGCAATGGGG + Intergenic
1119941813 14:78649253-78649275 CCCTTCTCCGCAAAGCACTCAGG + Intronic
1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG + Intronic
1129607323 15:77031211-77031233 CCATTCTCCGCAACGCCCTGTGG + Exonic
1134479307 16:14603715-14603737 CCATTCTTCACACAGCAAGCAGG + Intronic
1134512602 16:14860445-14860467 CCATTCTCCACACAGCAGCCAGG - Intronic
1134700240 16:16258940-16258962 CCATTCTCCACACAGCAGCCAGG - Intronic
1134971587 16:18535719-18535741 CCATTCTCCACACAGCAGCCAGG + Intronic
1135523330 16:23194239-23194261 CCATTCTCAGCACCTCCATGGGG + Exonic
1135747221 16:25027463-25027485 CCATTCCCCACACCGCCATGAGG + Intergenic
1140457557 16:75113951-75113973 CCATCCTCAGCTCACCAATGCGG + Exonic
1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG + Exonic
1141700754 16:85640985-85641007 CCCTTCTCCGCATAGCACAGTGG + Intronic
1144370533 17:14586129-14586151 CCATTCTCCACGTAGCAGTGAGG - Intergenic
1144635996 17:16909548-16909570 CCATTCTCCCCACACCCAAGTGG + Intergenic
1148229016 17:45919565-45919587 CCACTCTGCGCCCAGCAGTGGGG - Intronic
1153373915 18:4354302-4354324 CCATCTTCCACACAGCAAGGTGG - Intronic
1155238509 18:23844555-23844577 TCATTCCCTGCACAGTAATGTGG + Intronic
1160689595 19:455377-455399 CCATTCTCCCCACAACCCTGCGG - Intronic
1162188909 19:8929399-8929421 CCAATCTCAGGACAGGAATGAGG - Intronic
1164565745 19:29324618-29324640 CCACTCTCCCCACAGCCAGGTGG + Intergenic
1167624624 19:50579367-50579389 CCATTCTCCACACAGCAGCCAGG + Intergenic
925245978 2:2383420-2383442 CCACTCTGCACACATCAATGTGG + Intergenic
925785976 2:7431573-7431595 CGAGTCTCCGCCCAGGAATGTGG + Intergenic
925897337 2:8482805-8482827 CCACTCTCCTCACAGTCATGAGG - Intergenic
925903604 2:8525784-8525806 CCCTTCTCTGCCCAGCAACGTGG - Intergenic
926334269 2:11851471-11851493 CCATTCACCCAACATCAATGGGG - Intergenic
927278516 2:21282399-21282421 CCAATCTCTGCACAGCCATGAGG - Intergenic
930246955 2:48993561-48993583 CCATTCTCCATACAGCACTCTGG + Intronic
931856583 2:66308197-66308219 GCATTATCCAGACAGCAATGAGG + Intergenic
933424625 2:82094291-82094313 CCATTTTCTGCACAGTAAAGTGG - Intergenic
935205851 2:100895932-100895954 ACATTCTCTGCACAGTAAGGAGG - Intronic
943921718 2:193715284-193715306 CCACTCACCACCCAGCAATGTGG - Intergenic
944650508 2:201825523-201825545 CCATTCTCCACACAGCTAACTGG - Intronic
946384667 2:219375235-219375257 CCATTCTCCACACAGCAGGAAGG + Intronic
947215607 2:227747290-227747312 CCATTCCCCATCCAGCAATGTGG - Intergenic
947910884 2:233799952-233799974 GCATTCTCCCCTCAGCACTGTGG - Intronic
1170517858 20:17150144-17150166 TCATTCTAGGCACAGCCATGGGG + Intergenic
1170597565 20:17817262-17817284 CCATTCTCCGCTCCCCAAGGAGG + Intergenic
1171226521 20:23446114-23446136 ACATTCTCTGTACAGCAGTGAGG - Intergenic
1172303252 20:33864261-33864283 CCATTCTCCACTCAGCAACCAGG + Intergenic
1172792903 20:37518617-37518639 CCAGACTCCTCACAGTAATGAGG + Exonic
1173467973 20:43299278-43299300 TCATTCTCTGCACAGCAAGAGGG + Intergenic
1174414523 20:50358143-50358165 CCATTCTCCACACAGGATTAGGG + Intergenic
1174570358 20:51496997-51497019 CCATTCTCCGCAGCTTAATGGGG + Intronic
1175703805 20:61160816-61160838 CCCTCCTCCGCACAGCATGGCGG + Intergenic
1179935735 21:44602453-44602475 CCATTCTGCACACGGCCATGGGG - Intronic
1182267451 22:29129136-29129158 CCTTTCTCAGCAGAGCAATGGGG - Intronic
1183009809 22:34935555-34935577 CCATTCTCTACACAGAAATTGGG + Intergenic
950167573 3:10813374-10813396 CCATTCTATACACAGCATTGAGG + Intergenic
955880896 3:63544123-63544145 TCATTTTCCGCACAGCAACCAGG - Intronic
960955784 3:123029503-123029525 CCATTCCCTGCAGAGCCATGGGG + Intergenic
962828324 3:139119015-139119037 CCATCCTATGGACAGCAATGGGG + Intronic
967258993 3:187623480-187623502 CGATTCTCCCCACAGCCTTGAGG + Intergenic
968224476 3:196965068-196965090 CCATGCTCCCTACAGCAATGAGG + Intronic
970488672 4:16549588-16549610 CTATTCTCAACACAGCAGTGGGG + Intronic
971722892 4:30269604-30269626 CCATTCTCCACTCAGCAATTAGG + Intergenic
973771545 4:54211708-54211730 TCATTCTCCACACAGCAATCAGG - Intronic
975005459 4:69277554-69277576 CCATTCTCCTCATTTCAATGTGG - Intergenic
975013877 4:69386541-69386563 CCATTCTCCTCATTTCAATGTGG - Intronic
975918950 4:79359730-79359752 CCATTTTCCACTCAGGAATGAGG - Intergenic
984194493 4:176642445-176642467 CCATTCTCACCACTGTAATGAGG + Intergenic
986288259 5:6377348-6377370 TCGTTCTCCTCACAGCTATGCGG + Intronic
986757903 5:10855081-10855103 CCATTCAACTCACAGCACTGAGG - Intergenic
990313195 5:54559635-54559657 CCATTCTGGACACAGGAATGAGG + Intergenic
992150207 5:73895179-73895201 CTATTCTCCACACAGCAGTCAGG - Intronic
999250662 5:150180438-150180460 CCATTCTCCACAAAGCCATTTGG + Intronic
999549268 5:152666837-152666859 CCATTCTAACCAAAGCAATGAGG + Intergenic
1002301863 5:178261964-178261986 GCAGCCTCCGCACAGGAATGTGG + Intronic
1006143145 6:31943115-31943137 CCATCCTCCCCACACCAAGGAGG - Intronic
1006194016 6:32226680-32226702 CCATTCTCCAGAAAGCAGTGAGG + Intergenic
1007692306 6:43710490-43710512 CCATTCACAGCCCAGCAAGGTGG - Intergenic
1007934787 6:45723327-45723349 CCATTCAGCCCACAGCAAAGTGG - Intergenic
1008057052 6:46955962-46955984 CCATTCTCCTCTCAGCAACCAGG + Intergenic
1009480752 6:64155643-64155665 CCTTTTTCTGCATAGCAATGAGG - Intronic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1018462478 6:164011688-164011710 CCATTGGCCTCACAGGAATGTGG - Intergenic
1019630185 7:2044955-2044977 CCATTCTCCGCACTTCACAGAGG + Intronic
1020654408 7:10912285-10912307 CCATTCTCCAAACAGCAATCAGG + Intergenic
1021576608 7:22111083-22111105 GCATTGTCAGCACAGCCATGTGG - Intergenic
1022638199 7:32156981-32157003 TCCTTCTCGGCACAGCAATGAGG - Intronic
1022984829 7:35641884-35641906 CCATTCTGGACACAGGAATGGGG + Intronic
1031415964 7:121497045-121497067 ACATTCTCCTCAGAACAATGAGG - Intergenic
1032378573 7:131450179-131450201 CCATTCTCCACACTGCAAGCAGG + Intronic
1032763451 7:134966917-134966939 ACATTCTCCACACACCACTGTGG + Intronic
1033490395 7:141837775-141837797 CCTCTCTCCTCACAGCTATGAGG + Intronic
1036583068 8:10095272-10095294 CCATTCACTGCTCAGCAATAAGG - Intronic
1037021482 8:13976978-13977000 CCCTTCTCCTCACAGCAAGGTGG + Intergenic
1040890358 8:52310867-52310889 CCATTCTCCGCAGAGCAGTTGGG - Intronic
1045592838 8:103617430-103617452 CCATTCTGGACACAGGAATGGGG + Intronic
1046898647 8:119500256-119500278 CCATACTCCCAAAAGCAATGGGG - Intergenic
1051444509 9:17126046-17126068 CCATTCTCTCCACAGCAGAGTGG + Intergenic
1055319471 9:75068220-75068242 CCATTCTCCACACAGCCAGAGGG + Intronic
1057785504 9:98084524-98084546 ATATTCTCAGCACAGGAATGAGG - Exonic
1062141331 9:134960749-134960771 CCTTTCTCCGCCCAGCACTGTGG + Intergenic
1191670186 X:63741500-63741522 ACATGCTCCACACAGCCATGTGG - Intronic
1192198321 X:69047223-69047245 CCTTTCTCCCCACAGCACTGGGG + Intergenic
1195658668 X:107357288-107357310 CTATTTTCCCCACAGCAGTGAGG + Intergenic
1198499811 X:137232378-137232400 CCATTCTCCAAACAGCAGTCAGG + Intergenic
1198673058 X:139102389-139102411 TCATTGTCAGCACAGCATTGTGG + Intronic
1199754042 X:150847969-150847991 CCATTCTCCACACAGCAGGCAGG + Intronic
1199833992 X:151570631-151570653 CCAATCTCCACACAGGAAAGGGG - Intronic
1200825755 Y:7638660-7638682 CTATTCTCTTCACTGCAATGAGG - Intergenic
1202234300 Y:22692428-22692450 CTATTCTCTTCACTGCAATGAGG + Intergenic
1202308859 Y:23503738-23503760 CTATTCTCTTCACTGCAATGAGG - Intergenic
1202561942 Y:26166850-26166872 CTATTCTCTTCACTGCAATGAGG + Intergenic