ID: 1125972698

View in Genome Browser
Species Human (GRCh38)
Location 15:43924806-43924828
Sequence CCATTCTCCGCACAGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125972694_1125972698 -1 Left 1125972694 15:43924784-43924806 CCTTTGCTCTTGCCCTTTCAGTC 0: 1
1: 0
2: 0
3: 28
4: 615
Right 1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1125972691_1125972698 30 Left 1125972691 15:43924753-43924775 CCACTGCCAGAGCCTTCTAACTG 0: 1
1: 0
2: 7
3: 28
4: 272
Right 1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1125972693_1125972698 18 Left 1125972693 15:43924765-43924787 CCTTCTAACTGATCTTCTGCCTT 0: 1
1: 1
2: 2
3: 32
4: 296
Right 1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1125972692_1125972698 24 Left 1125972692 15:43924759-43924781 CCAGAGCCTTCTAACTGATCTTC 0: 1
1: 0
2: 3
3: 24
4: 176
Right 1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125972698 Original CRISPR CCATTCTCCGCACAGCAATG AGG Intronic