ID: 1125973083

View in Genome Browser
Species Human (GRCh38)
Location 15:43928157-43928179
Sequence TGTCTTCACGGCGGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125973083 Original CRISPR TGTCTTCACGGCGGGGGAGC AGG (reversed) Intronic
902875538 1:19338626-19338648 TGTTTTCAGGGCGGCGGGGCTGG + Intergenic
903019467 1:20383940-20383962 TTTCTTCAGGGCCAGGGAGCTGG - Intergenic
904215493 1:28915171-28915193 TTTCTTCCTGGCGAGGGAGCTGG + Intronic
922436728 1:225614663-225614685 TAGCTTCAGGGTGGGGGAGCTGG - Intronic
1064183704 10:13141804-13141826 TGCCTTCCCGGCGGGGAAGGAGG + Intergenic
1067464558 10:46487928-46487950 TGTCTCCAGGGCTGGGGAGGTGG + Intergenic
1067622637 10:47896725-47896747 TGTCTCCAGGGCTGGGGAGGTGG - Intergenic
1069544445 10:69318667-69318689 TGGCGTCCCGGCCGGGGAGCGGG - Intronic
1072607504 10:96997121-96997143 TTTCTTCACGGCAGGGGAATGGG + Intergenic
1072722757 10:97791046-97791068 TGTCCTCACGACATGGGAGCTGG + Intergenic
1072984867 10:100130656-100130678 TGTCTACACCGCAGGAGAGCAGG - Intergenic
1073325842 10:102643724-102643746 TCTCTCCGCGGCGGGGGCGCCGG + Intergenic
1076565507 10:131396110-131396132 TATCTGCACGCCCGGGGAGCAGG + Intergenic
1076843097 10:133056233-133056255 TGGCCTCACAGCTGGGGAGCCGG + Intergenic
1078393536 11:10957078-10957100 TGTCTTCACAATGGTGGAGCAGG - Intergenic
1080061892 11:27965207-27965229 AGTCTTCGCGGAGGTGGAGCGGG - Intergenic
1081771097 11:45650994-45651016 TGCCTCCACGGCGGGGGCACTGG + Intronic
1084968843 11:72758496-72758518 TGCCTTCCCTGCGGTGGAGCAGG - Intronic
1087264592 11:96046278-96046300 TGTGTTCATAGCCGGGGAGCTGG + Intronic
1091352232 11:134906764-134906786 TGTGCTCACGGCCGGGGATCGGG + Intergenic
1096593170 12:52675807-52675829 AGTCTTCAAGGTGGTGGAGCGGG - Intronic
1096660991 12:53123895-53123917 TGTCCTCATGGATGGGGAGCTGG - Intronic
1096779977 12:53986057-53986079 GGTCTTCGCGGCCGGGGAGGGGG + Intronic
1101714367 12:107297595-107297617 TGTCTTCCCTGCTGGGGTGCAGG + Intergenic
1113382047 13:109813179-109813201 TCTCTTCACTGGGGGAGAGCAGG + Intergenic
1114537416 14:23431858-23431880 TGTCTTCACAGCGGAGAATCCGG - Exonic
1116821698 14:49633835-49633857 TGTCCCCAAGCCGGGGGAGCAGG - Exonic
1119172921 14:72548063-72548085 CGTCTTCATGGCAGGGGAGAGGG + Intronic
1122973930 14:105163426-105163448 CGTCTTCACGGTGGGGGACCTGG - Intronic
1125973083 15:43928157-43928179 TGTCTTCACGGCGGGGGAGCAGG - Intronic
1129104432 15:73296351-73296373 CATCCCCACGGCGGGGGAGCTGG - Intronic
1129944677 15:79528339-79528361 TGTCTTCACAACAGGGCAGCTGG - Intergenic
1130562344 15:84968471-84968493 TGTCTTCACGACATGGCAGCTGG + Intergenic
1135304519 16:21356581-21356603 AGTCATCACGGCTGGGCAGCTGG - Intergenic
1135434975 16:22420721-22420743 TGTCTCCAAGGCGGAGGAACTGG + Intronic
1136301262 16:29335711-29335733 AGTCATCACGGCTGGGCAGCTGG - Intergenic
1137014077 16:35356390-35356412 TGTCTTCACAATGGTGGAGCAGG + Intergenic
1137985016 16:53099926-53099948 TGTGTGCAGGGCGGGGGAGGAGG + Intronic
1141601584 16:85129884-85129906 TGTCTTCATGCCGGCAGAGCAGG + Intergenic
1142851817 17:2708061-2708083 TGGCCGCACGGCGGGGGAGGAGG + Intronic
1143379341 17:6486244-6486266 TGTCTTCAGGGAGGAGGAACTGG + Intronic
1151547017 17:74799421-74799443 TGTGTTCAAGGCAGGAGAGCAGG - Intronic
1154492528 18:14932710-14932732 GGTCTTCAGGACTGGGGAGCAGG - Intergenic
1158416438 18:57253160-57253182 TGTCTTCATGGAGGGAGAGGTGG - Intergenic
1162566836 19:11449181-11449203 TGCCTGCAAGGCAGGGGAGCTGG + Intronic
1165070200 19:33251243-33251265 TGGCTTCATGGACGGGGAGCTGG + Intergenic
1165349963 19:35269889-35269911 TGCCTTCGCGGGGGGGCAGCAGG + Exonic
1166587651 19:43964979-43965001 GGTCTTCACTGAGGAGGAGCTGG + Exonic
1166590261 19:43991577-43991599 GGTCTTCACTGAGGAGGAGCTGG + Exonic
1166597220 19:44060484-44060506 GGTCTTCACTGAGGAGGAGCTGG + Exonic
1166599426 19:44081044-44081066 GGTCTTCACCGAGGAGGAGCTGG + Exonic
1166606580 19:44148800-44148822 GGTCTTCACTGAGGAGGAGCTGG + Exonic
1166624733 19:44340491-44340513 GGTCTTCACTGAGGAGGAGCTGG - Exonic
1167144694 19:47674759-47674781 TGTCTTCACAGCATGGCAGCTGG + Intronic
1167412132 19:49350828-49350850 TGTGTTGGGGGCGGGGGAGCCGG - Intronic
1168063841 19:53908582-53908604 TGACATCACGGCGGGGGGGGGGG + Intergenic
927964140 2:27258756-27258778 TGTCTTCATGGCTGGGGAGGTGG - Exonic
929501481 2:42494234-42494256 GGTCCGCAGGGCGGGGGAGCGGG + Intergenic
930990615 2:57649985-57650007 TGTCTTCACGTGGCTGGAGCAGG - Intergenic
936020123 2:108988447-108988469 TGTGTTGGTGGCGGGGGAGCGGG - Intronic
937066082 2:119019039-119019061 TGTTGTCAGGCCGGGGGAGCTGG + Intergenic
943155342 2:184168327-184168349 TGTCATAAGGTCGGGGGAGCGGG - Intergenic
946395499 2:219442037-219442059 CTTCTTCATGGCGGGGGAGGGGG - Intronic
947137399 2:226988602-226988624 TGTCTGCTCGGAGGGGCAGCTGG - Intronic
1168881126 20:1207057-1207079 TGTCTTCCCCTCGGAGGAGCTGG - Exonic
1169333802 20:4738420-4738442 TGCCTGCAGGGCGAGGGAGCTGG + Intronic
1172784783 20:37460625-37460647 TGTCTTCAGGGCATGGCAGCTGG + Intergenic
1173296780 20:41766668-41766690 TGTCATCAGGTAGGGGGAGCAGG + Intergenic
1181052722 22:20245448-20245470 TGTCTTCACAGCCGGGGCCCTGG + Intronic
1183416630 22:37686357-37686379 TGTCTTCAGGGAGAGGAAGCCGG + Exonic
1183716886 22:39538302-39538324 TGTCTTCAGGGAAAGGGAGCTGG + Intergenic
1185073318 22:48669070-48669092 TGTCCTCACGTCGGGGAAGTGGG - Intronic
1185147647 22:49147990-49148012 TGTCCTCACAGCAGGGGAGGAGG - Intergenic
1185261210 22:49864939-49864961 TGACTTCACGGGGGGGGGGGGGG - Intronic
949365917 3:3280358-3280380 TGTCTTCACAGAGTGGGGGCAGG + Intergenic
951977845 3:28533601-28533623 TGTCCTCATGGTGGGGCAGCTGG - Intronic
955228260 3:57078712-57078734 TCACTTCGCGGCGGGGGAGCCGG - Intronic
956700166 3:71951840-71951862 TGTCATCACTGTGGGTGAGCTGG - Intergenic
956838722 3:73117323-73117345 TGTCATCCCGGCGGGGAGGCGGG + Intergenic
956979368 3:74617486-74617508 TTTCATCAAGGAGGGGGAGCTGG + Intergenic
960601393 3:119462625-119462647 TTTCTTCAAGGGGGGGGGGCGGG + Intronic
961772499 3:129260280-129260302 TGCCTTCACTGCTGGGCAGCTGG - Intronic
967066275 3:185919485-185919507 TGTCTTCACAGAGGAGGAGGTGG - Exonic
967266574 3:187697143-187697165 TGTCTTAGCGGCGGGGGTGGGGG - Intergenic
968811395 4:2801102-2801124 TGTCTTGACCGCGGAGGACCGGG + Intronic
974706342 4:65521369-65521391 TGTCTTGAGGTCGGGGGAGTGGG + Intronic
979671793 4:123367386-123367408 TGTCTTCTAGGAGTGGGAGCGGG + Intergenic
981195249 4:141911999-141912021 TGTCTTCACTGCGGAGTAGCTGG - Intergenic
985026688 4:185745763-185745785 TGTCTTCAAATCGGGGGAGGGGG - Intronic
987294150 5:16535495-16535517 TGCCTTCACAGAGTGGGAGCTGG + Intronic
987294166 5:16535615-16535637 TGCCTTCACGAAGTGGGAGCTGG + Intronic
987294194 5:16535775-16535797 TGCCTTCACGAAGTGGGAGCTGG + Intronic
987294201 5:16535815-16535837 TGCCTTCACGAAGTGGGAGCTGG + Intronic
987294230 5:16535975-16535997 TGCCTTCACGAAGTGGGAGCTGG + Intronic
994171539 5:96663094-96663116 GATCCGCACGGCGGGGGAGCCGG - Intronic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1017787751 6:157770304-157770326 TGTCTCCATGGCTGGCGAGCAGG - Intronic
1019020152 6:168911494-168911516 TGTCTTCCCGGGTGGGGAGCAGG + Intergenic
1019020198 6:168911645-168911667 TGTCCTCCCGGGTGGGGAGCGGG + Intergenic
1019553945 7:1619471-1619493 CGTCTGAGCGGCGGGGGAGCCGG + Intergenic
1019563186 7:1667834-1667856 TGTCCTCGCGGCGGCGGCGCCGG + Intergenic
1032130111 7:129220987-129221009 GGTCTTCAGGGCGGGTGATCTGG + Intergenic
1032839610 7:135703698-135703720 TGTCTTCACAGTGGCTGAGCTGG - Intronic
1033552163 7:142457522-142457544 TGGCTTCACTGCTTGGGAGCTGG - Intergenic
1035041419 7:155930860-155930882 GGTCTTCATGGCTGGTGAGCAGG - Intergenic
1036477300 8:9104773-9104795 CGTCTTCAAGGAGGTGGAGCTGG + Intronic
1050163803 9:2744037-2744059 TGTCCTCACAGCGTGGCAGCTGG - Intronic
1050943108 9:11485299-11485321 TCTCTTCAGAGCGGGGAAGCAGG + Intergenic
1052403028 9:28024801-28024823 TGGCTCCACGTCGGGGAAGCTGG - Intronic
1052852826 9:33388134-33388156 CGTCATCTCCGCGGGGGAGCCGG + Intronic
1058185198 9:101846373-101846395 TAGCTTCATGGCTGGGGAGCTGG + Intergenic
1058289005 9:103213881-103213903 TGTTTTCAGGTGGGGGGAGCGGG + Intergenic
1061078312 9:128355156-128355178 TGTCTTCAAGAAGGGGGACCAGG + Exonic
1061706687 9:132458331-132458353 TGTCTCCCTGGCGGGGGAGGGGG + Intronic
1061986464 9:134132944-134132966 TGTTTTCACTGTGGAGGAGCTGG + Intergenic
1062505804 9:136875524-136875546 TGTCTTCATTGTGGTGGAGCCGG - Intronic
1188887926 X:35573088-35573110 CGTCTTCACGTGGGGGCAGCAGG - Intergenic
1197920662 X:131590304-131590326 TGTCTTCAGGCCGGGGGCGGTGG + Intergenic