ID: 1125974217

View in Genome Browser
Species Human (GRCh38)
Location 15:43936800-43936822
Sequence ATCTTTCTGGAGTTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125974217_1125974221 -5 Left 1125974217 15:43936800-43936822 CCCAGCCTCAACTCCAGAAAGAT 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1125974221 15:43936818-43936840 AAGATGCCGACAGTACAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125974217 Original CRISPR ATCTTTCTGGAGTTGAGGCT GGG (reversed) Intronic