ID: 1125976287

View in Genome Browser
Species Human (GRCh38)
Location 15:43954773-43954795
Sequence GATTTCATCTGAGGCTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125976287 Original CRISPR GATTTCATCTGAGGCTTTGC AGG (reversed) Intronic
900835897 1:5003743-5003765 GGTCTCATCTGAGGCTTGACTGG + Intergenic
905254775 1:36673286-36673308 GCTGTCTTCAGAGGCTTTGCGGG - Intergenic
905743445 1:40392397-40392419 CATTCCAGCTGAGCCTTTGCTGG + Intronic
906472226 1:46140734-46140756 GGTTTCTTCTGAGGCTCTGAAGG - Intronic
907101787 1:51844476-51844498 GGTTTCTTCTGAGGCCTTTCTGG - Intronic
908487180 1:64606291-64606313 TATTTCATCTAAGGGTTTGTGGG + Intronic
908922149 1:69208319-69208341 TATTTCTTCTGAGACTCTGCAGG + Intergenic
911547058 1:99230629-99230651 GTCTTCAGCTGAGGCCTTGCTGG + Intergenic
912761319 1:112370102-112370124 GATTTCAGCTCTGGCTTTCCAGG + Intergenic
912806766 1:112763037-112763059 GATTTCCTCTGATGCTTTTCTGG - Intergenic
913046128 1:115074914-115074936 GGTTGCCTGTGAGGCTTTGCTGG - Intronic
913711854 1:121492550-121492572 GATCTCATCTGAGACTTTGGGGG + Intergenic
915556737 1:156664990-156665012 GATTTCCTCTGAGACTCTGGTGG + Intergenic
917107249 1:171504822-171504844 AATTTCTTCTGAGGTTTTGTTGG + Intronic
919669306 1:200324387-200324409 GTTCTCATCTGAGGCTTGACTGG - Intergenic
920000298 1:202793412-202793434 GATTTGAACTTAGGCTGTGCAGG - Intronic
920229721 1:204462203-204462225 TATTTCACCTGAGTCTTAGCAGG + Intronic
921745324 1:218733754-218733776 AATCTCATCTGAGGCTTTGTTGG - Intergenic
922203789 1:223429340-223429362 GATTTACTCTGGGCCTTTGCTGG + Intergenic
922412514 1:225390096-225390118 GATTTCACCTGCGCCTTGGCAGG + Intronic
922752845 1:228078951-228078973 GCTTTCATCTGAGGTTTGGAGGG + Intergenic
924615470 1:245608385-245608407 GATTCCAACAGAGGCCTTGCTGG + Intronic
1063308655 10:4931981-4932003 GTTTTCACCTGGGGCATTGCAGG - Intronic
1063956363 10:11271167-11271189 GATTTCACCTGAGGTCCTGCTGG - Intronic
1066010085 10:31186984-31187006 GATTTCCTCTCGGGCTTTGTGGG + Intergenic
1066313941 10:34224755-34224777 GCTGTCATCTGAGGGTTTCCAGG + Intronic
1066411853 10:35178599-35178621 GATGTCAAATGAGGCATTGCAGG - Intronic
1068400657 10:56523541-56523563 AATATCATTTGAGGCTGTGCTGG + Intergenic
1069105511 10:64378713-64378735 GAATTCAGCCAAGGCTTTGCTGG - Intergenic
1069780864 10:70954524-70954546 GATTACATCTGAGGCTGTCTGGG + Intergenic
1070436646 10:76400276-76400298 GGTCTCATCTGAGGCTTAACTGG - Intronic
1071557278 10:86614301-86614323 GCTTTTATCTGAGTCTCTGCTGG + Intergenic
1072561504 10:96580086-96580108 CCTTTCATCTGAGGCTTCCCTGG + Intronic
1074942966 10:118252782-118252804 AATTTTATCTGAGGCTTATCAGG - Intergenic
1075107250 10:119548469-119548491 GAGCTCCTCTGAGGCTCTGCAGG - Intergenic
1076980409 11:201146-201168 GATTTCAACTCAGGCTTTCAGGG + Intronic
1078921632 11:15836241-15836263 GATGTCATCTGAGCATCTGCAGG - Intergenic
1079294658 11:19222241-19222263 GGTCTCATCTGAGGCTTGACTGG + Intergenic
1080002055 11:27361484-27361506 GTTTTCATCTGGGCCTTTGTAGG - Intronic
1083215751 11:61218552-61218574 GGTCTCATCTGAGGCTTGACTGG + Intergenic
1083218635 11:61237381-61237403 GGTCTCATCTGAGGCTTGACTGG + Intergenic
1085561623 11:77477140-77477162 GATTTCAGCTGCAGCTTTGGTGG - Intergenic
1088533473 11:110835858-110835880 CAGTGCATGTGAGGCTTTGCAGG - Intergenic
1088670787 11:112138285-112138307 TATTTCAACTGAAGCTTTGCAGG + Intronic
1088881986 11:113979749-113979771 GGATACATCTGAGGCTTGGCAGG + Intronic
1089384479 11:118058868-118058890 AAGTGCTTCTGAGGCTTTGCTGG + Intergenic
1089468671 11:118703616-118703638 GGTCTCATCTGAGGCTCAGCTGG + Intergenic
1089630286 11:119780032-119780054 GCTCTCATCAGAGGCTTCGCCGG - Intergenic
1089681326 11:120120520-120120542 GAGTTCATGTGGGGCTGTGCAGG - Intronic
1093209597 12:16292518-16292540 GTTTTCATCTGAGGATTAGTGGG + Intergenic
1095167799 12:38994256-38994278 GAAATTATTTGAGGCTTTGCTGG - Intergenic
1099781820 12:87204292-87204314 GAATTCATCAGAGACTTTGTAGG + Intergenic
1099876515 12:88413702-88413724 GATATCAGCTGAGGGTTTGTTGG - Intergenic
1100920280 12:99476860-99476882 GGTCTCATCTGAGGCTTGACTGG + Intronic
1103141835 12:118555302-118555324 CTTTTCATCTGTGGCTTTGAAGG - Intergenic
1103216381 12:119204765-119204787 GAATTCAGCTGAGGCTCAGCTGG + Intronic
1103850553 12:123930215-123930237 CAATTGATCTGTGGCTTTGCTGG - Exonic
1105651539 13:22383900-22383922 GACTTCATCTGAATGTTTGCAGG + Intergenic
1106497557 13:30294703-30294725 TATTTCATCTAAGACTTTCCTGG + Intronic
1106794056 13:33186120-33186142 AATCTCAGCTGAGGCTTCGCAGG - Intronic
1108049949 13:46423797-46423819 GATTTCTTTTAAGGCTTTGAAGG + Intronic
1108934030 13:55864803-55864825 CATTTCCCCTGCGGCTTTGCAGG - Intergenic
1109542469 13:63797085-63797107 GATTTCTTTTAAGGCTTTGAAGG + Intergenic
1112302170 13:98240261-98240283 GATTAGATCTGAGGCCTTGGAGG + Intronic
1112881645 13:104114062-104114084 TAGCTCATCTGAGGCTTTGAGGG + Intergenic
1114340491 14:21737919-21737941 TAGTTCATCTGAGGGTTTGGTGG + Intergenic
1119512679 14:75223799-75223821 GAATCCATTGGAGGCTTTGCAGG - Intergenic
1121122177 14:91383018-91383040 GCTTTAAGATGAGGCTTTGCGGG - Intronic
1121858074 14:97288786-97288808 GACTCTACCTGAGGCTTTGCAGG - Intergenic
1122677885 14:103432377-103432399 GATTTCATCAGGGTCTTTGTGGG + Intronic
1202835515 14_GL000009v2_random:75163-75185 GAGTGCACCTGTGGCTTTGCAGG + Intergenic
1123874530 15:24610303-24610325 GATTTGAGCAGAGGCTTTGTTGG - Intergenic
1125976287 15:43954773-43954795 GATTTCATCTGAGGCTTTGCAGG - Intronic
1127059675 15:55169426-55169448 CCTTTCATCTGTGGTTTTGCTGG - Intergenic
1128991328 15:72262852-72262874 GATTTCATCTGAGTGTTTAAGGG + Intronic
1133968912 16:10553093-10553115 GACTTCACCCGAGGCTTTGGAGG + Intronic
1135188023 16:20331830-20331852 GACTCCATCTGTGGCTTTTCAGG - Intergenic
1136113934 16:28082741-28082763 GAAAATATCTGAGGCTTTGCAGG - Intergenic
1139197807 16:64941325-64941347 GATTTGATCTGAGGGTGTGCTGG + Intergenic
1144016843 17:11204267-11204289 GATTTCTTCTGAGGCTATGAGGG + Intergenic
1146158958 17:30548980-30549002 GGTTTCTTCTGAGGCTGTGCAGG - Intergenic
1149002662 17:51773380-51773402 GATGTAAACTGAGGCTTTGTGGG + Intronic
1149280580 17:55100957-55100979 GGTCTCATCTGAGGCTTGACTGG - Intronic
1150438971 17:65176558-65176580 GGTTTCATCTTGGGCTTGGCGGG - Intronic
1152133083 17:78488929-78488951 GGTTCCCTCTGAGGCTCTGCGGG - Intronic
1155348472 18:24882442-24882464 GATTTCAACCGAGGCCTTTCTGG - Intergenic
1158958433 18:62565416-62565438 GATCTCTCCTGTGGCTTTGCCGG + Intronic
1159868192 18:73730581-73730603 GATCTCATCTGAAGCTTGACTGG - Intergenic
1159880528 18:73854573-73854595 GGTTCCTTCTGAGGCTGTGCAGG - Intergenic
1161255623 19:3307607-3307629 GAGTTCATTTGAGGCTTTGATGG - Intergenic
1161709852 19:5841753-5841775 AATTTCCTCTGAGGCTTAGAGGG - Intergenic
1161716056 19:5876905-5876927 AATTTCCTCTGAGGCTTAGAGGG - Intronic
1162467695 19:10852400-10852422 GATTTCATCTGGTGCCCTGCTGG - Intronic
1163460668 19:17435671-17435693 GACTTCATGTGAGGCATTCCGGG - Exonic
1164818014 19:31221541-31221563 GATATCATCTGAAGGTTAGCTGG + Intergenic
1164866582 19:31609324-31609346 GATTTTATCAAAGGCTTTTCGGG - Intergenic
1165315883 19:35055170-35055192 GTTTTTAGCTCAGGCTTTGCTGG + Intronic
1165532516 19:36416420-36416442 GAATTCATTTGAGGCTTTCAGGG - Intronic
1166642604 19:44506764-44506786 GGTCTCATCTGAGGCTCAGCTGG - Intronic
1202637115 1_KI270706v1_random:52186-52208 GAGTGCACCTGTGGCTTTGCAGG - Intergenic
925771720 2:7288823-7288845 GGTTTCTTCTGAGGCTGTGAGGG + Intergenic
931564474 2:63600946-63600968 TGTTTCACCTGAGGCTTTGGTGG + Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
933688852 2:85163718-85163740 GGTTCCCTCTGAGGCTGTGCGGG + Intronic
935124486 2:100211501-100211523 GGTCTCATCTGAGGCTTGCCAGG + Intergenic
939063202 2:137449511-137449533 GATCTCAGCAGAGGCTTGGCTGG + Intronic
940288705 2:152057267-152057289 GGTCTCATCTGAGGATTTGTGGG - Intronic
942887237 2:180940329-180940351 GATTTCAGCTGAAGCTATGAGGG - Intergenic
945444595 2:209921233-209921255 TATTTCATCTCAGGATTTGCAGG - Intronic
945911702 2:215657266-215657288 GATTTCACATTATGCTTTGCAGG + Intergenic
946046121 2:216822526-216822548 GTTTTCATCTCAGGGTTTTCTGG - Intergenic
947942327 2:234068999-234069021 GATCTCATCTGAAGCTTGACTGG + Intronic
1169949565 20:11028437-11028459 GTTTTCATCTTAGTCTCTGCAGG + Intronic
1172922324 20:38495430-38495452 GATAGCATTTTAGGCTTTGCAGG + Intronic
1173054052 20:39594334-39594356 GATTTCATCTGAGGCTGGACTGG + Intergenic
1175162734 20:57021039-57021061 GATTGTTTTTGAGGCTTTGCAGG - Intergenic
1175820817 20:61907850-61907872 GATCTCATCTGAGGATTGGGAGG - Intronic
1179315966 21:40244739-40244761 GATTACTTCTGGGGCTTTTCTGG - Intronic
1180942452 22:19668190-19668212 GGTCTCATCCAAGGCTTTGCTGG + Intergenic
1182905377 22:33931355-33931377 TATTTCATTTGAGGCTTTTAAGG - Intergenic
1184683555 22:46085796-46085818 GATTCCTTCTGGGGTTTTGCCGG - Intronic
1184939672 22:47753743-47753765 GGTTCCATTTTAGGCTTTGCTGG - Intergenic
1184963003 22:47945179-47945201 GGTCTCATCTGAGGCTCGGCTGG - Intergenic
1185184136 22:49382460-49382482 GCTTCCATCTGAGGCTGTGAGGG - Intergenic
951671220 3:25184318-25184340 GAGTTTATCTGTGGCTTTGTGGG + Intronic
952020932 3:29019217-29019239 GGTTTCTTCTGAGGCTTTTGAGG - Intergenic
952040303 3:29253493-29253515 GATTTGATGTGAGGGATTGCAGG + Intergenic
952486970 3:33822363-33822385 GATTTCATCTCAGGCATTTAGGG + Intronic
952830844 3:37563651-37563673 GATTCCAGCCGTGGCTTTGCTGG + Intronic
953554271 3:43930817-43930839 GCATGCATCTGTGGCTTTGCTGG - Intergenic
955248744 3:57255290-57255312 GATTTCAGCTGAGGCTGGGAGGG + Intronic
963294801 3:143534286-143534308 GATTTGATTTGTAGCTTTGCTGG - Intronic
965302807 3:167024386-167024408 GATTTCATCTGTGTCTTAGTGGG + Intergenic
966490752 3:180525965-180525987 GGTCTCATCTGAGGCTTGACTGG + Intergenic
969119399 4:4896827-4896849 GATCTCATCTGAGGTTTGACTGG + Intergenic
972086931 4:35229551-35229573 TATGTCATCTGAGGCTTTACTGG - Intergenic
972124723 4:35749164-35749186 GATAATATCTGAGGCTTTGCAGG - Intergenic
973391909 4:49564179-49564201 AATTGCACCTGTGGCTTTGCAGG + Intergenic
973393689 4:49576879-49576901 GAGTGCACCTGTGGCTTTGCAGG + Intergenic
973571725 4:52247063-52247085 GAAGTCATCTGAAGCCTTGCAGG + Intergenic
974054877 4:56975317-56975339 AATTTGATGTGTGGCTTTGCCGG - Intronic
974356443 4:60818902-60818924 TTTTTCATCTGAGGCTTCCCTGG + Intergenic
975813092 4:78190099-78190121 AATTTCTTCTGATGCTTTTCTGG + Intronic
977323817 4:95549759-95549781 GAATTCGGCTGAGGCTTTGCCGG - Intergenic
977372574 4:96158401-96158423 GATTTCATCAGAGTCTTTCCTGG - Intergenic
978825212 4:113014608-113014630 GATTTCATCCACAGCTTTGCTGG + Intronic
979350184 4:119635075-119635097 GGTCTCATCTGAGGCTTGACTGG - Intergenic
979753645 4:124311446-124311468 GATCTCATCTGAGGTTTTACTGG - Intergenic
980459968 4:133096874-133096896 GTTTTTATATCAGGCTTTGCAGG - Intergenic
981475591 4:145183868-145183890 GATTTCCCCTGAGTTTTTGCTGG + Intergenic
982983786 4:162177823-162177845 GATTTCTTCTGAGGCTGTGAGGG - Intergenic
983596915 4:169479443-169479465 GATCTCATCTGTTGCTTTGATGG + Exonic
985045175 4:185933501-185933523 GGTTCCTTCTGAGGCTGTGCGGG + Intronic
1202764432 4_GL000008v2_random:138043-138065 GAGTGCACCTGTGGCTTTGCAGG - Intergenic
987288850 5:16488552-16488574 GTCTTCAGCTGAGGCTTTGCTGG + Intronic
987462053 5:18223660-18223682 CTTTTCCTCTGTGGCTTTGCAGG - Intergenic
987735930 5:21843426-21843448 GATTTCTTCTGACTCTTGGCAGG + Intronic
987868512 5:23578610-23578632 TATATCATGTGAGGCTTTGCAGG - Intergenic
988737527 5:34037769-34037791 GATTTTATCTGAGGGATTTCAGG + Intronic
989419243 5:41216750-41216772 GATTGCATCAGTGGCTTAGCTGG + Intronic
989966036 5:50466572-50466594 GATCCCATCTGAGACTTTGGGGG - Intergenic
991983945 5:72263312-72263334 GTTTTCTTCTGAGGCTTTTATGG - Intronic
994549562 5:101213416-101213438 GATTTCAGCTGAGCCTCTACTGG + Intergenic
997005422 5:129811161-129811183 GATTTCATCTGAGGCCTATTTGG + Intergenic
998617879 5:143760905-143760927 GCTGTCATCTGAGCCTTTGGTGG + Intergenic
1001114045 5:168924010-168924032 GATATTATTTTAGGCTTTGCAGG - Intronic
1001741641 5:174057824-174057846 GATGTCTTCTGAAGGTTTGCTGG + Intronic
1004989298 6:21118933-21118955 GAATTCAGTTTAGGCTTTGCGGG + Intronic
1005259713 6:24045407-24045429 AAGTTCATCTGACCCTTTGCAGG + Intergenic
1008245209 6:49162858-49162880 GATTACATCTCATGCTTTTCTGG - Intergenic
1011445310 6:87432877-87432899 GAATTCATCTGAGGTAATGCAGG - Intronic
1011852437 6:91646825-91646847 TGTTTCATCTGAGGCTTGACTGG - Intergenic
1012272733 6:97234958-97234980 TATCTCATTTGAGGCTTTACTGG + Intronic
1013664244 6:112330370-112330392 GATTTCATCTGGGGGGCTGCAGG - Intergenic
1014700826 6:124685986-124686008 GTTCTCAGCTGAGGCTTGGCTGG + Intronic
1015733844 6:136376515-136376537 CATTGCATCTGAGGTTTTCCTGG - Intronic
1019607758 7:1918597-1918619 GATTTAATCACAGGGTTTGCAGG - Intronic
1020870593 7:13624442-13624464 GATATCATCTCATGCTTTTCAGG + Intergenic
1020957052 7:14752943-14752965 GATTTCATCTCTGACTTTTCTGG - Intronic
1023694903 7:42835117-42835139 CTTTGCATTTGAGGCTTTGCAGG + Intergenic
1024700828 7:51902179-51902201 GTTTTCATCTGAAGCTGGGCAGG + Intergenic
1028125912 7:87113360-87113382 AATCTCATCTGAGGTTTGGCTGG - Intergenic
1029945696 7:104530418-104530440 AATTACAGCTGTGGCTTTGCTGG - Intronic
1033505656 7:141997198-141997220 GATCTGATCAGTGGCTTTGCTGG + Intronic
1035072729 7:156157047-156157069 CATTTCCTCGGAGGATTTGCAGG + Intergenic
1035081007 7:156215957-156215979 GATTTTCTCTGTGGCTTTCCAGG + Intergenic
1037250608 8:16889294-16889316 GATTTCATCTAATGTTTTACAGG + Intergenic
1037256502 8:16961402-16961424 AATTTCATCTCATGCTATGCTGG + Intergenic
1037383309 8:18311382-18311404 GATTTTTGCAGAGGCTTTGCAGG - Intergenic
1038242309 8:25821250-25821272 AATATCATCCGAGGCTTTGTGGG - Intergenic
1039896671 8:41721347-41721369 GATTCCTTCTGAGGCTGTGAGGG - Intronic
1040115230 8:43609959-43609981 GCTTTTATCTGAGGCTATTCAGG - Intergenic
1040634230 8:49253831-49253853 TATTTCTTCTCAGTCTTTGCTGG - Intergenic
1040786381 8:51169389-51169411 TTTTTCATCTGAGTCTTTTCTGG + Intergenic
1042610462 8:70594023-70594045 CATTTCAAGAGAGGCTTTGCTGG + Intronic
1043262106 8:78214806-78214828 AATTTCATATGAGGCTTTTTGGG - Intergenic
1043824334 8:84906973-84906995 CATTTCATCTCAGGCTATCCTGG - Intronic
1045982003 8:108200644-108200666 TATTAAATCTTAGGCTTTGCAGG - Intergenic
1046313786 8:112474003-112474025 GATTTCCTTTGAAGTTTTGCAGG + Intronic
1047544338 8:125800851-125800873 CATGTCATCTGAGGCTCTACTGG - Intergenic
1049915873 9:318198-318220 GTTTTCATCTGTGGATTTGAAGG - Intronic
1050362313 9:4842173-4842195 CTTCACATCTGAGGCTTTGCAGG + Intronic
1052140223 9:24972862-24972884 AATTTTATCTGAAGTTTTGCTGG + Intergenic
1055803046 9:80061557-80061579 CATTTTATCTGAGGCTTTAGTGG + Intergenic
1057675687 9:97134452-97134474 GAGTGCACCTGTGGCTTTGCAGG - Intergenic
1058772204 9:108246637-108246659 GTTTTCTTCTGAGCATTTGCAGG - Intergenic
1061436398 9:130565470-130565492 AAGTTCATCTGAGGCTAAGCAGG + Intergenic
1203545180 Un_KI270743v1:122930-122952 GAGTGCACCTGTGGCTTTGCAGG - Intergenic
1187962887 X:24583442-24583464 GATTTTAGCAGAGGCTTGGCTGG - Intronic
1188512619 X:30952987-30953009 GATTTCTTCAGAAGCTTTGTAGG - Intronic
1188874360 X:35411891-35411913 GATTTCTTCTTTGGCTGTGCAGG - Intergenic
1189343567 X:40222986-40223008 GTTTTCATCTGAGGCTTGACTGG - Intergenic
1191150912 X:57220430-57220452 GATTCCTTCTGAGGGTTTGAAGG - Intergenic
1191578510 X:62734062-62734084 GATTTCTTCCGAGGCTTTAATGG + Intergenic
1192795819 X:74423116-74423138 GATTTCGCCAGCGGCTTTGCTGG - Intronic
1192849694 X:74942174-74942196 GATGTCATCTGAGTGTTTCCAGG + Intergenic
1194623452 X:96201112-96201134 GATTTGTGCTCAGGCTTTGCTGG + Intergenic
1194745422 X:97622741-97622763 GATTTTAGCTGAAGCTTTCCAGG - Intergenic
1196302865 X:114066502-114066524 TAGTTCCTCTGAAGCTTTGCAGG - Intergenic
1201516184 Y:14820546-14820568 GTTTTCACCTGAAGCTTTGTTGG - Intronic
1202338457 Y:23834833-23834855 AGTTTCTTCTGAGGCTTTCCTGG - Intergenic
1202532309 Y:25835239-25835261 AGTTTCTTCTGAGGCTTTCCTGG + Intergenic