ID: 1125998090

View in Genome Browser
Species Human (GRCh38)
Location 15:44183395-44183417
Sequence GGGCCCACCACTCCACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125998090 Original CRISPR GGGCCCACCACTCCACAGGA AGG Intronic
900462923 1:2810000-2810022 GGGCCCAGCAGGCCACAGCACGG + Intergenic
900780324 1:4613771-4613793 GGGCCCTGCATTCCACAGGCCGG - Intergenic
900849043 1:5127632-5127654 TGGCCAACCAGACCACAGGAGGG - Intergenic
905364110 1:37439425-37439447 GGGCCCCCAACCCCACAGGCAGG + Intergenic
906506460 1:46383309-46383331 GTGCCCACCTCTCCCCAGCATGG - Intergenic
907272754 1:53300417-53300439 GGGCCCACAACACCAAAGGTAGG + Intronic
910145765 1:84078252-84078274 GTGCCCGCCACTCCACAGTCTGG - Intronic
913968129 1:143393606-143393628 GGGTCCACCTCTCCACAGCTTGG + Intergenic
914062510 1:144219196-144219218 GGGTCCACCTCTCCACAGCTTGG + Intergenic
914116640 1:144747158-144747180 GGGTCCACCTCTCCACAGCTTGG - Intergenic
915590006 1:156865244-156865266 GGGTCCACTGCTCTACAGGAGGG - Intronic
919765513 1:201124811-201124833 GCAGCCCCCACTCCACAGGAGGG + Intronic
921932079 1:220762863-220762885 GGCCCCACCACTCCACAAAATGG - Intronic
922892763 1:229074285-229074307 GGGCACCCCAGCCCACAGGAGGG + Intergenic
923698204 1:236275602-236275624 GGCCCCACCAATCTGCAGGAAGG - Intronic
1062907883 10:1191091-1191113 GGGCCCCACACTCCGCAGAATGG + Intronic
1063089927 10:2854963-2854985 GGACCCTCCACCCCACATGAAGG + Intergenic
1064230417 10:13525122-13525144 GGGCACAGCACTGCACAGCAAGG - Intronic
1066670101 10:37827864-37827886 GGGCCCACTAGACCAGAGGAGGG + Intronic
1067752988 10:48984154-48984176 GAGAGCACCACTCCCCAGGAAGG + Intergenic
1070489043 10:76958649-76958671 GGGCCAACTTTTCCACAGGAGGG + Intronic
1072788218 10:98299028-98299050 GGGCCCACCAATCCAGAGATTGG + Intergenic
1075062638 10:119267530-119267552 GGGCAGCCCTCTCCACAGGATGG + Intronic
1075103834 10:119524220-119524242 GTGCCCAGCACTGAACAGGAAGG - Intronic
1075505751 10:123020274-123020296 GGGCCAAAAACTCCCCAGGAGGG + Intronic
1076685642 10:132197396-132197418 GGGTACCCCGCTCCACAGGAGGG - Intronic
1076910834 10:133388492-133388514 GTTCCCACCACTGCACATGAGGG - Intronic
1078143914 11:8710371-8710393 AGCCCCACCACACCACAGAAAGG + Intronic
1080749923 11:35141906-35141928 GAGTCCACCACTCCCCAGAATGG - Intronic
1081654155 11:44846370-44846392 GCGCCCAACACTCCGCAAGAAGG - Intronic
1083730843 11:64651703-64651725 GGAGCCTCCCCTCCACAGGAGGG + Intronic
1084799260 11:71531260-71531282 GGGCGGACCACACCACAGGTAGG + Intronic
1085048961 11:73369881-73369903 GGGTCCTCAACACCACAGGACGG + Intergenic
1085162455 11:74360917-74360939 GAGCCCACCACTGCTCAGGGAGG + Intronic
1088332086 11:108664912-108664934 GGGCGCAGCACTCCACGGAAGGG - Intergenic
1089342756 11:117770524-117770546 GTGTCCTCCATTCCACAGGACGG + Intronic
1092200948 12:6582396-6582418 AAGCCCACCACTGCACGGGAAGG + Intronic
1092913767 12:13171527-13171549 GGACACCCCAGTCCACAGGAGGG - Intergenic
1095740929 12:45606335-45606357 AGGCCTACCACTCAGCAGGAAGG + Intergenic
1096717876 12:53501822-53501844 GGGCCCACTACCCCAAAGCAAGG - Intronic
1096895645 12:54818800-54818822 GAGCCCACCACAGCTCAGGAAGG - Intergenic
1097472724 12:60015361-60015383 GTGAACACCATTCCACAGGAAGG + Intergenic
1098859223 12:75688798-75688820 GGGCCCACCACTTCTCTAGAGGG + Intergenic
1098955094 12:76681400-76681422 GTGTGGACCACTCCACAGGATGG - Intergenic
1103947240 12:124533199-124533221 GGGCCCCCCACTAGGCAGGAGGG - Intronic
1104747022 12:131216906-131216928 GGACCCAGCACGGCACAGGAGGG + Intergenic
1104785596 12:131446279-131446301 GGACCCAGCACGGCACAGGAGGG - Intergenic
1113915980 13:113874534-113874556 GGGCCCACCACTCACCTGGAGGG - Intergenic
1113916017 13:113874652-113874674 GGGCCCACCACTCACCTGGAGGG - Intergenic
1113919313 13:113898040-113898062 TCGCCCACCACTCACCAGGATGG + Intergenic
1116370289 14:44121829-44121851 ATGCCCACCTCTCCACTGGAAGG + Intergenic
1116872829 14:50084090-50084112 GAGGCCACCTCCCCACAGGAAGG + Intronic
1119029109 14:71177512-71177534 GGCCACAGCTCTCCACAGGAAGG - Intergenic
1119085124 14:71732371-71732393 GAGCACACCACTCCACGAGAAGG - Intronic
1119468140 14:74875945-74875967 GGGCCAACCACTCTAGAAGACGG + Intergenic
1119474650 14:74920121-74920143 TGGCCCCCCACCCCAGAGGAGGG - Intronic
1124129984 15:26974687-26974709 GGGCAAATCACTCCACAGCAAGG - Intronic
1125998090 15:44183395-44183417 GGGCCCACCACTCCACAGGAAGG + Intronic
1126742101 15:51787364-51787386 GGGCCCACCACAGCTCAGGAAGG + Intronic
1128313298 15:66644941-66644963 GAGCCCAGCACACCCCAGGAAGG + Intronic
1129250622 15:74306943-74306965 AGGCTCCTCACTCCACAGGAGGG - Intronic
1129389175 15:75212049-75212071 GAGCTCAGCACTCCACAGGCAGG - Exonic
1130440170 15:83945334-83945356 GAGACCACCACCCCAAAGGAGGG + Intronic
1132827026 16:1910211-1910233 TGCCCCACCACTCCACAGCGAGG + Intergenic
1136399483 16:30009996-30010018 GGGGCCACCACGCCTGAGGATGG - Exonic
1137043882 16:35638876-35638898 GGGCCCAGCACCCCTCAGGAGGG - Intergenic
1139552819 16:67685072-67685094 GGGCACACAGCACCACAGGAAGG - Intronic
1141033416 16:80608747-80608769 AGCCCCACCTCTCCACAGGCCGG - Intronic
1142064179 16:88051130-88051152 AGGCCCGCCACTACACGGGAGGG - Intronic
1143181572 17:4987239-4987261 GGGACCACCACTCCGCCGGGGGG - Intronic
1143515247 17:7416294-7416316 GGGCCCCCAACTCCCCAGAAAGG - Intronic
1143591647 17:7888685-7888707 AGGCCCACAAATCCAGAGGATGG - Intronic
1144670812 17:17131684-17131706 GAGCCCCCCACACCACAGGTAGG + Exonic
1145263960 17:21370633-21370655 GGGGCCATCACTCCACAGATAGG - Intergenic
1146320588 17:31843482-31843504 GGGCCCAACTTTTCACAGGATGG - Intergenic
1147630177 17:41925179-41925201 GCGCCCACCACCACACAGGGTGG + Intronic
1150650330 17:67005923-67005945 CGGCCCAGCATTCCTCAGGATGG + Intronic
1151808544 17:76422043-76422065 GGGACAACCAAGCCACAGGAGGG + Intronic
1157725798 18:49962774-49962796 GGGCTCTCCACTGCTCAGGAGGG - Intronic
1157858943 18:51124124-51124146 GAGCCCACCACCCGGCAGGAAGG - Intergenic
1160066888 18:75583900-75583922 TGGCCCATCCCACCACAGGATGG - Intergenic
1160723412 19:607308-607330 GGGCACAGCACTCCCCAGGCAGG - Intronic
1161210623 19:3063348-3063370 GGCCCCCCCACCCCACAGCAGGG + Intergenic
1161487360 19:4543462-4543484 GGGCCCCCCACTCCGCGGGTGGG + Exonic
1163366681 19:16879469-16879491 GGGCCCGCCGCCCCACAGCAGGG - Exonic
1167313863 19:48752795-48752817 GGGCCCACCGCTCCCCAGATCGG + Exonic
1167381518 19:49141004-49141026 GGCTCCAGCACACCACAGGAAGG - Intronic
1202701916 1_KI270712v1_random:171074-171096 GGGTCCACCTCTCCACAGCTTGG + Intergenic
925931890 2:8714692-8714714 AGGCCCACCCCTGCAAAGGAAGG + Intergenic
926682727 2:15676010-15676032 GGGCCCATCAAGCCCCAGGAAGG + Intergenic
929917837 2:46151064-46151086 GGGCCCACCAGTCCACGGAGGGG - Exonic
932377538 2:71251044-71251066 GAGCCCACCACACCTCAGCAAGG - Intergenic
932795496 2:74691998-74692020 GTGCCCACCACACCATCGGAGGG - Intergenic
934172828 2:89554520-89554542 GGGTCCACCTCTCCACAGCTTGG + Intergenic
934283142 2:91628873-91628895 GGGTCCACCTCTCCACAGCTTGG + Intergenic
934756534 2:96828302-96828324 GAGCCCACCACCCCACAAGGTGG + Intronic
936076852 2:109406867-109406889 GTGCCCACCCCTCAACAGGGCGG - Intronic
937780000 2:125826030-125826052 GAGCCCACCACTGCTCAAGAAGG + Intergenic
937910657 2:127074030-127074052 GGGCCCCCCACCCCATAAGAAGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948515344 2:238499977-238499999 AGGACCCCCATTCCACAGGAAGG - Intergenic
1170752830 20:19167307-19167329 GAGCCCACCACACCTCAAGAAGG - Intergenic
1171283254 20:23918691-23918713 GGGGCCACCAGTCCACGGGTGGG + Intergenic
1172739104 20:37151254-37151276 GGGCCCACCACCCCCCAGACGGG - Intronic
1175221064 20:57416728-57416750 GTGCCCACCACTCAGCAGCATGG + Intergenic
1175760944 20:61561981-61562003 GGGTCCACCTCTCCACACGAAGG - Intronic
1175760959 20:61562029-61562051 GGGTCCACCTCTCCACACGAAGG - Intronic
1175760974 20:61562077-61562099 GGGTCCACCTCTCCACACGGAGG - Intronic
1175760989 20:61562121-61562143 GGGTCCACCTCTCCACACGGAGG - Intronic
1175761004 20:61562169-61562191 GGGTCCACCTCTCCACAGGGAGG - Intronic
1175761019 20:61562217-61562239 GGGTCCACCTCTCCACACGAAGG - Intronic
1175761033 20:61562263-61562285 GGGTCCACCTCTCCACACGGAGG - Intronic
1175761062 20:61562359-61562381 GGGTCCACCTCTCCACACGGAGG - Intronic
1175761079 20:61562407-61562429 GGGTCCACCTCTCCACACGAAGG - Intronic
1175815406 20:61880903-61880925 GGGCCCCCCAGGCCCCAGGAGGG + Intronic
1176191220 20:63811087-63811109 GGTCCCAGAACCCCACAGGATGG + Intronic
1176191263 20:63811213-63811235 GGTCCCAGAACCCCACAGGATGG + Intronic
1179375030 21:40842296-40842318 TGGCCCACCTCTCCAGAGCAGGG - Intronic
1180038265 21:45262055-45262077 GGGCCCAGCTCACCACACGACGG + Intergenic
1180084865 21:45504063-45504085 GGGCCCCCAACCCCACAGGGAGG - Intronic
1181030606 22:20147433-20147455 GGGTCCAGCACCCCACAGGGGGG + Exonic
1181648297 22:24245595-24245617 GGTCCCACAACTCCCCAGGGTGG + Intergenic
1181769339 22:25113982-25114004 GGTCACACCACTCCCCAGGGTGG - Intronic
1183481746 22:38069108-38069130 GGACTCACCATTGCACAGGATGG - Exonic
1184117838 22:42432327-42432349 GGGCCCGCCACCTCACAGGCTGG + Exonic
1184943127 22:47783090-47783112 GGGCCATCCCCTCCACAGGGAGG + Intergenic
949543554 3:5053296-5053318 GAGCCCACAACTTCACAGCAGGG - Intergenic
949683394 3:6541228-6541250 GAGCCCACCACACCTCAGCAAGG - Intergenic
950259853 3:11535980-11536002 GGGCCCACAGCTGCACTGGATGG - Intronic
950872736 3:16243456-16243478 GTGCCAACCTCTGCACAGGAAGG - Intergenic
953420670 3:42751069-42751091 GGGCCCATCACTGCACAGCGAGG + Intronic
954084404 3:48232828-48232850 GAGCCCACCAGGCCACACGATGG + Intergenic
954449128 3:50562295-50562317 GGGCCCACCAGTCCCCAGGCCGG - Intronic
954827966 3:53391635-53391657 GAGCCCACCACAGCTCAGGAAGG + Intergenic
957811573 3:85229047-85229069 GAGCCCACCACAGCTCAGGAAGG - Intronic
961026741 3:123564983-123565005 GTGCACACCAGTCCTCAGGATGG + Intronic
962201416 3:133403766-133403788 GGGACCCCCACTCCCCAGAATGG - Intronic
966206606 3:177412755-177412777 GGGCCCCCCACTTCCCAGAAGGG + Intergenic
967989835 3:195122611-195122633 GGTCCTTCGACTCCACAGGAAGG + Intronic
968472382 4:788052-788074 GGCACCAGCACTCTACAGGACGG + Intronic
969496610 4:7529918-7529940 GGGCCAGCCCCTCCCCAGGATGG - Intronic
969826672 4:9763365-9763387 GGGTCCACCTCTCCACAGCTTGG + Intergenic
970325923 4:14925457-14925479 GTGCCCACCTCTCCACAGCCTGG + Intergenic
973279701 4:48346336-48346358 AGGCCTACCACTCCAAATGATGG - Intronic
973874754 4:55206408-55206430 GAGCCCACCACACCTCAGGGAGG + Intergenic
973883560 4:55297649-55297671 GGGCCCACCACAGCTCAGCAAGG + Intergenic
975843997 4:78506380-78506402 GAGCCCACCACAGCTCAGGAAGG - Intronic
976204556 4:82612213-82612235 GGGTCCCCGACTCCACAGCATGG + Intergenic
988381260 5:30499473-30499495 GAGCCCACCACACCTCAGCAAGG - Intergenic
995108222 5:108399179-108399201 GAGCCCACCACAGCTCAGGAAGG + Intergenic
995541682 5:113191783-113191805 TGGGCCACCACTCCCCATGAAGG + Intronic
996147280 5:119991769-119991791 GGGCCCACCACAGCTCAGCAAGG - Intergenic
999229981 5:150056110-150056132 GGGCCATCCACTTCACAGGCAGG + Exonic
1001703106 5:173721648-173721670 GGCCCCACCCCTCCCGAGGATGG + Intergenic
1002279637 5:178122809-178122831 GGGCCCCCCACTCCTATGGAGGG - Exonic
1003150685 6:3546298-3546320 GGGCCCTCCCCTCCCCAAGATGG - Intergenic
1005150352 6:22741703-22741725 GGGCCCATCTCTCCACATCAGGG + Intergenic
1005950270 6:30626575-30626597 TGGGCCCCCACTCCACAGCATGG + Intergenic
1005994036 6:30921061-30921083 GGGCCCCCGACTCCACAGCCTGG - Exonic
1009380766 6:63026098-63026120 GTGCTTACCACTGCACAGGATGG - Intergenic
1009695327 6:67095914-67095936 GAGCCCACCACAGCTCAGGAAGG + Intergenic
1012133479 6:95524997-95525019 GAGACCACCAACCCACAGGAAGG + Intergenic
1018860768 6:167709333-167709355 GGACACTCCACTCCACATGATGG + Intergenic
1019360331 7:601567-601589 GGGCCTCCCACATCACAGGAGGG + Intronic
1019525986 7:1480780-1480802 GGCCCCACCCCTCCCCAGGCTGG + Intronic
1019910228 7:4095958-4095980 GGGCCCACCAGTCCCTAAGAGGG + Intronic
1020068619 7:5210368-5210390 GTGCCCAGCACTGCAGAGGAGGG - Intronic
1028532420 7:91852152-91852174 GGGCCCATCTCTGCACAGGATGG + Intronic
1032384173 7:131510003-131510025 CAGGCCACCGCTCCACAGGAGGG - Intronic
1033118172 7:138644702-138644724 GGGGCCAGCACTCACCAGGACGG + Exonic
1035635872 8:1143803-1143825 GGGTCCAGCACTGCACAGAAGGG - Intergenic
1036751268 8:11444866-11444888 GGCACGTCCACTCCACAGGAGGG + Intronic
1036781499 8:11651073-11651095 GAGCCCAGCTCTCCACTGGAAGG + Intergenic
1046880928 8:119307272-119307294 GGGCCCACCACAGCTCAGGAAGG + Intergenic
1049479105 8:142811524-142811546 TGGCCCAACACCCCACAGCATGG - Intergenic
1051853426 9:21535625-21535647 GGGCCCACCACTCCCAACCAAGG + Intergenic
1052998080 9:34562132-34562154 GGGCCCAGAAGTCCTCAGGATGG - Intronic
1054740847 9:68804397-68804419 GGGCCCACCATTCCTCGGGGAGG + Intronic
1057402475 9:94736833-94736855 GGGCCCACCACTCTGCAGTGGGG + Intronic
1057507908 9:95651140-95651162 AGCCCCACCACACCACAGGCCGG - Intergenic
1059668834 9:116474612-116474634 GGGTCCATCACTGCACATGAAGG - Intronic
1060744934 9:126125087-126125109 CTTCCCACCACTCCACAGCACGG - Intergenic
1061837089 9:133336501-133336523 AGGCCCCCCACTCCAAAGGACGG - Intergenic
1062302478 9:135882762-135882784 GAGCCCACGGCTCCAGAGGATGG + Intronic
1062462840 9:136669061-136669083 GGGCACCCCCCTCCACATGACGG + Intronic
1062655408 9:137602129-137602151 GGGACCACCACGCCCTAGGAAGG + Intergenic
1186497392 X:10022538-10022560 GGGGCCACTATACCACAGGAAGG - Intronic
1187409715 X:19039738-19039760 GGGCCCAGCACTCACCAGAATGG - Intronic
1189017663 X:37301208-37301230 GAGCCCACCACTGCTCAGCAAGG - Intergenic
1190280090 X:48923663-48923685 GGGCCCGGCACTCCAAAGCAGGG + Exonic
1190318839 X:49167443-49167465 GGCCCCATCCCCCCACAGGAGGG + Intronic
1190942131 X:55052431-55052453 GGGCCCACCACAGCTCAAGAAGG - Intergenic
1195968586 X:110451131-110451153 GTACACACCACTCCAGAGGATGG - Exonic
1198466262 X:136907309-136907331 GGGCCCGCCGCTCCACAAGAAGG - Intergenic
1201494262 Y:14576211-14576233 GGGCCCACCACACTTCAAGAAGG - Intronic