ID: 1126009411

View in Genome Browser
Species Human (GRCh38)
Location 15:44288723-44288745
Sequence CCTCCCAACCGTGAGGTGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126009401_1126009411 0 Left 1126009401 15:44288700-44288722 CCCCTTTCCGGTTTTTTTCCCCG 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1126009404_1126009411 -7 Left 1126009404 15:44288707-44288729 CCGGTTTTTTTCCCCGCCTCCCA 0: 1
1: 0
2: 0
3: 17
4: 281
Right 1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1126009402_1126009411 -1 Left 1126009402 15:44288701-44288723 CCCTTTCCGGTTTTTTTCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 180
Right 1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1126009400_1126009411 3 Left 1126009400 15:44288697-44288719 CCGCCCCTTTCCGGTTTTTTTCC 0: 1
1: 0
2: 1
3: 21
4: 423
Right 1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1126009403_1126009411 -2 Left 1126009403 15:44288702-44288724 CCTTTCCGGTTTTTTTCCCCGCC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1126009398_1126009411 14 Left 1126009398 15:44288686-44288708 CCAGGGTACATCCGCCCCTTTCC 0: 1
1: 0
2: 0
3: 2
4: 85
Right 1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126009411 Original CRISPR CCTCCCAACCGTGAGGTGTT GGG Exonic
902922017 1:19671864-19671886 CCTCCCAGCCCTGAGGTGGTGGG - Intronic
911003680 1:93195542-93195564 CCTCCCAACAGTGTTGCGTTGGG - Intronic
915650552 1:157307463-157307485 CCTCCCAGCAGTGAGGTTCTGGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
1063636380 10:7787232-7787254 CTTACCAACCGTGTGGTCTTGGG - Intronic
1065408482 10:25394303-25394325 CTTCCCAACCGTGTGGATTTGGG - Intronic
1065570185 10:27063174-27063196 CTTCCCAACAGTGAGGTGGATGG + Intronic
1070068865 10:73066474-73066496 CCTCCCAAATGTGTGGTGGTGGG - Intronic
1076501738 10:130942626-130942648 CCGCCCAACCCTGTGGAGTTTGG + Intergenic
1076572545 10:131442015-131442037 CCTCCAGACCCTGATGTGTTTGG - Intergenic
1080117458 11:28636792-28636814 CATCCCATCCTTTAGGTGTTTGG + Intergenic
1080564209 11:33493200-33493222 CCTCCCAACAGTGTTATGTTGGG - Intergenic
1083430878 11:62612986-62613008 CCGCTCAACCCTGAGGGGTTAGG - Exonic
1085769564 11:79312718-79312740 CCTTCCAACCAAGAAGTGTTGGG - Intronic
1098956896 12:76697090-76697112 GCTCCCAACCCTGAAGGGTTGGG + Intergenic
1101195089 12:102373443-102373465 CCACTCCACAGTGAGGTGTTGGG + Intergenic
1101255090 12:102968909-102968931 CCTCCCAAGCCTGAGATATTTGG - Intergenic
1103279158 12:119740824-119740846 CCTCCCTTCCTTGAGGAGTTGGG - Intronic
1111927763 13:94481325-94481347 CTTCCCACCCATGATGTGTTAGG - Intergenic
1113626646 13:111852835-111852857 GTTCCCACCCGTGAGCTGTTAGG + Intergenic
1117771671 14:59139838-59139860 TCTCCCAACCGGGAGGTTTAGGG - Intergenic
1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG + Exonic
1131068639 15:89450121-89450143 GCTCCCAACTGTGTGGTGTCTGG - Intergenic
1132249258 15:100322088-100322110 TCTTCCAACCTTCAGGTGTTTGG - Intronic
1132532916 16:462489-462511 CCTCCCAAGGCTGAGGTGCTGGG + Intronic
1136929814 16:34409010-34409032 CCTCCCTACCCTGAGGGTTTGGG + Intergenic
1136974760 16:35002795-35002817 CCTCCCTACCCTGAGGGTTTGGG - Intergenic
1138790189 16:59894893-59894915 TCTTCCAACTGTGGGGTGTTGGG + Intergenic
1139188625 16:64836263-64836285 CCTCCCAGCTGTGAGGTGTGTGG - Intergenic
1140643306 16:77002506-77002528 CTTCCCACCCTTGAGGGGTTTGG - Intergenic
1147254372 17:39173411-39173433 CCTCCCTCTCCTGAGGTGTTGGG + Intergenic
1148492962 17:48035012-48035034 CCTCACAACTGTGAGATGTTGGG - Intronic
1152837389 17:82542568-82542590 CCTCCCAACCGTGAATTACTGGG + Intronic
1160218361 18:76953900-76953922 CCTCCCAAGCATGAGGAGTGTGG - Intronic
1162395691 19:10417091-10417113 CCTCCAAGCTGTGAGGAGTTTGG + Intronic
1164206066 19:23059822-23059844 CCTCCCATCTTTCAGGTGTTTGG + Intergenic
1164211157 19:23098476-23098498 CCTCCCATCGTTTAGGTGTTTGG - Intronic
928300507 2:30119872-30119894 CCTCCCAACAGTAATGTGTAAGG - Intergenic
942668061 2:178343409-178343431 GCTCACAACCTTGAGGTGTCAGG + Intronic
942830406 2:180232637-180232659 CCTCCCAACCCAGAAGTGTTGGG - Intergenic
1168998061 20:2147211-2147233 GCTCCCAACCCTGTGGTGCTAGG + Exonic
1169211005 20:3766428-3766450 CCTTCTAACAGTGAGGTGCTGGG + Intronic
1170778039 20:19395955-19395977 CCTCCAAACCCTGAGATGGTTGG + Intronic
1176235878 20:64053296-64053318 CCTCTCAACTGTTAGGTGTGGGG + Intronic
1182470690 22:30546497-30546519 CTTCCCAACCCTGAGGGGCTTGG - Intronic
1182483218 22:30623062-30623084 CCTTGCAACAGTGGGGTGTTGGG - Exonic
964504726 3:157386647-157386669 CCACACAACCGAGAGTTGTTTGG + Intronic
965621128 3:170643294-170643316 CCTCCCGCCTGTGAGGAGTTTGG + Intronic
969621482 4:8281008-8281030 CCTCCCAGCCGTGAGTCCTTGGG + Intronic
986148774 5:5107450-5107472 CCTCCCAACACTGTTGTGTTGGG - Intergenic
987255400 5:16145259-16145281 CCTACCAACCCTGCTGTGTTGGG - Intronic
990662523 5:58033169-58033191 TCTGCCCACCCTGAGGTGTTAGG - Intergenic
993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG + Intergenic
1000250166 5:159486758-159486780 CCTCCCCATCGTTAGATGTTTGG + Intergenic
1001539527 5:172527608-172527630 CCTCCCAACTCTGTGGTGCTGGG + Intergenic
1001549419 5:172592479-172592501 CCTCCTAGCTGTGAGATGTTGGG + Intergenic
1006513570 6:34534177-34534199 CCTCCTAACAGTGGGCTGTTGGG - Exonic
1006669198 6:35719092-35719114 GGTCCCAACCCTGAGGGGTTGGG + Intronic
1006671558 6:35732464-35732486 CATCCCAACAGTGTGGGGTTTGG - Intergenic
1007554762 6:42756581-42756603 CATCCTAAACATGAGGTGTTTGG - Intronic
1013072397 6:106740995-106741017 CCTCCAAACCATGCGGTCTTTGG + Intergenic
1014693644 6:124592496-124592518 CCTTTCAACAGTGAAGTGTTAGG - Intronic
1019179275 6:170176661-170176683 CCCCCCAAACGTGTGGAGTTGGG + Intergenic
1020271736 7:6600546-6600568 CCTCCCATCTGTGGGATGTTAGG - Intronic
1022226657 7:28370419-28370441 CCTCATAAAGGTGAGGTGTTTGG + Intronic
1025257115 7:57391805-57391827 CCTCCCAGCTGTGTGGTTTTTGG + Intergenic
1031072269 7:117174926-117174948 CCTCCCAAAAGTGATGTGCTGGG + Intronic
1032262480 7:130348137-130348159 CCTCCCACCCGTGTGGCTTTAGG - Intronic
1033234010 7:139623958-139623980 CCTCTCAACCCTGAGGTACTTGG - Intronic
1033930616 7:146515780-146515802 CCTCCAAATCATGAGGTGTGAGG + Intronic
1041628294 8:60056172-60056194 CCTTCCAACCCTAACGTGTTAGG + Intergenic
1043913177 8:85888509-85888531 CCTCCCAACCCTGTGGCATTGGG - Intergenic
1050662589 9:7899055-7899077 CCTCCCTACCATGAGGTGGTAGG - Intergenic
1055179018 9:73359806-73359828 CTTGCTAACCGTGTGGTGTTGGG + Intergenic
1059689655 9:116672798-116672820 CCTTCCAACTGGGTGGTGTTGGG + Intronic
1059984729 9:119811111-119811133 CCTCTCAACCGTGAGGTCCTAGG - Intergenic
1061434076 9:130549745-130549767 CCTCACTAACGTGAGGTCTTTGG - Intergenic
1062141511 9:134961598-134961620 CCTCCCTCCCGTGGGCTGTTCGG + Intergenic
1062285449 9:135770685-135770707 CCTCCCGTCCCAGAGGTGTTGGG - Intronic
1062521469 9:136959683-136959705 CCTCCCCACCGTGAGCCGTGCGG - Intergenic
1062672241 9:137717925-137717947 CCTCCCAACCCTGAGCTGCTGGG + Intronic
1189582148 X:42417898-42417920 CCTCCCAACAGTGTTGTATTGGG + Intergenic
1196909091 X:120468233-120468255 CCTCCCAGATGTGAGGTTTTGGG - Intronic
1198375972 X:136040604-136040626 CCTCCCAACCTTTGGATGTTTGG + Intronic
1200143442 X:153913400-153913422 CCTCCCCACCGTGAGGTAGAAGG + Exonic
1200163155 X:154019394-154019416 CCTCCCAGCCGTGGGGTGCCCGG + Intronic
1200229371 X:154436653-154436675 CCTCCCTACCCTGAGCGGTTAGG - Intergenic
1201142677 Y:11041629-11041651 CCTTCCAACCTTGTGGAGTTGGG - Intergenic
1201568853 Y:15393064-15393086 CCTCCCAACCCTGAAGAGTGAGG + Intergenic