ID: 1126010181

View in Genome Browser
Species Human (GRCh38)
Location 15:44295161-44295183
Sequence CACTTCAGCCCGGCGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9348
Summary {0: 1, 1: 0, 2: 12, 3: 584, 4: 8751}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126010181_1126010189 17 Left 1126010181 15:44295161-44295183 CCTCCACCCGCCGGGCTGAAGTG 0: 1
1: 0
2: 12
3: 584
4: 8751
Right 1126010189 15:44295201-44295223 TCCTGAGTAGCTGAGACTACAGG 0: 2329
1: 50429
2: 170412
3: 224564
4: 204159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126010181 Original CRISPR CACTTCAGCCCGGCGGGTGG AGG (reversed) Intronic
Too many off-targets to display for this crispr