ID: 1126010189

View in Genome Browser
Species Human (GRCh38)
Location 15:44295201-44295223
Sequence TCCTGAGTAGCTGAGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651893
Summary {0: 2329, 1: 50429, 2: 170412, 3: 224564, 4: 204159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126010182_1126010189 14 Left 1126010182 15:44295164-44295186 CCACCCGCCGGGCTGAAGTGATT 0: 1
1: 0
2: 17
3: 809
4: 14900
Right 1126010189 15:44295201-44295223 TCCTGAGTAGCTGAGACTACAGG 0: 2329
1: 50429
2: 170412
3: 224564
4: 204159
1126010181_1126010189 17 Left 1126010181 15:44295161-44295183 CCTCCACCCGCCGGGCTGAAGTG 0: 1
1: 0
2: 12
3: 584
4: 8751
Right 1126010189 15:44295201-44295223 TCCTGAGTAGCTGAGACTACAGG 0: 2329
1: 50429
2: 170412
3: 224564
4: 204159
1126010185_1126010189 7 Left 1126010185 15:44295171-44295193 CCGGGCTGAAGTGATTCTCCTGC 0: 34
1: 1758
2: 40585
3: 91837
4: 113385
Right 1126010189 15:44295201-44295223 TCCTGAGTAGCTGAGACTACAGG 0: 2329
1: 50429
2: 170412
3: 224564
4: 204159
1126010184_1126010189 10 Left 1126010184 15:44295168-44295190 CCGCCGGGCTGAAGTGATTCTCC 0: 1
1: 28
2: 749
3: 4198
4: 8650
Right 1126010189 15:44295201-44295223 TCCTGAGTAGCTGAGACTACAGG 0: 2329
1: 50429
2: 170412
3: 224564
4: 204159
1126010183_1126010189 11 Left 1126010183 15:44295167-44295189 CCCGCCGGGCTGAAGTGATTCTC 0: 1
1: 21
2: 1059
3: 22600
4: 106170
Right 1126010189 15:44295201-44295223 TCCTGAGTAGCTGAGACTACAGG 0: 2329
1: 50429
2: 170412
3: 224564
4: 204159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126010189 Original CRISPR TCCTGAGTAGCTGAGACTAC AGG Intronic
Too many off-targets to display for this crispr