ID: 1126011099

View in Genome Browser
Species Human (GRCh38)
Location 15:44303254-44303276
Sequence GGGTGCATAAATATGTACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126011099 Original CRISPR GGGTGCATAAATATGTACTA GGG Intronic
906887057 1:49660312-49660334 GGCTGCATAAATATATTCTTTGG - Intronic
907991742 1:59589237-59589259 GGGTGCATATATATTTAGGATGG - Intronic
909403550 1:75260475-75260497 GGGTGCATATATATTTAGGATGG - Intronic
910111477 1:83688201-83688223 GGGTGCATATATATTTAGGATGG + Intergenic
910627232 1:89320285-89320307 GGGTGCATATATATTTACAATGG + Intergenic
910945918 1:92591562-92591584 GGGTGCATATATATTTAGGATGG - Intronic
917019622 1:170571629-170571651 GGGTGCATATATATTTAGGATGG - Intergenic
917215379 1:172672800-172672822 GTGTGCATAAACATGTATTCTGG + Intergenic
918227633 1:182499362-182499384 GGGTGCATACATATATATTTAGG + Intronic
919555593 1:199048378-199048400 GGGTGCATATATATTTAGAATGG - Intergenic
924872001 1:248057326-248057348 GGGTTCATAAATATTTACAATGG + Intronic
924900651 1:248395278-248395300 GGGTGCATATATATTTAGGATGG + Intergenic
1065157791 10:22888080-22888102 GGGTGCATATATATTTAGGATGG - Intergenic
1067970546 10:50965154-50965176 GTGTGCATAAAAACATACTAAGG - Intergenic
1068469802 10:57447153-57447175 GGGTGCATATATATTTAGGATGG + Intergenic
1070272154 10:74966617-74966639 GAGTGAATGAATATGTATTATGG + Intronic
1071832710 10:89387794-89387816 GGATGAATAGATATGTAATAAGG + Intronic
1072368732 10:94742568-94742590 TGGTGCATAAATATTTAGGATGG + Intronic
1074344652 10:112672001-112672023 GTATGCATAAAAATGTACTATGG + Intronic
1075430184 10:122374123-122374145 TGGAGCATAAATATGTATTCTGG - Intergenic
1079719974 11:23798269-23798291 GGGTGCCTGAACATGTTCTACGG + Intergenic
1080213438 11:29814449-29814471 GGGTGCATATATATTTAAAATGG + Intergenic
1082135576 11:48545590-48545612 GGGTGCATATATATTTAGGATGG + Intergenic
1082557135 11:54576040-54576062 GGGTGCATATATATTTAGGATGG - Intergenic
1082591630 11:55018753-55018775 GGGTGCATATATATTTAGTATGG + Intergenic
1084728669 11:71059313-71059335 GGGTGAAAAAAAATGTTCTAAGG + Intronic
1085047357 11:73361431-73361453 GGCTGCATACATATGTACAGAGG + Intronic
1087003211 11:93442731-93442753 GGGTGCATATATATTTAGGATGG + Intergenic
1087506918 11:99035461-99035483 GGGTGCATATATATTTAGGATGG + Intronic
1087540501 11:99511734-99511756 GGGTGCATATATATTTAGCATGG + Intronic
1089680037 11:120114235-120114257 GGGTGGAAAAGTATGTAGTAGGG + Intronic
1090152439 11:124399835-124399857 GGTTACATAAATATGTACATGGG - Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1095319733 12:40812591-40812613 GGGTGCATATATATTTACAATGG + Intronic
1098876995 12:75876244-75876266 TGGTACATATATATATACTATGG + Intergenic
1099323700 12:81183748-81183770 GGGTGTATAAATATTTACAGTGG - Intronic
1100266499 12:92981338-92981360 GGGTGCATATATATTTAGGATGG - Intergenic
1101218306 12:102607991-102608013 GGGTGCATATATATCTAGGATGG + Intergenic
1106388263 13:29309213-29309235 TGGTGCATATATATACACTATGG + Intronic
1108157294 13:47598848-47598870 TGGTGCTTAAAGATGTACCAAGG - Intergenic
1109066696 13:57703314-57703336 GGGTGCATAAAGAACTTCTAGGG + Intronic
1112211829 13:97385358-97385380 GGCTGCACAAATATGTTATAAGG + Intronic
1112899743 13:104344043-104344065 GGGTGCATATATATTTAGGATGG + Intergenic
1114161615 14:20174524-20174546 GGCTGCATAAATGTTTACTGTGG - Intergenic
1115657404 14:35457051-35457073 GGGTGCATATATATTTATAATGG + Intergenic
1116273117 14:42797947-42797969 GGGTGCATATATATTCACAATGG + Intergenic
1117576844 14:57107237-57107259 GGGTGCATATATATTTAAGATGG - Intergenic
1118894979 14:69938384-69938406 GAGTGGATAAATATTTTCTAAGG + Intronic
1119848778 14:77850481-77850503 GGGTGCATAAATGTTTAGGATGG + Intronic
1120057892 14:79947109-79947131 GGATGAAAAAATATGTCCTATGG + Intergenic
1122833320 14:104415713-104415735 GGGTGCATATATATTTAGGATGG + Intergenic
1126011099 15:44303254-44303276 GGGTGCATAAATATGTACTAGGG + Intronic
1129588538 15:76893381-76893403 GGGTGCGTACATATCTACAACGG - Intronic
1130729552 15:86476531-86476553 GGGTGCATATATATTTAGGATGG - Intronic
1139621827 16:68151486-68151508 GGGGGTATTAATATATACTAAGG + Intronic
1140027970 16:71308780-71308802 GGGTGCATATATATTTAGGATGG - Intergenic
1140766533 16:78164700-78164722 GTCTACATAAATATTTACTAAGG + Intronic
1141221618 16:82074652-82074674 GGGTGCATGTATATTTACAATGG - Intronic
1141708661 16:85684561-85684583 CGGTGAACAAATATGTAGTATGG + Intronic
1146611618 17:34310585-34310607 GTGTGCATATATATGTACATAGG - Intergenic
1151262276 17:72925594-72925616 GGGGACATAAACATCTACTAAGG - Intronic
1151920211 17:77148902-77148924 GTGTGCATAATTATGAAATAAGG - Intronic
1156376858 18:36522455-36522477 AGGTGGATATATATCTACTAGGG + Intronic
1156433336 18:37099766-37099788 GGGTGCATATATATTTAGGATGG + Intronic
1156434676 18:37113959-37113981 GGGTGCATATATATTTAGGATGG - Intronic
1156891084 18:42189911-42189933 GGGTGAAGAAATAGGTACAAGGG + Intergenic
1156905166 18:42343887-42343909 GTTTGCATAACTATGTACTGTGG + Intergenic
1158736486 18:60087834-60087856 GTGTGGAAAAATATGTAATAGGG - Intergenic
1160530899 18:79561892-79561914 GGATGCAGAAACAGGTACTAAGG + Intergenic
1161826587 19:6571072-6571094 GGGTGCATATATATTAACAATGG + Intergenic
1163872887 19:19838294-19838316 AAGTGAATAAATATGTAATATGG + Intergenic
1164094123 19:21989864-21989886 GGCTGCATAAATATCTTCTTTGG + Intronic
924958659 2:13395-13417 TGTAGCATAAATTTGTACTATGG + Intergenic
925461094 2:4063317-4063339 GTGTGTATACATATGTATTAGGG - Intergenic
926011700 2:9413657-9413679 AGCTGCATAAATATCTACAAGGG + Intronic
927117434 2:19918697-19918719 GGGTCCATATATATTTACGATGG - Intronic
928768716 2:34679208-34679230 GGGTACATAGATATTTACTTCGG + Intergenic
930791234 2:55331086-55331108 GGGTTCATAAATTTATAATAGGG + Intronic
930926432 2:56823520-56823542 GGGTGCATAAAAATCCACTAAGG - Intergenic
931572543 2:63683923-63683945 GGGTGCATATATATTTACAATGG - Intronic
932377325 2:71249106-71249128 GGGTGCATATATATTTAGGATGG + Intergenic
932540362 2:72645240-72645262 GGGTGCATATATATTTAGCATGG - Intronic
936880102 2:117240235-117240257 GGGTTCATAAATAGGTAAGAGGG + Intergenic
937143450 2:119621343-119621365 GGGTGCATATATATTTAGGATGG - Intronic
939690013 2:145247448-145247470 GATTGCATATATTTGTACTATGG - Intergenic
939725091 2:145709457-145709479 AGGTGCATATATATTTACAATGG + Intergenic
939885224 2:147674058-147674080 GGGTGTATAAATATTGACTAGGG - Intergenic
940114663 2:150194625-150194647 GGGTGCATATATATGTACGATGG - Intergenic
941088298 2:161144988-161145010 GGGTGCATATATATTTAGGATGG + Intronic
942272279 2:174288402-174288424 GGGTGCATATATATTTAGGATGG - Intergenic
943087969 2:183336844-183336866 GAGTGCATATATATTTACAATGG + Intergenic
943267113 2:185746173-185746195 TGGTACATCAATATGTATTATGG - Intronic
943512096 2:188839008-188839030 GGGTGCATAGATATTTATAATGG - Intergenic
945056481 2:205873786-205873808 TGGCGCATAAAAATGGACTAGGG - Intergenic
945927661 2:215821783-215821805 GGGTGCATATATATTTAGGATGG - Intergenic
946696629 2:222366412-222366434 GGGTGCATATATATTTAGGATGG + Intergenic
948267172 2:236643440-236643462 GGCTGCATAAATGTGTTCTGAGG - Intergenic
1169867332 20:10216279-10216301 GGGTACATAAAAATCTGCTAGGG - Intergenic
1170123023 20:12931699-12931721 GGGAGTATGAAAATGTACTAAGG - Intergenic
1171120463 20:22564098-22564120 GGGAGCTTAAATATCTACCATGG + Intergenic
1177234324 21:18367044-18367066 AGGTGCATAAAAATTTACTTTGG + Intronic
1177824962 21:26072563-26072585 GAATGCATAAATATTTCCTAGGG + Intronic
1177931668 21:27293174-27293196 GGATGCATGAATATTTAGTAAGG + Intergenic
949155253 3:818943-818965 TGGTGCATACATATTTAGTATGG - Intergenic
949687736 3:6596927-6596949 GAGTGCATATATATTTACAATGG + Intergenic
950852754 3:16078543-16078565 GTGAGCATAAATATGTACATGGG + Intergenic
950927547 3:16757462-16757484 AGGTGCATATATATTTACAATGG + Intergenic
951269974 3:20612768-20612790 GGGTGCATATATATTTATAAAGG - Intergenic
951379245 3:21962808-21962830 GGGAACATTAATATGTACTAGGG + Intronic
951736192 3:25867554-25867576 GGCTACATAAATATGCACGATGG - Intronic
953554988 3:43938125-43938147 GGGTGCATATATATTTAAGATGG + Intergenic
956111318 3:65872315-65872337 GGGTACATAAATTTTTAATATGG - Intronic
956709024 3:72024042-72024064 GGGTGCAGAAATAAGGACTGGGG - Intergenic
956866257 3:73372151-73372173 GGGTGCATATATATTTAGGATGG + Intergenic
956978599 3:74611369-74611391 GGGAAAATAAAAATGTACTATGG + Intergenic
957287345 3:78233356-78233378 GGGTGCATACATATTTACAATGG - Intergenic
957308537 3:78489452-78489474 GGGTGCATATATATTTAGGATGG - Intergenic
957938941 3:86979773-86979795 GTGTGCATATATATGTTCTGAGG + Intronic
959234106 3:103695923-103695945 TGTTGAATAAATATGTACAAAGG + Intergenic
959237609 3:103745051-103745073 GTGTACATATATATGTATTAAGG - Intergenic
959449087 3:106477431-106477453 GGGTGCGTATATATTTACAATGG + Intergenic
959846348 3:111038281-111038303 GGGTGCATATATATTTAGAATGG - Intergenic
959998835 3:112709177-112709199 GGGTGCATATATATTTAAGATGG + Intergenic
960233701 3:115257126-115257148 GGGTGCATATATATTTAGAATGG - Intergenic
962082502 3:132155657-132155679 CAGTGCATCAATTTGTACTAGGG - Intronic
963035219 3:141019849-141019871 GGGTGCGTGATTATGTACAAGGG + Intergenic
964857256 3:161159842-161159864 GGATGCATAAAAATGTTCCAAGG + Intronic
965194348 3:165574640-165574662 GGGTGCATATATATTTAGGATGG - Intergenic
969708191 4:8825173-8825195 GGGTGCATAAATATTAAGGATGG - Intergenic
971605095 4:28649072-28649094 GGGTGCATATATATTTAGGATGG + Intergenic
973556579 4:52089974-52089996 GGGTGCATATATATTTAGGATGG + Intronic
974196553 4:58583294-58583316 GGGTGCATATATATATATTTAGG + Intergenic
977771501 4:100866495-100866517 GGGTGCATATATATTTAGGATGG + Intronic
977831451 4:101598850-101598872 GGGTGGATTAATATGTAGGATGG + Intronic
978068725 4:104439455-104439477 GGGTGCATATATATTTAGGATGG - Intergenic
978543676 4:109846870-109846892 GGGTGCATGACGATGTATTATGG - Intergenic
981600579 4:146483931-146483953 AGGTGCATAAATATTTACTGTGG - Intronic
982141243 4:152320993-152321015 GGGTGTATAAATATGAAATCTGG - Intergenic
983032542 4:162821048-162821070 AGGTGTAAAAATATATACTATGG + Intergenic
983681760 4:170361536-170361558 GGGTGCATATATATTTAAGATGG + Intergenic
983749692 4:171251014-171251036 AGGTGCATAAATATTTAGGATGG + Intergenic
986800669 5:11256883-11256905 TGTTGCATAAATATGTTATAAGG - Intronic
987838239 5:23188579-23188601 GGGTGCATATATATTTAGGATGG - Intergenic
988770906 5:34432440-34432462 GGGTGCATATATATTTAGGATGG + Intergenic
988929082 5:36017915-36017937 GCATGCATAAATATGTATTCAGG + Intergenic
989657188 5:43757770-43757792 GGGTGCATATATATTTAGGATGG + Intergenic
990229442 5:53695905-53695927 GGGTGCATATATATTTATAATGG - Intergenic
990578201 5:57143992-57144014 GGGTGGATATATATTTACAATGG + Intergenic
992292101 5:75290333-75290355 GGGTGCATATATATTTAGAACGG + Intergenic
992634299 5:78712184-78712206 GGGTGCATATATATTTAGGATGG - Intronic
993303648 5:86247365-86247387 GAATGCATAAAAATGTAGTAAGG - Intergenic
993914213 5:93722194-93722216 GGGTACTTAAATAAGAACTATGG + Intronic
994327637 5:98466993-98467015 GGGTGCATATATATCTAGGATGG - Intergenic
994542108 5:101112145-101112167 GGGTGCATATATATTTAGGATGG + Intergenic
995093673 5:108211001-108211023 GGGTGCATATATATTTAGGATGG + Intronic
995268402 5:110192228-110192250 GGGTGCATATATATTTACAGTGG + Intergenic
995978029 5:118065634-118065656 GGGTGCATATATATTTAGCATGG + Intergenic
996952414 5:129143293-129143315 GGGTTCAGAAATGTTTACTATGG + Intergenic
1003416645 6:5915547-5915569 GGGTGCATATATATTTAGGATGG + Intergenic
1004068688 6:12276608-12276630 GGCTTCATAAATATGTACGTTGG + Intergenic
1004363889 6:14996060-14996082 GGTTGCACAAATATGTATTGTGG + Intergenic
1004967283 6:20867973-20867995 GGGGGCATGAATAGGTATTAAGG + Intronic
1007882396 6:45182067-45182089 TGGTGCATAAAAATTTATTAAGG - Intronic
1009000090 6:57702849-57702871 GGGTGCATATATATTTAGGATGG - Intergenic
1009191323 6:60633479-60633501 GGGTGCATATATATTTAGGATGG + Intergenic
1009393477 6:63169417-63169439 GGGTGCATATATATTTAGTATGG - Intergenic
1010759293 6:79703935-79703957 GGGAGCATAAATTAGTACTCTGG - Intergenic
1011359141 6:86503179-86503201 GTGTGCATAAATATCTGTTAAGG - Intergenic
1012082823 6:94783150-94783172 GGGTGCATATATATTTAGAATGG + Intergenic
1012118689 6:95337008-95337030 GGCTGCATAAATATCTTCTTTGG - Intergenic
1013299346 6:108789142-108789164 AGGTTCATAAAAATGTACTAAGG - Intergenic
1014176786 6:118340233-118340255 GGGTGCATATATATTTAGGATGG + Intergenic
1014566470 6:122955519-122955541 GGGTGCATAAATATTAAGGATGG - Intergenic
1014833811 6:126134450-126134472 GGTTGCATATGTATTTACTATGG - Intergenic
1016221474 6:141676430-141676452 GGGTGCATATGCATGTATTATGG - Intergenic
1016387856 6:143545701-143545723 GGGGTGATAGATATGTACTAGGG - Intronic
1016985561 6:149892489-149892511 GGCTGCATAAATATCTTCTTTGG + Intronic
1020741948 7:12031315-12031337 GGGAGCATAAATTAGTACTTGGG - Intergenic
1020996786 7:15275725-15275747 GGGTGCATATATATTTAGGATGG + Intronic
1021238513 7:18173142-18173164 GGGTGCATTTATATTTAGTATGG + Intronic
1021824517 7:24535300-24535322 GGGTGCATATATATTTAGGATGG + Intergenic
1022111375 7:27234499-27234521 AGATGCATAAATCTGTACTAGGG + Intergenic
1024842788 7:53605898-53605920 GGGTGCATATATATCTAAGATGG - Intergenic
1025873431 7:65456955-65456977 GGCTCTATAAATTTGTACTATGG - Intergenic
1027964745 7:84991135-84991157 GGGTGCATATATATTTAGGATGG + Intergenic
1028946223 7:96583663-96583685 GGGTGCATATATATTTAGGATGG + Intronic
1031384787 7:121135620-121135642 TGTTTCATAAATATGTATTAAGG + Intronic
1036991299 8:13598784-13598806 TGGTGTAACAATATGTACTAGGG - Intergenic
1037030201 8:14094917-14094939 GGCTGCATAAATATCTTCTTTGG + Intronic
1037082661 8:14805530-14805552 GGGTGCATATATATTTAGGATGG - Intronic
1037403736 8:18519862-18519884 TGGTGCATTAATGTCTACTAGGG - Intergenic
1040540896 8:48354175-48354197 GGGTGCATATATATTTAGGATGG - Intergenic
1042308491 8:67356629-67356651 GGGTGCATATATATTTAGGATGG + Intergenic
1042976476 8:74475972-74475994 GGGTGCATATATATTTAAGATGG + Intronic
1043748670 8:83908167-83908189 GGGTGCATATATATTTAGGATGG + Intergenic
1045620192 8:103968192-103968214 GGATGGAAAAAAATGTACTATGG - Intronic
1045785937 8:105920270-105920292 GGGTGCATATATATTTAGGATGG - Intergenic
1046238437 8:111458054-111458076 ATGTGTATATATATGTACTAAGG - Intergenic
1046738831 8:117807141-117807163 TGCTGCATAAATAGGAACTAAGG - Intronic
1047473211 8:125199867-125199889 GGGTGCATATATATTTAGAATGG + Intronic
1047538564 8:125742375-125742397 GGGTGCATATATATTTAGGATGG + Intergenic
1047604360 8:126459714-126459736 GGGTGCATATATATTTAGGATGG - Intergenic
1049060047 8:140269615-140269637 GGCTGGATAGATATGTAATAAGG + Intronic
1052143790 9:25023242-25023264 GGGTGCATATATATTTATTTAGG + Intergenic
1054956593 9:70918078-70918100 GGGTGCAAATATATTTACAATGG - Intronic
1055231475 9:74072031-74072053 GGGTGCATATATATTTAGAATGG + Intergenic
1056684500 9:88748432-88748454 TGGTGCATATGTCTGTACTATGG + Intergenic
1058353365 9:104053803-104053825 GGGTGCATATATATTTATGATGG + Intergenic
1058441711 9:105014508-105014530 GGGTGCATATATATTTAGGATGG + Intergenic
1060035684 9:120253646-120253668 GGGAGCATAAATATGTTCTATGG - Intergenic
1186544750 X:10437036-10437058 CATTGCGTAAATATGTACTAAGG + Intergenic
1187293652 X:17978511-17978533 GGCTTTATAAATATTTACTATGG + Intergenic
1190606484 X:52148826-52148848 GGGTGCATATATATTTAGGATGG + Intergenic
1191159605 X:57314190-57314212 GGGTGCATACATATTTAAGATGG - Intronic
1191168313 X:57415916-57415938 GGGTGCATATATATTTAGGATGG + Intronic
1191180664 X:57559810-57559832 GGGTGCATATATATTTAGGATGG - Intergenic
1191208334 X:57857433-57857455 GGGTGCATATATATTTGGTATGG - Intergenic
1191823866 X:65342217-65342239 GGGTGCATACATATTTAAGATGG - Intergenic
1191825299 X:65358147-65358169 GGGTGCATATATATTTAGGATGG - Intergenic
1192712395 X:73605190-73605212 GGGTGCATATATATTTAGGATGG + Intronic
1193062600 X:77222389-77222411 GGGTGCATATATATATATTTAGG - Intergenic
1194525766 X:94975977-94975999 GGGTGCATATATATTTAGGATGG + Intergenic
1194537656 X:95126151-95126173 GGGAGAATAAATATGTATTTTGG + Intergenic
1194837233 X:98696792-98696814 GGGTGCATATATATTTAGGATGG + Intergenic
1195354918 X:104030567-104030589 GGGTGCATATATATTTAGGATGG + Intergenic
1195419404 X:104656866-104656888 GGGTGCATATATATTTAGGATGG + Intronic
1195434449 X:104826801-104826823 GGGTGCATATATATTTAGGATGG + Intronic
1195932633 X:110094375-110094397 GGGTGCATATATATTTAGAATGG + Intronic
1196253903 X:113493513-113493535 GGGGGCATATATATATACAAAGG + Intergenic
1196361324 X:114863823-114863845 GGGTGCATAAATATTTACAATGG + Intronic
1199137337 X:144268161-144268183 GGGTGCATATATATTTAGGATGG - Intergenic
1201234779 Y:11898835-11898857 GGCTGCATAAATATCTTCTTTGG - Intergenic
1201503611 Y:14673388-14673410 GGCTGCATAAATATCTTCTTTGG - Intronic