ID: 1126012751

View in Genome Browser
Species Human (GRCh38)
Location 15:44318869-44318891
Sequence TAATTCTCTGTTGCAGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126012746_1126012751 9 Left 1126012746 15:44318837-44318859 CCTTTCTAGCCATATTTCTTACC 0: 1
1: 0
2: 0
3: 28
4: 245
Right 1126012751 15:44318869-44318891 TAATTCTCTGTTGCAGCTACTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1126012745_1126012751 18 Left 1126012745 15:44318828-44318850 CCTTACTTACCTTTCTAGCCATA 0: 1
1: 0
2: 0
3: 29
4: 231
Right 1126012751 15:44318869-44318891 TAATTCTCTGTTGCAGCTACTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1126012747_1126012751 0 Left 1126012747 15:44318846-44318868 CCATATTTCTTACCAGTTCTCCC 0: 1
1: 0
2: 2
3: 54
4: 345
Right 1126012751 15:44318869-44318891 TAATTCTCTGTTGCAGCTACTGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126012751 Original CRISPR TAATTCTCTGTTGCAGCTAC TGG Intronic
900302764 1:1986279-1986301 CAATTCTCTGCTGCAGCCTCCGG - Intronic
907805962 1:57820445-57820467 AAATTCTCAATTGCAGCTTCTGG - Intronic
907863149 1:58373034-58373056 TAATTCTCTGTGGAAGGAACAGG + Intronic
908277928 1:62495675-62495697 TAATTCTCTGCTGCAGGTCCAGG - Exonic
910868108 1:91806276-91806298 GAATGCTGTGTTGCAGCTAAAGG - Intronic
911948282 1:104138679-104138701 TGATTCACTGTTGCTGCAACGGG + Intergenic
913411558 1:118557733-118557755 TAATTCACTGTCACAGCTCCTGG - Intergenic
916348027 1:163816383-163816405 TACTTATCTTTTGCAGCCACAGG - Intergenic
916430033 1:164719113-164719135 TAGGTCTCTTTTGCAGCTCCTGG - Intronic
918771150 1:188561744-188561766 TAATTATCTGTTGCTACTACTGG - Intergenic
920689493 1:208135043-208135065 TAGTTTTCTGGTGCAGCTGCTGG + Intronic
921580099 1:216886255-216886277 AAATTCCCTGTTGCAGCTCCAGG - Intronic
922170386 1:223149638-223149660 ACATTCTCTGTGGCAGCTTCAGG + Intergenic
924596451 1:245449056-245449078 TTATTCTGTGTTGCGGCTTCTGG + Intronic
1064491427 10:15861002-15861024 TAATTCTGCGTTGCAGCTGGTGG - Intergenic
1065023923 10:21523845-21523867 TCTTTCACTGCTGCAGCTACTGG + Exonic
1067838987 10:49661088-49661110 TTGTTCTCTGTTGTGGCTACAGG + Intronic
1069770333 10:70894525-70894547 TCATTCTCTGCTGCAGCTTTTGG + Intergenic
1070834644 10:79440580-79440602 TTCTTCTGTGTTCCAGCTACGGG - Intronic
1074397740 10:113112491-113112513 TAATTCCCTGTAGCAGCTTGGGG + Intronic
1074896885 10:117784784-117784806 TAATTCTCTGTTGCCCAAACAGG - Intergenic
1076032409 10:127170675-127170697 TAATTCACTGTAGCAGCTATGGG - Intronic
1080791571 11:35526192-35526214 TTATTATCTTTTGCAACTACAGG + Intronic
1087736891 11:101844076-101844098 TAATTCTCTGTTGAGTCTTCTGG + Intronic
1087877649 11:103376518-103376540 AAATACTCTGTTACAACTACAGG - Intronic
1087990217 11:104740183-104740205 TTATGCTCTGTTGAAGCTATGGG + Intergenic
1092796629 12:12116618-12116640 TAATTCTCTGGTGTTGCTTCTGG + Exonic
1092859399 12:12707172-12707194 TAATTTTGTGTTGCAGGCACAGG - Intergenic
1093484618 12:19639950-19639972 TAATTCACTGCTGCACCTGCTGG + Intronic
1097777710 12:63668114-63668136 TAATTCCCTGGCGCAGCTCCGGG - Exonic
1098711446 12:73767717-73767739 TATTTCTCTCTTGCATCAACTGG + Intergenic
1098800982 12:74957575-74957597 TATTTCCCTGTTGAAGCTATTGG - Intergenic
1103144120 12:118579339-118579361 TAATTCTCTGTTGCACACACTGG - Intergenic
1104423713 12:128657757-128657779 TATTGGTCTGGTGCAGCTACAGG + Intronic
1109879804 13:68457194-68457216 TTATTCTCTGTTTCAACTTCTGG + Intergenic
1110546764 13:76764808-76764830 TAATTCTGTCTTGTTGCTACTGG + Intergenic
1112155419 13:96811581-96811603 TACTACTATGTTGCAGCCACTGG - Intronic
1113004682 13:105686837-105686859 TAGTGCTCTGTTGCAACTGCTGG + Intergenic
1114767220 14:25387267-25387289 CACTTCTCTGTATCAGCTACTGG - Intergenic
1116608485 14:47034476-47034498 TAATTCACTGTTACAACTTCAGG + Intronic
1117030064 14:51659473-51659495 TATTTCTCAGTTACAGATACTGG + Intronic
1120263370 14:82217220-82217242 TAATTGTCTGTTGCAATTCCAGG + Intergenic
1124846241 15:33293901-33293923 TGATTCTCAAATGCAGCTACTGG + Intergenic
1125321996 15:38498853-38498875 TTGTTCTCTGTGGGAGCTACTGG + Exonic
1126012751 15:44318869-44318891 TAATTCTCTGTTGCAGCTACTGG + Intronic
1127274741 15:57432271-57432293 TAATTCTCAGTGGCACCTCCAGG - Intronic
1128946354 15:71824820-71824842 TAATTCTGAGTGGCAGCTAAAGG - Exonic
1132402437 15:101521170-101521192 TAATTCCATGATGCAGCTTCAGG - Intronic
1134011048 16:10853385-10853407 TCATCCTCCGTGGCAGCTACAGG - Intergenic
1138110019 16:54316344-54316366 TAATTCTCTGTGCCAGGGACTGG - Intergenic
1138861514 16:60763773-60763795 AAATCCTCTGTTGCAGCTTCTGG - Intergenic
1144407007 17:14961570-14961592 TAATTCTCTTTTGTAGCTGCTGG - Intergenic
1147911911 17:43861118-43861140 CAAGTCTCTGTTACAGCCACTGG + Intronic
1148577735 17:48723332-48723354 TAATTCGCGGTTGCAGCTCGGGG + Intronic
1151304054 17:73251565-73251587 TGGGTCTCTGTTGCAGCCACTGG + Intronic
1153522505 18:5966016-5966038 TAGTTCTCTGTTGTGGGTACAGG - Intronic
1155112456 18:22729568-22729590 TTATTCTCCCTTGCAGCTAAGGG + Intergenic
1155867272 18:30981375-30981397 TATTTGTCTGTTTCAGCTCCTGG + Intergenic
1156410185 18:36820552-36820574 TAATTCTCTGTTACAGGAAATGG + Intronic
1159794399 18:72823836-72823858 CATGTCTCTGTGGCAGCTACTGG - Intronic
1162681588 19:12347620-12347642 TTATTCTCTGTTGAAGTTATGGG - Intergenic
1162753949 19:12846044-12846066 TAATTCTTTTTTGCAGAGACAGG - Intronic
1165304522 19:34995343-34995365 TAAACCTCAGTTCCAGCTACAGG + Intronic
1166220022 19:41358096-41358118 TGTTTCTCTGTGGCATCTACTGG + Intronic
1167092284 19:47352923-47352945 TAGTTCTCTATTGCAGGCACTGG + Exonic
1168201573 19:54819206-54819228 TAATTTTCTGCAGCAGCAACAGG + Intronic
1168206312 19:54852889-54852911 TAATTTTCTGCAGCAGCAACAGG + Intronic
1168677138 19:58286711-58286733 AAATTCTCAGTTGCAGCCAAAGG + Exonic
927866270 2:26589732-26589754 TAAGTCTCCTTTGCAGCTATGGG + Intronic
941760876 2:169241544-169241566 TATTTCTTTGTGGCAGCTAGTGG + Intronic
943682228 2:190780650-190780672 TAATTCTCCTTTGCAGCTAGAGG + Intergenic
943944008 2:194035385-194035407 TAATACTCAGTTGCAGCTAAGGG - Intergenic
944861277 2:203818050-203818072 TAATTCTCTGATCCAGTAACTGG + Intergenic
944926698 2:204472680-204472702 TAATCATCTGTTGCAGTTGCGGG - Intergenic
946447130 2:219749552-219749574 TAATTCTTTGTTGCAGGTGAAGG - Intergenic
947404567 2:229761506-229761528 TAATTGTGTGTTGCAGCTTTTGG - Intergenic
947504445 2:230696316-230696338 TAATTCTCAGATTCAACTACTGG - Intergenic
948639529 2:239366344-239366366 TGATGCTCTGTTGCTGCTAACGG - Intronic
948770300 2:240248301-240248323 TAGTTCTCTGCTGGAGCTCCTGG - Intergenic
1169872264 20:10260497-10260519 TCATTCTCTGATGCTGCTGCTGG - Intronic
1170641135 20:18154012-18154034 TAATTCTCTTTTGCTTCTTCTGG - Intronic
1171376747 20:24699125-24699147 TGACTCTCAGTGGCAGCTACAGG + Intergenic
1175711427 20:61224510-61224532 TGATTCTCTGCCCCAGCTACAGG + Intergenic
1181144835 22:20837768-20837790 TATTTTTTTGTTGGAGCTACAGG + Intronic
1181152522 22:20895242-20895264 CAATTGTCTGTTGCAGCTATGGG - Intergenic
949101177 3:147179-147201 TAATTTCCTGTTGCTGCTGCTGG + Intergenic
950574675 3:13824938-13824960 TCATTCTCTTTAGCAGCTATAGG - Intronic
951681276 3:25297282-25297304 TAATTCTATGTTTCAGTTATAGG - Intronic
951801998 3:26606101-26606123 TAATTCTCTAATGCAGCTCAAGG - Intergenic
954112675 3:48443832-48443854 TATTTTTCTTTTGCAGCCACAGG + Exonic
954276774 3:49547333-49547355 TTATGCTCTGTTGAAGCTATAGG - Intergenic
958504860 3:94962196-94962218 TAATTCTCTGTTGAAAATAAGGG - Intergenic
962568586 3:136689579-136689601 TAATTCTGTTTTTCAGCTTCTGG + Intronic
962573065 3:136730700-136730722 TAATTCTAAGGTGCAGCCACTGG + Intronic
964035378 3:152189477-152189499 TAATTATCTATGGCAGCTAAAGG - Intergenic
966452009 3:180073661-180073683 GAATTCTCTTTTGGAGCCACTGG - Intergenic
967016872 3:185490167-185490189 CAATTCTGTACTGCAGCTACAGG + Exonic
969430656 4:7152052-7152074 TAATTCTCTGTTCCAGAGACAGG + Intergenic
971226749 4:24761133-24761155 TAAATCTCAGTTGCAGTAACTGG - Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
977287890 4:95131966-95131988 AAATTCACTGTTTCAGGTACAGG - Intronic
979209797 4:118086096-118086118 TAATTTTCAGGTACAGCTACAGG - Intronic
980554765 4:134388652-134388674 TTATGCTCTGTTGAAGATACAGG + Intergenic
981110740 4:140930455-140930477 CAATTCGCTGTTGCATCTCCGGG + Intronic
981119342 4:141031076-141031098 TAATTATTAGTTGGAGCTACAGG - Intronic
985868470 5:2534956-2534978 TAATTCTCAGTTGCAAATTCAGG + Intergenic
985999757 5:3621093-3621115 TAATTCTCTGCTGCAGAAAGGGG - Intergenic
988615949 5:32774907-32774929 TATTTCTCAGTTGCAGCTGTGGG + Intronic
989004318 5:36792953-36792975 TAAGTCTTTGTAGCAGCTGCTGG - Intergenic
989225449 5:39022543-39022565 TTGTTCTGTGTTGCAGCTAAAGG + Intronic
990474849 5:56152585-56152607 GGCTTGTCTGTTGCAGCTACCGG - Intronic
991085292 5:62643620-62643642 TTACTCTCTGTTGGAGCTCCTGG - Intergenic
992613178 5:78525024-78525046 TAATTCTTTGTTGCAGGGGCTGG + Intronic
996983247 5:129526268-129526290 CAATTCTCTGTTGCAGATAAAGG + Exonic
997181005 5:131829088-131829110 TATTTCTCTGTGGAAGCTAGAGG - Intronic
998623941 5:143824266-143824288 TCCTTCTCTATTGCAGCCACCGG - Intergenic
998694310 5:144621572-144621594 TAATTCACTTTTACAGCTAAAGG + Intergenic
1000419299 5:161020158-161020180 TAATTCTCTGATCCATCAACCGG - Intergenic
1004138159 6:12989009-12989031 TGAATCTTTGTTGCAGCAACAGG - Intronic
1005351646 6:24941694-24941716 TTATTATCAGTAGCAGCTACAGG - Intronic
1010184897 6:73132689-73132711 TGATTTGCTGTGGCAGCTACTGG - Intronic
1011528898 6:88298361-88298383 TTATGCTCTGTTGAAGCTATGGG + Intergenic
1011915479 6:92500636-92500658 TAATTATTTGTTTCAGCTTCAGG + Intergenic
1014649156 6:124014046-124014068 TAATTTGCTGTAGCAGCAACAGG + Intronic
1016377911 6:143442883-143442905 TAAGTCACTGTTCAAGCTACTGG - Intronic
1019385855 7:755850-755872 TAGTTCTCTGTGGAACCTACAGG + Intronic
1020605072 7:10326934-10326956 TAATGGTCTGCTGCAGCTGCAGG + Intergenic
1021431539 7:20564469-20564491 GAATTCTCTGGTGCAGCCATGGG - Intergenic
1022360383 7:29650946-29650968 TAATTTCCTGGTGCAGCTCCGGG + Intergenic
1022916760 7:34963549-34963571 TACTTCTGTGTTTCAGCTATAGG - Intronic
1022936642 7:35185777-35185799 TAATTCCCTGGCGCAGCTCCGGG - Intergenic
1024038926 7:45534240-45534262 TGATTCTCTGGTCCAGCTAGGGG + Intergenic
1024470362 7:49763582-49763604 TGATTCTCAGTTGGAGCTGCCGG - Intergenic
1027640517 7:80727877-80727899 CACTTCTCTGTTACAGCAACTGG + Intergenic
1027788168 7:82606370-82606392 TCATGCTCTATTTCAGCTACGGG - Intergenic
1028029154 7:85887354-85887376 TACTTCCCTCTTGCAGCTCCTGG - Intergenic
1028373471 7:90119786-90119808 TAATTCCCTGGCGCAGCTCCGGG + Intergenic
1029832875 7:103279888-103279910 TAATTCCCTGGCGCAGCTCCGGG - Intergenic
1031800518 7:126237989-126238011 TAATTCTCTGTTGTAGACAGGGG - Intergenic
1032024494 7:128430738-128430760 TATTTCCCTGTTGCACCTATAGG + Intergenic
1034849291 7:154479208-154479230 TACTTGTTTGTTGCAACTACTGG + Intronic
1036491495 8:9230275-9230297 TGATTCTCATATGCAGCTACGGG + Intergenic
1044041467 8:87373979-87374001 GAATTCAGTGTTACAGCTACTGG + Intronic
1047349576 8:124060786-124060808 TAATTCTTTCTCGCAGCTAGTGG - Intronic
1050266326 9:3893924-3893946 TACTTCTCTGTTGTAGGCACTGG - Intronic
1052752115 9:32502556-32502578 TAATTCGTTATTGCAGCCACAGG - Intronic
1061280619 9:129596139-129596161 TTATGCTCTGTTGAAGCTATGGG + Intergenic
1186931858 X:14400877-14400899 GAATTCTCTTTTGCAGCCTCAGG + Intergenic
1189176628 X:38963853-38963875 TTATTTTCTGTTGCATCTCCAGG + Intergenic
1190951339 X:55146634-55146656 TACTTCTCTGATGCAGTTATTGG - Intronic
1197389916 X:125849124-125849146 TAATGATTTGTTGCAGCTAAAGG - Intergenic
1198053644 X:132972938-132972960 TGATCCTCTGTGGCAGCTAAAGG + Intergenic
1198529413 X:137536012-137536034 CAATTCTCTGCTTCAGCTTCCGG + Intergenic
1199056801 X:143306200-143306222 TAGCTCTCTGTAGCAGATACTGG + Intergenic
1199515704 X:148673246-148673268 TGATATTCTGTTGCAGCTACAGG - Intronic