ID: 1126020342

View in Genome Browser
Species Human (GRCh38)
Location 15:44394306-44394328
Sequence CAGGGGATACATTCTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126020338_1126020342 0 Left 1126020338 15:44394283-44394305 CCACGGAATACATTGCATCACAA 0: 1
1: 0
2: 1
3: 1
4: 91
Right 1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG 0: 1
1: 0
2: 6
3: 33
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126020342 Original CRISPR CAGGGGATACATTCTGAGAA AGG Intronic
900469443 1:2846067-2846089 CAGGGAAGAAAGTCTGAGAACGG - Intergenic
906970207 1:50505314-50505336 GAGAGCATACATTCTGAGAAAGG + Intronic
907947141 1:59146584-59146606 GAGGGGACAAATGCTGAGAATGG + Intergenic
908111270 1:60900827-60900849 ACAGGGATACGTTCTGAGAAAGG - Intronic
908770655 1:67592738-67592760 TGAGGGAAACATTCTGAGAAGGG + Intergenic
909726512 1:78842513-78842535 CAGTGGAAATATTTTGAGAATGG - Intergenic
910664649 1:89711187-89711209 CAGTGTATATTTTCTGAGAAAGG - Intronic
913251289 1:116913615-116913637 CAGGGGAAACAATCAGAGTAGGG - Intronic
913453436 1:119007921-119007943 CAGCGGATAGAATCTGCGAAAGG - Intergenic
914223783 1:145703669-145703691 CAGGAGATGCATTCCCAGAATGG + Intronic
915797911 1:158756235-158756257 CAGGGGATGCATTTCCAGAAAGG - Intergenic
916627863 1:166578768-166578790 CAGAGTATATATTCTGATAATGG + Intergenic
918102488 1:181388352-181388374 ACAGGGATACATTCTGAGAAAGG + Intergenic
918379173 1:183937451-183937473 TAGGGGATATCTTTTGAGAAAGG + Exonic
918517181 1:185375954-185375976 CAGGGAAAACAATCCGAGAAAGG - Intergenic
919527746 1:198675810-198675832 CAGGGGCTATATTCTCGGAAGGG + Intronic
921643593 1:217585754-217585776 CCAGGGATACATTCTGAGAAAGG + Intronic
922630201 1:227099479-227099501 CCAGGGATATTTTCTGAGAAAGG - Intronic
924000012 1:239540144-239540166 ATGAGGACACATTCTGAGAAAGG - Intronic
1062953318 10:1522111-1522133 CAAGGGAAACATTCTGTGAATGG + Intronic
1063639367 10:7815343-7815365 CAGGCAATACCTTCTGAGGATGG + Intergenic
1064308706 10:14191733-14191755 CAGGGAATATATTCTGAGGCTGG - Intronic
1066460631 10:35609109-35609131 CAGGAGATATATTCTCAGTACGG + Intergenic
1067175461 10:43942881-43942903 CAGAGGGTAGATTCTGAGTAGGG + Intergenic
1069223501 10:65912033-65912055 CATGGGATTCATACTGAGAAAGG + Intergenic
1070084726 10:73226024-73226046 ACAGGGATACCTTCTGAGAATGG - Intronic
1075379831 10:122010151-122010173 CATGGGAGAGATTTTGAGAAAGG - Intronic
1080930454 11:36804815-36804837 CTGGGGAAAGAGTCTGAGAAAGG + Intergenic
1082522985 11:53996867-53996889 CACAGGAAACATTCTGAGAATGG - Intergenic
1083242396 11:61398528-61398550 CAGGGGACTGGTTCTGAGAAGGG - Exonic
1086999933 11:93407428-93407450 ATGGGGACACATTCTGAAAAAGG - Intronic
1088140092 11:106605384-106605406 AATGGGGTACATTCTCAGAAAGG + Intergenic
1088567620 11:111189206-111189228 CAGGGGATACATTGTTACAGAGG - Intergenic
1089638066 11:119829258-119829280 GAGGGAATTCAATCTGAGAATGG + Intergenic
1090265472 11:125350695-125350717 CTGGGGCTACAGTCTGAGGACGG + Intronic
1090335397 11:125959544-125959566 CAAGGGTGACATTCTGAAAAAGG + Exonic
1091191424 11:133698649-133698671 CAGGGGAGCCTGTCTGAGAATGG - Intergenic
1091440055 12:505625-505647 CAGTGGGAACATTCTGAAAATGG - Intronic
1091866310 12:3840217-3840239 CAAGGAGTTCATTCTGAGAATGG + Intronic
1093144430 12:15547594-15547616 CAAGAGATACATTCATAGAAGGG - Intronic
1093286200 12:17267380-17267402 ATGGGGATATGTTCTGAGAAAGG - Intergenic
1093886024 12:24462065-24462087 ACAGGGATGCATTCTGAGAAAGG + Intergenic
1095335951 12:41026627-41026649 CAGGGCATAGGTTCTGAGTAAGG + Intronic
1095559613 12:43550844-43550866 CAAGGGCTACATTCAGCGAACGG - Intronic
1097086167 12:56469863-56469885 GATGGAATACAGTCTGAGAAAGG - Exonic
1098453148 12:70643100-70643122 CAGGTAATCCATTCTTAGAAAGG + Intronic
1099094854 12:78361616-78361638 CAAGTGATACATTTTGAAAAAGG + Intergenic
1101178349 12:102181354-102181376 GATGGGATACATTCTGATAAAGG + Intronic
1101680797 12:106963037-106963059 CAGGGGACATCTTCTGATAAGGG + Intronic
1106256443 13:28026414-28026436 CTGGGAATCCATTCAGAGAAAGG + Intronic
1106903910 13:34385042-34385064 GAGAGGAAACATTTTGAGAAAGG - Intergenic
1106904297 13:34388885-34388907 GAGAGGAAACATTTTGAGAAAGG - Intergenic
1107623133 13:42254151-42254173 CAAGGGATAGATTCTAAGAGTGG - Intronic
1108546228 13:51497525-51497547 CATGTGATACATTCTTATAAAGG + Intergenic
1108620756 13:52181778-52181800 CAGTGCCAACATTCTGAGAAAGG + Intergenic
1108665994 13:52631200-52631222 CAGTGCCAACATTCTGAGAAAGG - Intergenic
1109067723 13:57721201-57721223 CAAGGGATGCATTCTATGAAGGG + Intronic
1109498248 13:63203910-63203932 CAGGGAATGCATCCTGAGATGGG + Intergenic
1112418162 13:99222154-99222176 CAGGGTTTACATTCTGATGAAGG + Intronic
1113608112 13:111624740-111624762 CAGGGGATACTTTCTGAGTGTGG + Intronic
1114827114 14:26094471-26094493 CAGTGGACAGAGTCTGAGAAGGG + Intergenic
1115356510 14:32454169-32454191 CTGGGGATAGATTCAGGGAATGG - Intronic
1117400242 14:55352397-55352419 CAGGGAATCCTTTCTGAGACCGG - Exonic
1117590761 14:57265804-57265826 CAGGATAGACATTCTGAGTAAGG - Intronic
1117602260 14:57388690-57388712 CAAGTTATACATTCTGAAAATGG + Intergenic
1117907717 14:60608008-60608030 CAAGGGATACAATCTGAGAATGG - Intergenic
1118719916 14:68586661-68586683 CATGGGGTACATGCTGAGAATGG - Intronic
1118735676 14:68700190-68700212 GTGGGGATACATTCAGAGCATGG - Intronic
1119469471 14:74885520-74885542 CAAAGGATACATGCTGGGAATGG - Intronic
1121176212 14:91892503-91892525 CAGGGCACAGAATCTGAGAAGGG - Intronic
1121459283 14:94061606-94061628 CAGGGAATTCACTCTGGGAAGGG - Intronic
1122124996 14:99574089-99574111 CAGGAGTTAAATTCTGAGACAGG + Intronic
1123799658 15:23806687-23806709 CAGGGGCTAAATTGTCAGAAGGG + Intergenic
1124789323 15:32712637-32712659 CAGTGGAACCATTCTGAGAAGGG + Intergenic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1128536437 15:68494182-68494204 CAGAGGAAGCATTCTGAGGAAGG - Intergenic
1129671765 15:77611657-77611679 CAGGGGATAAAGCCTGAGAAAGG + Intergenic
1130347417 15:83061037-83061059 ATGGAGATACATTCTAAGAAAGG + Intronic
1130818159 15:87463000-87463022 AAAGGAATAAATTCTGAGAAAGG - Intergenic
1131580505 15:93638318-93638340 AAGGTGACACATTCTGAGTATGG - Intergenic
1131818098 15:96243894-96243916 CCTGGGAAACATTCTGAGATGGG + Intergenic
1132350360 15:101135910-101135932 ATGGGCATACGTTCTGAGAAAGG + Intergenic
1132391660 15:101443556-101443578 CTGGGGGTCCATTCTGAGGAAGG + Exonic
1133382378 16:5341931-5341953 TGGGGGATACATTCTGAAAGAGG + Intergenic
1133894434 16:9912403-9912425 CAGGGGCTACGTTCTGAAAATGG - Intronic
1137560621 16:49499839-49499861 CAGGGGATAGATTATTAGGAGGG + Intronic
1137706228 16:50537631-50537653 CAGTGGAAACATGCTCAGAAGGG - Intergenic
1138406230 16:56796476-56796498 ACAGGGATACATTCAGAGAAAGG - Intronic
1138817873 16:60223078-60223100 CAGTGGATAAATACTAAGAAAGG - Intergenic
1141489733 16:84364286-84364308 CAGAGCAGACATTTTGAGAAAGG + Intergenic
1143775868 17:9198400-9198422 AAGGGCAAACATTCAGAGAAGGG + Intronic
1146286352 17:31576696-31576718 ACGGGGATCCATCCTGAGAAAGG - Intergenic
1146298881 17:31672732-31672754 CAGGGGGTAAAATCAGAGAAGGG - Intergenic
1150010920 17:61502837-61502859 AATGGAATACGTTCTGAGAAAGG + Intergenic
1150899312 17:69253169-69253191 ACAGAGATACATTCTGAGAAAGG - Intronic
1152977649 18:238411-238433 ACAGGGATACATTCTAAGAAAGG + Intronic
1152990314 18:357785-357807 ATGGGGATACATTCTGAGAATGG + Intronic
1153095739 18:1400782-1400804 GAGGGGATACATTCAGAAAGAGG + Intergenic
1157741220 18:50095156-50095178 GAGGGGATACTCTGTGAGAAAGG - Intronic
1159419375 18:68196671-68196693 CTGGGGATCAATTCTGAGAAGGG + Intergenic
1160598226 18:79992481-79992503 CAGGGCTTACATACTGTGAAAGG + Intronic
1161009776 19:1954619-1954641 CAGTGGAGACAGTCAGAGAAGGG + Intronic
1161328101 19:3672992-3673014 CAGGGGAGGGATTCTGCGAAAGG + Intronic
1164423353 19:28117287-28117309 CAGTAGATACATTCTAAGCAGGG + Intergenic
1167030164 19:46953639-46953661 CTGGGTATACATCCAGAGAAAGG - Intronic
925234156 2:2263380-2263402 CAGGCAATACATTCTGCGACCGG - Intronic
928381404 2:30821756-30821778 CAGAGGGTACGGTCTGAGAACGG - Intergenic
930010963 2:46938498-46938520 CAAGGGATTCATTGTGTGAATGG + Intronic
930263591 2:49174426-49174448 CAGGGGAAAGGTGCTGAGAATGG + Intergenic
931175939 2:59855456-59855478 CAGGTGATAACTTCTGAGAAGGG - Intergenic
931796886 2:65719792-65719814 CAGGGGGTTCACTTTGAGAATGG + Intergenic
932469069 2:71942208-71942230 CAGGGGGTACTTTGTGAAAAGGG - Intergenic
933223172 2:79714849-79714871 CATGGCATGCATTCTTAGAAGGG + Intronic
933826785 2:86168844-86168866 CAGGGGATACAACAAGAGAAAGG + Intronic
934301762 2:91780750-91780772 GTGGGGACACATTCTGAGCATGG + Intergenic
935456302 2:103271086-103271108 CAGGGAAGACATGCTGAGAGGGG - Intergenic
939719964 2:145636187-145636209 ATGAGGACACATTCTGAGAAAGG - Intergenic
940897903 2:159098431-159098453 ATGAGGATACATTCTGAGACAGG - Intronic
941272296 2:163445476-163445498 TAGGAAATACAGTCTGAGAACGG - Intergenic
941356563 2:164500344-164500366 CCAGGTATACATTTTGAGAAAGG - Intronic
942049438 2:172125266-172125288 AAGAGAATACATTCTGAGAAAGG - Intergenic
942099712 2:172568014-172568036 CAGGTGAAACATTTTGAAAATGG + Intronic
942819207 2:180091268-180091290 ATGGGGATACATTCTGAGAAAGG - Intergenic
944123731 2:196269940-196269962 AGGGGTATAAATTCTGAGAAGGG + Intronic
945732275 2:213553582-213553604 ATGGGTATACATTTTGAGAAAGG - Intronic
946333337 2:219022429-219022451 CATAGGGTAGATTCTGAGAAAGG - Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168996363 20:2136100-2136122 CAGGGGACACATTCTGAGGCCGG + Intronic
1170227359 20:14006256-14006278 AATGGAATACGTTCTGAGAAAGG - Intronic
1170251299 20:14286475-14286497 CAGGGGGAACATTCTAATAATGG - Intronic
1173144398 20:40512266-40512288 AAGGGCATGGATTCTGAGAAGGG - Intergenic
1174124775 20:48296225-48296247 CAGGAGATACTCTCTAAGAATGG - Intergenic
1177381984 21:20355893-20355915 CAGGGGCTACATTGAGAGGATGG + Intergenic
1181007400 22:20020574-20020596 CTGGGGGTACATACTGGGAATGG + Intronic
1181200858 22:21216305-21216327 GTGGGGACACATTCTGAGCATGG - Intronic
1182172707 22:28249054-28249076 CAGGGGATACATTATTATTAGGG - Intronic
1182737184 22:32539267-32539289 CAGGTGAACCATTCTGAGACTGG + Intronic
1182760934 22:32721859-32721881 CAGGGAAGGCTTTCTGAGAAGGG + Intronic
1183254186 22:36750540-36750562 CAGGACATACATTCCTAGAAAGG - Intergenic
1183273938 22:36879474-36879496 CAGGGGTTCCATGCTGAGAGGGG + Intergenic
1184558902 22:45249977-45249999 CAGGGGAAACATTTTGATAAGGG + Intergenic
949126345 3:449499-449521 ATGGGGATTCATTCTGAGAAAGG + Intergenic
953034533 3:39200694-39200716 CCAGGGATACCTTGTGAGAAGGG + Intergenic
953767135 3:45752179-45752201 CATGGGATTCATTTTGTGAAAGG + Intergenic
955043139 3:55336024-55336046 CTGAGGACTCATTCTGAGAAAGG + Intergenic
955497893 3:59555242-59555264 CAGGGGAGAAATGCTGAGAGAGG - Intergenic
957337475 3:78850177-78850199 ACAGGGATACATTCTGACAAAGG - Intronic
957682334 3:83452754-83452776 GAGGGGATACATTCAGACCATGG + Intergenic
959208715 3:103347080-103347102 CAGCGTATACATCCTGAAAAAGG + Intergenic
960947038 3:122974012-122974034 CAGGGTGTACATTCGGGGAACGG - Intronic
961085050 3:124060170-124060192 CAGGGAGTCCTTTCTGAGAAAGG + Intergenic
961121660 3:124376475-124376497 AAGGGGATGAATTCTGGGAATGG - Intronic
961361534 3:126371114-126371136 CAGGGGCTCCATGCAGAGAATGG + Intergenic
961631177 3:128299962-128299984 CAGGGCTTACATGCTGGGAAAGG - Intronic
963144756 3:141981379-141981401 GAGGGGCTATGTTCTGAGAAAGG - Intronic
963259992 3:143182651-143182673 CAGGGAACATATTTTGAGAAAGG - Intergenic
963853782 3:150233513-150233535 CAGAGAATATATTCTGAAAATGG - Intergenic
964199342 3:154100532-154100554 CATAGGATAAATTCGGAGAAGGG + Intergenic
964556913 3:157949737-157949759 CATGGGTTACATTATGGGAAGGG + Intergenic
966982447 3:185150948-185150970 CAGGAAAGACATTGTGAGAATGG + Intronic
968597210 4:1491692-1491714 CACGGCATACATGCTGAGCATGG + Intergenic
969163990 4:5289019-5289041 ACAGGGATACATTCTGAGAAAGG + Intronic
970797590 4:19932000-19932022 ACGGGGATATGTTCTGAGAAAGG + Intergenic
972576150 4:40353884-40353906 ACAGGGATACATTCTGAGAAAGG - Intronic
972924954 4:43992745-43992767 CAGTGGCTACATTCAGTGAATGG + Intergenic
973320961 4:48809800-48809822 CAGGGCAAACTTTCTGGGAAAGG - Intronic
973708433 4:53602303-53602325 CAGGGGATGGAGGCTGAGAAAGG + Intronic
973731080 4:53822829-53822851 AAGGGCAGACATTCTGAGCATGG + Intronic
975756771 4:77579059-77579081 CAAGGGCTACACTCTGAGGATGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978468573 4:109036317-109036339 CAGGGGATATAGTCAGACAAAGG + Intronic
978561881 4:110042457-110042479 CAGGGAATAGATTCGGGGAATGG - Intergenic
978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG + Intronic
980955475 4:139424228-139424250 GATGGGATACATTCTGAGAAAGG + Intergenic
981472496 4:145152571-145152593 CAAGGAATTCATTCTGAGAATGG - Exonic
982758775 4:159255222-159255244 CGGGGAATACATTCCGAGAACGG - Intronic
984276914 4:177622166-177622188 ATGGGGATACATTCTGAGTACGG - Intergenic
984435163 4:179700886-179700908 TTGAAGATACATTCTGAGAAAGG - Intergenic
987929234 5:24382254-24382276 CAGGGGATGTATTTTGAGAAAGG + Intergenic
988316650 5:29639672-29639694 CAGGGTATACATCCAAAGAAAGG + Intergenic
988431066 5:31119140-31119162 GAGAGGATGCCTTCTGAGAAAGG - Intergenic
989373159 5:40731337-40731359 CAGGGGATCCATACTAACAAAGG - Intronic
990556302 5:56939965-56939987 AAGGGAATACATTCTGAAAAAGG - Intronic
993392482 5:87337343-87337365 CAAGGGATATATTATGAGAAAGG - Intronic
994837469 5:104874028-104874050 ATGGGGATACTTTCTGAAAAAGG - Intergenic
994847802 5:105012562-105012584 AAGAGGATGTATTCTGAGAAAGG - Intergenic
995969571 5:117952041-117952063 CAAGGGAAACATTGTGGGAAAGG - Intergenic
999687664 5:154117195-154117217 CAGGGGACCCATGCTGAGGAGGG + Intronic
1001708963 5:173762646-173762668 CAGGGGATAAATTCCCAGATTGG + Intergenic
1002357578 5:178643037-178643059 GAGGGGATTGATCCTGAGAAGGG + Intergenic
1002667354 5:180834882-180834904 CAGGGGACACATTCAGATCATGG + Intergenic
1002971898 6:2031538-2031560 ATGGGGATACAATCTGAGATAGG + Intronic
1007402085 6:41608620-41608642 CAGGGGACCCCTTCTGGGAAGGG + Intergenic
1007941674 6:45787318-45787340 GAGGGGGTACATTTTGAGGAAGG + Intergenic
1007963469 6:45982400-45982422 ATAGGGATGCATTCTGAGAAAGG + Intronic
1009955060 6:70443544-70443566 ACAGGAATACATTCTGAGAAAGG - Intronic
1010967037 6:82222699-82222721 CAGGTGACACATTATGAGTATGG + Intronic
1011360337 6:86517356-86517378 AAGGGGATGCATTATGAGGAGGG - Intergenic
1014898419 6:126932443-126932465 CTTGGGACACAATCTGAGAAAGG - Intergenic
1015424382 6:133049117-133049139 GTGGGTATACGTTCTGAGAAAGG - Intergenic
1015675805 6:135747113-135747135 ATGGGGATATGTTCTGAGAAAGG + Intergenic
1018202628 6:161409883-161409905 CAGGGTAAACTTTATGAGAATGG - Intronic
1018739384 6:166715562-166715584 ACGGGGATACGTTCTGAGAAAGG + Intronic
1020126275 7:5534057-5534079 CAGGTGATAAATTCTGAGGAGGG - Intronic
1020658217 7:10952438-10952460 CAGGGGAAATATTCAGTGAATGG + Intergenic
1021111648 7:16701460-16701482 CTGGGAATATATGCTGAGAAGGG - Intronic
1022725450 7:32977299-32977321 ATGGGGATATGTTCTGAGAAAGG + Intronic
1022834731 7:34102739-34102761 CAGGGGACACATTATGATCAGGG + Intronic
1024986041 7:55194042-55194064 GAGGAGATACATTCTGAAAATGG - Intronic
1026526980 7:71162341-71162363 CAGGGGAAAGATTCTAACAAAGG - Intronic
1027599294 7:80219578-80219600 CAGGCAATGCATTCTCAGAAGGG - Intergenic
1028131550 7:87181513-87181535 CAGATTATACATTATGAGAATGG - Intronic
1029125715 7:98293966-98293988 CAGGGGGTCCAGCCTGAGAAAGG - Intronic
1029259723 7:99293583-99293605 CAGGAGAGACTCTCTGAGAAGGG - Intergenic
1029315903 7:99713616-99713638 AAGGGGCTATATTCTCAGAAGGG - Intronic
1033398496 7:140998918-140998940 AATGGGGTACAATCTGAGAACGG + Intergenic
1035077838 7:156192721-156192743 CAGGGCAGACCTACTGAGAACGG + Intergenic
1035178908 7:157075223-157075245 GAGGGGATCCATTCTGGGATGGG - Intergenic
1037381900 8:18294127-18294149 CAGGAGATTCTTCCTGAGAAGGG - Intergenic
1037583561 8:20261350-20261372 CTGGGGCCAGATTCTGAGAAGGG - Intronic
1037718658 8:21422155-21422177 GAGCGGCTGCATTCTGAGAAGGG - Intergenic
1038418501 8:27415682-27415704 CAGAGGATACAATATGAGATTGG + Intronic
1040813859 8:51485610-51485632 CAGAGGAAACATTAGGAGAAAGG - Intronic
1041144855 8:54863420-54863442 TCAGGGACACATTCTGAGAAAGG - Intergenic
1041400997 8:57445264-57445286 CAGGGGATGCATTCCTGGAATGG + Intergenic
1043697290 8:83236322-83236344 CAAGGAATACATCCTGTGAATGG - Intergenic
1047419554 8:124695787-124695809 TAGGGGCTACCTTCTGAAAAAGG + Intronic
1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG + Intergenic
1047768237 8:128007597-128007619 CATGGGAGAAATTCTGTGAAGGG + Intergenic
1050756802 9:9014665-9014687 CATGGGAGACAATCTGAGGAAGG + Intronic
1051570678 9:18555197-18555219 CAGGGGATAAAGTCTATGAACGG - Intronic
1052615943 9:30842243-30842265 CAAGGAAGACACTCTGAGAAAGG - Intergenic
1052968109 9:34357401-34357423 AAAGGGATACATTCCTAGAAAGG - Intergenic
1053486674 9:38462319-38462341 CAGAGGATAAACTCTGTGAATGG + Intergenic
1055096860 9:72422880-72422902 CAGGGGATGCTTTCTGGGAGTGG - Intergenic
1056632345 9:88304296-88304318 CAGGAGATACATACAGAGAATGG - Intergenic
1056733191 9:89183231-89183253 CAGGGGATACTCTCTGTGGATGG - Intergenic
1057799037 9:98178596-98178618 AAGGGGAAACACTCTGAGAAAGG - Intronic
1059200295 9:112408491-112408513 ATGGGGATATGTTCTGAGAAAGG + Intronic
1059315811 9:113424950-113424972 TGGGGGATACATTTGGAGAAAGG + Intronic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1186162687 X:6794159-6794181 ATGGGGACACACTCTGAGAAAGG + Intergenic
1187536647 X:20147042-20147064 AAGGGGATTCATTTTGGGAAAGG - Intergenic
1187705740 X:22007641-22007663 CAGAGGTGACACTCTGAGAAGGG + Intergenic
1188196740 X:27243835-27243857 AATGGGATATGTTCTGAGAAAGG - Intergenic
1188886548 X:35558093-35558115 CAGAGCACACATTCTGAGAATGG - Intergenic
1193202845 X:78712598-78712620 GAAGGGAAACATTCTGATAATGG - Intergenic
1195126345 X:101813091-101813113 ATGGTGATACCTTCTGAGAAAGG + Intergenic
1195179256 X:102340269-102340291 ATGGCGATACCTTCTGAGAAAGG - Intergenic
1195630059 X:107046114-107046136 ACAGGGACACATTCTGAGAATGG + Intergenic
1196274060 X:113745705-113745727 CAGAGTATACTTTCTGAGATGGG - Intergenic
1197936773 X:131747636-131747658 CAGGGGATAAATTCGGTGGATGG + Intergenic
1198594522 X:138222047-138222069 AAGGGGATACATAGTGAGAGCGG - Intergenic
1201613773 Y:15872844-15872866 AGAGGGATACATTCTGAGAAAGG - Intergenic
1201950968 Y:19563382-19563404 ACAGAGATACATTCTGAGAATGG + Intergenic