ID: 1126024391

View in Genome Browser
Species Human (GRCh38)
Location 15:44432106-44432128
Sequence TGGTGGGGATAGAATTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126024391 Original CRISPR TGGTGGGGATAGAATTGTGG TGG Intronic
900866266 1:5270737-5270759 TGGTGGGGAGAGAACTGGGGTGG + Intergenic
905939714 1:41853521-41853543 TGGAGGTGATTGAATCGTGGGGG - Intronic
907116142 1:51970237-51970259 TTGTGGGAATAGAAGAGTGGAGG - Intronic
907742071 1:57176451-57176473 GGGAGGTGATTGAATTGTGGGGG - Intronic
909539536 1:76775785-76775807 CTGTGAGGATAGAATTCTGGTGG - Intergenic
911127433 1:94353565-94353587 TGATGGGGAGAGAGTTGTGGAGG - Intergenic
912717620 1:111992966-111992988 TGCTGGGGCAAGAATTTTGGGGG + Intergenic
914681675 1:149943408-149943430 TGGTGGAGTGAGAAGTGTGGAGG - Exonic
914751205 1:150536301-150536323 TGGTGGCCATAGAATGGAGGTGG + Intergenic
915978373 1:160405379-160405401 TAGTCTGGATAGAACTGTGGTGG + Intronic
916045959 1:161000111-161000133 TGGTGGTGAAAGATGTGTGGGGG - Intronic
916073493 1:161186239-161186261 TGCTAGGGATGGGATTGTGGGGG - Exonic
916319023 1:163481574-163481596 TGGAGGTGATTGAATTATGGGGG + Intergenic
917205017 1:172562867-172562889 GGGAGGTGATTGAATTGTGGGGG + Intronic
918111772 1:181461018-181461040 CGGTGGGGATTGAATTGAGGTGG + Intronic
918306717 1:183252888-183252910 AGGTGGGGAAGGAGTTGTGGAGG - Intronic
919135520 1:193503709-193503731 GGGAGGTGATAGAATTGTGGGGG + Intergenic
919762354 1:201106153-201106175 AGGTGGGGATGGAGGTGTGGGGG - Intronic
919975339 1:202607117-202607139 TGGAGAGGACAGAATTATGGGGG - Intronic
920192182 1:204200856-204200878 TGGTGTGGAGAGAATAGGGGTGG - Intronic
920373400 1:205493456-205493478 GGGTGAGGACAGACTTGTGGTGG - Intergenic
921173996 1:212577563-212577585 TGGTGGGGGTAGGATGGGGGTGG - Intronic
921683687 1:218065008-218065030 CGGTGGGGATAGAGATGGGGTGG - Intergenic
922123377 1:222697841-222697863 TGGTGGGGGTAGAACTGAGGGGG + Intronic
922970074 1:229728823-229728845 TGTTGGAGAGAGAATTCTGGAGG - Intergenic
1063216751 10:3932265-3932287 TGGTGGGGAGAGAGGTGTGGAGG + Intergenic
1063636428 10:7787575-7787597 TGGTGGGGATCGGACTGGGGAGG + Intronic
1065256328 10:23872526-23872548 TAGTGGAGATATATTTGTGGTGG - Intronic
1067471679 10:46542384-46542406 TGGAGGTGATGGAATCGTGGGGG + Intergenic
1070138869 10:73721238-73721260 TAGTGGGGGTAGAAGTGTAGTGG - Intergenic
1070170056 10:73926099-73926121 TGGTGGGGATAGAATAGACTTGG + Intergenic
1071222335 10:83483641-83483663 GGGTGGCGATTGGATTGTGGGGG - Intergenic
1071700420 10:87926824-87926846 GGGGTGGGAGAGAATTGTGGTGG + Intronic
1071718402 10:88119782-88119804 TGGTGGGGAAAGAATTAGGCAGG - Intergenic
1072933893 10:99693383-99693405 TGCTGGGGTTGGAAATGTGGGGG + Intronic
1073683445 10:105729004-105729026 TGGTGGGGAGTGACTTGAGGAGG - Intergenic
1074115716 10:110456425-110456447 TGGTGGGGAGTGACTTGTGGAGG - Intergenic
1074237352 10:111598934-111598956 TGGTGGGGATAGGATGGGGTGGG + Intergenic
1074911919 10:117919059-117919081 TGGTGGGAATAGAAGTGTCAGGG + Intergenic
1077009677 11:374576-374598 TGGTGGGGGTAGAGTGGGGGGGG + Intronic
1077179511 11:1206025-1206047 TATTGGGGCTAGAACTGTGGGGG + Intergenic
1077353123 11:2102095-2102117 TGGATGATATAGAATTGTGGTGG + Intergenic
1079073278 11:17366953-17366975 TGGTGGGGATAAAAGGGTGCTGG + Intronic
1079763639 11:24361373-24361395 TGGGGGTGATTGAATTATGGGGG + Intergenic
1080696328 11:34606043-34606065 AGGTGGGGACTGAATGGTGGCGG + Intergenic
1085337458 11:75707015-75707037 GGATGGGGATAGAATTATAGGGG - Intergenic
1085649789 11:78257317-78257339 GGGTGGGGATAAATTTTTGGGGG - Intronic
1086065583 11:82740242-82740264 AGGTGAGGAGAAAATTGTGGAGG - Intergenic
1086069891 11:82788855-82788877 TGGTGGTGAGAGAATTGGGATGG - Intergenic
1088051464 11:105520167-105520189 TGGGAGGAATAGGATTGTGGAGG + Intergenic
1089619012 11:119711930-119711952 TGGTGGTGCTAGGATTGGGGAGG + Intronic
1089825159 11:121268556-121268578 TGTTGGAGAGAGAATTCTGGAGG + Intergenic
1090316025 11:125789288-125789310 AGGTGGGGAATGAATAGTGGAGG - Intronic
1091949765 12:4583045-4583067 TGGTGGGCAAAGAATGGTGAAGG + Intronic
1092123508 12:6060446-6060468 TTTTGGGGATGGAAGTGTGGAGG - Intronic
1096064715 12:48730413-48730435 TGGAGGGTATAAAATTGGGGTGG - Intergenic
1096749252 12:53748300-53748322 TGTTGGGGATGGAGTTGGGGGGG - Intergenic
1096979537 12:55720328-55720350 GGGTGGGGATAGGACTGAGGAGG - Intronic
1097480910 12:60125160-60125182 TGGAGGTGATTGAATTATGGGGG + Intergenic
1097484396 12:60176994-60177016 TTGTGGGTATAGAATTGCTGAGG - Intergenic
1098373378 12:69783954-69783976 TAGTGGTGTTATAATTGTGGTGG - Intronic
1098676226 12:73293286-73293308 GGGAGGTGATTGAATTGTGGGGG + Intergenic
1098882150 12:75927586-75927608 GGGAGGTGATTGAATTGTGGGGG - Intergenic
1100483912 12:95006209-95006231 TAGTGGGGAGAGAATAGTGTTGG - Intergenic
1101381098 12:104214781-104214803 GGGTGGGGGTAGAGTTGAGGGGG + Intergenic
1102404799 12:112664008-112664030 GGATGGGGAAAGAAGTGTGGGGG + Intronic
1102798613 12:115711559-115711581 TGGTGGAGATACTATGGTGGTGG - Intergenic
1102879783 12:116475385-116475407 TGGAGGGGATAGAAAAGGGGAGG + Intergenic
1104939652 12:132389008-132389030 TGTTGGGGATGGAGTTGTGGGGG - Intergenic
1105803911 13:23938614-23938636 AGGTGGGGAAATAATGGTGGGGG - Intergenic
1106778111 13:33027891-33027913 TATTGGGGAAAGAATTGTGAAGG + Intronic
1107500134 13:40965187-40965209 TGGTGTGGAAAAAATTGAGGTGG - Intronic
1108997958 13:56759309-56759331 TGGTAGGGATACATCTGTGGAGG - Intergenic
1109863446 13:68230149-68230171 TGGTGGGGATGGGATTCAGGTGG - Intergenic
1110006559 13:70278572-70278594 AGGAGGCGATTGAATTGTGGGGG - Intergenic
1112795663 13:103054100-103054122 GGGAGGTGATTGAATTGTGGGGG + Intronic
1112872645 13:103993813-103993835 GGGAGGGGATTGAATTATGGGGG + Intergenic
1112991441 13:105518436-105518458 TGGTGGGAATTGAATCATGGGGG - Intergenic
1116865858 14:50031116-50031138 TGGGGGTGACTGAATTGTGGGGG - Intergenic
1117020146 14:51562159-51562181 TGGGCGGGATAGAAATGTGGGGG - Intronic
1117099067 14:52327083-52327105 TGGTGGGGAACGAAAGGTGGGGG - Intronic
1117949705 14:61069814-61069836 TGCTGGGGATAGAATTGGATGGG - Intronic
1119293462 14:73514450-73514472 TGGGGGTGAGAGATTTGTGGGGG + Intronic
1120706947 14:87755144-87755166 GGGTAGGGATAAAATTCTGGAGG + Intergenic
1122189524 14:100029679-100029701 TGGAGGGTATAGGATTGGGGTGG + Intronic
1122261677 14:100527033-100527055 TGGTGGTGATAGAGTGGTGATGG - Intronic
1122791404 14:104185580-104185602 GGGTGGGGATAGGAGTGGGGTGG + Intergenic
1122805731 14:104255658-104255680 TAATGGGGATAGAGTTGTTGGGG - Intergenic
1122805747 14:104255734-104255756 TAATGGGGATAGAGTTGTTGGGG - Intergenic
1124490995 15:30155460-30155482 TGGAGAGGACAGAATTATGGGGG - Intergenic
1124847246 15:33303061-33303083 GGGAGGGGATTGAATTGTGGGGG + Intergenic
1124997252 15:34735850-34735872 TGGTTGGGATGGAATGGTGATGG - Intergenic
1125753227 15:42044831-42044853 GGGTGGGGACAGAATTGGGCAGG + Intronic
1126024391 15:44432106-44432128 TGGTGGGGATAGAATTGTGGTGG + Intronic
1128081964 15:64862157-64862179 TTGTGGGGAGGAAATTGTGGAGG + Intronic
1129298532 15:74612720-74612742 TGGAGGGGAGACAATTTTGGAGG - Intronic
1129695300 15:77737595-77737617 TGGTGGGGACAGAACTGGAGAGG - Intronic
1131795510 15:96012031-96012053 TGGTGGGGCTATAAATGTGTGGG - Intergenic
1133446087 16:5862336-5862358 TGGTGGGGAGGGAAATCTGGAGG + Intergenic
1135652664 16:24219762-24219784 GCTTGGGGATAGAAATGTGGTGG - Exonic
1137975912 16:53031831-53031853 TGGAGGTGAGAGAATTGGGGAGG + Intergenic
1138147896 16:54628513-54628535 TGGCGGGGTTTGAATTCTGGTGG - Intergenic
1138487806 16:57358011-57358033 GGGTGGGGATGGCATTGAGGAGG + Intergenic
1139467526 16:67161949-67161971 CGGTGGGGAGAGGAGTGTGGAGG - Intronic
1139698136 16:68689841-68689863 GGGTGGGGGTAGAAACGTGGGGG + Intronic
1140877725 16:79168581-79168603 TGGGGGGCCTAGAAATGTGGAGG + Intronic
1143994671 17:10996419-10996441 TGGAGGGAATAGAATCGTGATGG + Intergenic
1145400695 17:22529963-22529985 TGGAAGGCCTAGAATTGTGGGGG - Intergenic
1146704184 17:34988312-34988334 TGTTGGGGATGGAATTTGGGAGG + Intronic
1148083817 17:44982254-44982276 TGGTGGTTATGGAATGGTGGTGG + Intergenic
1149100482 17:52900553-52900575 TGGTGGGAATAGAATCGGGGAGG + Intergenic
1151386833 17:73760190-73760212 TGGGGGGGATTGAAGGGTGGAGG + Intergenic
1153669485 18:7397207-7397229 TTGTGGTGATGGAATTGTGGTGG - Intergenic
1153851361 18:9098316-9098338 TCCTTAGGATAGAATTGTGGGGG - Intergenic
1154177438 18:12094421-12094443 TGGTGGGGGTAGAGTTGGGTGGG + Intronic
1154177546 18:12094706-12094728 TGGTGGGGGTAGAGTTGGGTGGG + Intronic
1154490034 18:14914558-14914580 TGTTTGGGCAAGAATTGTGGTGG + Intergenic
1155022970 18:21913195-21913217 TGGTGGGGATAGAAATGCAGGGG + Intergenic
1155144358 18:23071021-23071043 GTGTGGGGATAGATTTGTGGAGG - Intergenic
1157045682 18:44099624-44099646 GGGTGGTGATTGAATTATGGGGG + Intergenic
1157465259 18:47938571-47938593 TGGTGGAGAAACAATTCTGGTGG - Intergenic
1158088545 18:53682973-53682995 TGCTAGGGAGAGAATTCTGGAGG + Intergenic
1162525334 19:11203313-11203335 TGGTGGGGCCAGAGGTGTGGGGG + Intronic
1163685569 19:18710020-18710042 GGGTGGGCAAAGAAGTGTGGGGG - Intronic
1165782892 19:38444122-38444144 GGGTGGGGATGGAATGGGGGTGG - Intronic
1167502628 19:49856357-49856379 TGGAGGGGACAGCACTGTGGGGG + Intronic
1168567940 19:57440270-57440292 GGGTGGGGATAGCATTGGGGAGG + Intronic
924996673 2:367645-367667 TGGTGGAGACAGAAGGGTGGGGG + Intergenic
925422203 2:3721719-3721741 TGGGAGGGATTGAATTATGGGGG + Intronic
925653476 2:6117928-6117950 TGGAGGGAATTGAATTATGGGGG - Intergenic
926588867 2:14718539-14718561 TGGGGGTGATTGAATTATGGGGG + Intergenic
930103055 2:47617905-47617927 TGTTGGGAGTAGAATTGAGGGGG - Intergenic
932326121 2:70862998-70863020 GGGTGGGGATAGGGATGTGGTGG - Intergenic
936472244 2:112809596-112809618 GGGAGGTGATTGAATTGTGGGGG + Intergenic
937865081 2:126744722-126744744 AAGTGGGGATAGAGTTGTAGGGG + Intergenic
937881978 2:126875238-126875260 TGGTGGGGTTAGTAGTTTGGTGG - Intergenic
937961766 2:127465431-127465453 AGGAGGTGATTGAATTGTGGGGG + Intronic
939847928 2:147270058-147270080 TGGAGGTGATTGAATTATGGGGG - Intergenic
943567034 2:189527922-189527944 GGGTGGGATTAGCATTGTGGTGG + Intergenic
944374201 2:199021855-199021877 TGGTGGAGCTAGAACTGTGAAGG - Intergenic
944454558 2:199879552-199879574 TGCTTGGGATAGAATTCTGGAGG + Intergenic
946005292 2:216519865-216519887 TTGTGGGAAAAGAAATGTGGAGG + Intronic
946253181 2:218425852-218425874 TGGTAGGGATAGAGATGTTGGGG + Intronic
947372683 2:229464736-229464758 CGGTGGGTAGAGAATGGTGGGGG + Intronic
948897348 2:240933640-240933662 TGGTGGGGGCAGAGTTGGGGCGG - Intronic
1169564580 20:6839955-6839977 AGGGGGGGGTAGAATTTTGGGGG - Intergenic
1170491238 20:16877049-16877071 TGGTGGGAATTGAATCATGGGGG + Intergenic
1170657995 20:18308085-18308107 CTGTGGGGATAGAATTGGGGAGG + Intronic
1170748287 20:19120388-19120410 TGGTGGGGCTGGGACTGTGGCGG + Intergenic
1171046863 20:21816914-21816936 GGGAGGTGATAGAATTATGGGGG + Intergenic
1172572945 20:35984517-35984539 TGGTGAGGAGAGAATTCAGGGGG + Intronic
1173720411 20:45253261-45253283 TGGTGGTGATAGAGGTGGGGAGG - Intronic
1174068896 20:47886216-47886238 TGGTGGGGATGGAGGTTTGGTGG + Intergenic
1176346114 21:5749313-5749335 GGGTGGGGAGAGATTTGTGCAGG + Intergenic
1176352928 21:5869897-5869919 GGGTGGGGAGAGATTTGTGCAGG + Intergenic
1176498713 21:7575142-7575164 GGGTGGGGAGAGATTTGTGCAGG - Intergenic
1176540435 21:8147383-8147405 GGGTGGGGAGAGATTTGTGCAGG + Intergenic
1176559386 21:8330428-8330450 GGGTGGGGAGAGATTTGTGCAGG + Intergenic
1176972944 21:15287978-15288000 GGTTTGGGATAGACTTGTGGTGG - Intergenic
1177350607 21:19935980-19936002 TGGAGAGAATAGATTTGTGGAGG - Intergenic
1178939905 21:36896764-36896786 GGGAGGGGATAGAGTTGTAGAGG - Intronic
1182684803 22:32113749-32113771 TGGTGGGGATGGGATTAGGGAGG - Intergenic
1184666758 22:45993366-45993388 TGGTGGTGATGGAATGATGGTGG + Intergenic
1203245378 22_KI270733v1_random:63810-63832 GGGTGGGGAGAGATTTGTGCAGG + Intergenic
950820772 3:15756086-15756108 TGGTATGCATAGATTTGTGGGGG - Intronic
950906760 3:16545712-16545734 TGGTGGGGAAAGAATGTTGGTGG - Intergenic
952602391 3:35100889-35100911 TGGTGGAGATAAAACTGTGGAGG + Intergenic
952996399 3:38887181-38887203 TGTTGGGGAGAGAATTCTAGAGG - Intronic
953030856 3:39178808-39178830 TGGTGGGGAGAGAAATGAGGAGG + Intergenic
953211916 3:40883845-40883867 TGGTGGGGATGGGGTTGTGCAGG + Intergenic
953522201 3:43654371-43654393 TGATGGGGATAGAATTCAGAGGG + Intronic
953909587 3:46884920-46884942 TGCTGGGGCCAGAATTGTGAGGG - Intronic
954315645 3:49799928-49799950 GGGTGGGGATAGAATCTGGGAGG - Intergenic
954714633 3:52520935-52520957 TGGTGGTGACACAATTGCGGTGG - Exonic
955919539 3:63941063-63941085 TGCTGGGGATAGAATAGAGTAGG - Intronic
956161194 3:66354739-66354761 GGGAGGGGATTGAATTATGGGGG + Intronic
956803559 3:72786256-72786278 TTGTGGGGAATGAATTGTGGTGG - Intronic
957257532 3:77857328-77857350 GGGTGGGGAGAGGATTGTGGAGG + Intergenic
960354979 3:116640509-116640531 TAAGGGGAATAGAATTGTGGTGG - Intronic
960986649 3:123285436-123285458 TGGTGGGGACAGATGTGGGGAGG + Intronic
961440154 3:126947986-126948008 TGGTGGGCATTGAAGTGTAGCGG + Intronic
961617785 3:128197236-128197258 TGCTGGGGCTAGAATCCTGGAGG + Intronic
963901124 3:150734480-150734502 TGGTGTGTATTGAATTGAGGAGG + Intergenic
964157901 3:153608070-153608092 GGATGGGGAGAGTATTGTGGGGG + Intergenic
964258193 3:154804171-154804193 TGGAGGTGATTGAATTATGGGGG - Intergenic
964466516 3:156998958-156998980 TGGTGGTGATTGAATCATGGGGG + Intronic
964766874 3:160187990-160188012 TGGTGGGGATAGGGGTGGGGAGG - Intergenic
966519385 3:180856079-180856101 TGGTGGGACTAGAATTGCAGAGG - Intronic
966877144 3:184328855-184328877 TAGTGGTGAGAGAACTGTGGAGG + Intronic
968589989 4:1452932-1452954 TGGTGGTGATAGTGATGTGGTGG - Intergenic
969280846 4:6170018-6170040 TGGTGGTGATGGGAATGTGGTGG - Intronic
969280952 4:6170490-6170512 TGGTGGTGATAGAAGGGTGCTGG - Intronic
970520858 4:16882474-16882496 AGGTGGGGAGAGAATGGAGGGGG - Intronic
971546156 4:27890060-27890082 GGGAGGTGATTGAATTGTGGAGG + Intergenic
972251258 4:37304824-37304846 TGGTGGGTCTACAATTCTGGGGG + Intronic
974011908 4:56614837-56614859 TGGTGGGGAAACAACTCTGGAGG - Intergenic
974141354 4:57891935-57891957 TTGAGGGTATAGATTTGTGGAGG + Intergenic
974195606 4:58570489-58570511 GGGTGGTGATTGAATTGTGAGGG + Intergenic
974723687 4:65773326-65773348 TGGTGGTGTTAGTATGGTGGTGG + Intergenic
974939641 4:68450647-68450669 TGCTGAGGAAAGAAGTGTGGAGG + Intronic
975373411 4:73614057-73614079 TAGATGGGAAAGAATTGTGGAGG - Intronic
975693934 4:76993111-76993133 TAGTAGGAATAGAAATGTGGAGG + Intronic
977098081 4:92770754-92770776 TGGAGGTGATTGAATTATGGTGG - Intronic
977648118 4:99437711-99437733 TGGTGTGCACAGAATTGAGGGGG + Intergenic
978380027 4:108117404-108117426 TGGTGGGAATAGAAAGGTGGAGG - Intronic
980727710 4:136786806-136786828 TGGAGGTGATTGAATTATGGGGG + Intergenic
982019513 4:151189522-151189544 TGGAGGTGATTGAATTATGGGGG + Intronic
983742545 4:171153277-171153299 TGGTGGAGAAAGAAGTGAGGAGG - Intergenic
985364246 4:189210322-189210344 TGGTGATGGTAGACTTGTGGTGG + Intergenic
986318211 5:6605486-6605508 TTTTGGGGATTGAATTCTGGAGG - Intronic
987206187 5:15628484-15628506 TGGTGGGGATAGATTTACTGTGG + Intronic
988897463 5:35693084-35693106 GGGTGAAGATTGAATTGTGGAGG + Intronic
990160707 5:52936856-52936878 AGCTGGGGGTAGAATTGTGAAGG + Intronic
992973796 5:82090598-82090620 GGGTGGGGATAGGAGGGTGGTGG + Intronic
993774950 5:91981997-91982019 TGGAGGTCATAGATTTGTGGTGG - Intergenic
995286500 5:110394936-110394958 TGGTGAGGGAAGAAGTGTGGGGG + Intronic
995794552 5:115927898-115927920 GGGTAGGGATAGAGTGGTGGTGG - Intergenic
996347391 5:122501768-122501790 TGGTGGGGACAGAAAGGAGGGGG + Intergenic
996911023 5:128656671-128656693 GGGAGGGGATTGGATTGTGGAGG - Intronic
996915738 5:128710306-128710328 CGGAGTGGCTAGAATTGTGGAGG - Intronic
998591019 5:143478425-143478447 GGGAGGTGATTGAATTGTGGGGG + Intergenic
999427581 5:151500962-151500984 TGGTGGGGAGAGGATGGAGGTGG + Intergenic
999864262 5:155683867-155683889 GGGAGGTGATTGAATTGTGGGGG + Intergenic
1000907077 5:166976685-166976707 TGCTGGGGATGGCATTATGGGGG - Intergenic
1001858750 5:175034781-175034803 TGGTGATGATAGTATGGTGGTGG + Intergenic
1002236486 5:177807158-177807180 TGGTGGGGAAAAAATGTTGGGGG - Intergenic
1002909507 6:1478536-1478558 TGGTGGTGATGGTATTGTGGTGG + Intergenic
1002994271 6:2268315-2268337 AGGTGGGGAGAGAACTGAGGGGG + Intergenic
1004409012 6:15362964-15362986 TGGTGTGGAGAGGGTTGTGGTGG + Intronic
1004489417 6:16100114-16100136 TGGTGGGTCTACTATTGTGGTGG + Intergenic
1005421934 6:25660260-25660282 CGGTGGAAAGAGAATTGTGGTGG - Intronic
1006052322 6:31354605-31354627 TGGTGGGGGTGGGAGTGTGGAGG - Intronic
1006066375 6:31465231-31465253 TGGTGGGGTAAGATTTGGGGTGG - Intergenic
1006705921 6:36021327-36021349 GGGTGGGGAAAGAAAGGTGGGGG - Intronic
1007181544 6:39932570-39932592 TTGTGGGGATAGAAAGGCGGAGG + Intronic
1007834453 6:44663980-44664002 TGTAGGGGATAGCATTCTGGGGG - Intergenic
1009974640 6:70659747-70659769 TGGTGGGGTCAGGACTGTGGAGG + Intergenic
1011144377 6:84196169-84196191 GGGAGGTGATAGAATTATGGGGG + Intronic
1011165297 6:84439778-84439800 TGGTGGGGATGGGATTATAGGGG - Intergenic
1011385918 6:86797662-86797684 TGGAGGCAATTGAATTGTGGGGG - Intergenic
1011821060 6:91254676-91254698 TGGGAGGGATTGAATTATGGGGG + Intergenic
1011858631 6:91726841-91726863 AGGTAGGCCTAGAATTGTGGGGG - Intergenic
1012086406 6:94831461-94831483 TGGTGGGAATAGAATTGGTGAGG - Intergenic
1014987411 6:128028946-128028968 TGGTAAGGTTAGAATTGTGCTGG + Intronic
1014995081 6:128132710-128132732 TGGTGGGAATAATTTTGTGGAGG - Intronic
1015312881 6:131784186-131784208 GGGAGGTGATTGAATTGTGGGGG - Intergenic
1015939700 6:138435567-138435589 TTTTGGGAATAGAATTTTGGTGG - Intronic
1016068202 6:139705741-139705763 TAATGGGGTTAGAATTTTGGTGG + Intergenic
1016730234 6:147420705-147420727 GTGTGGGAATGGAATTGTGGTGG - Intergenic
1017724960 6:157270368-157270390 TGTTGGTGATGGTATTGTGGTGG - Intergenic
1019761994 7:2819779-2819801 TGGTGGGAACAGAAATGTTGCGG + Intronic
1020550518 7:9597599-9597621 GGGAGGGGATTGAATTATGGGGG + Intergenic
1021479978 7:21104969-21104991 GAATGGGCATAGAATTGTGGGGG + Intergenic
1024999497 7:55303134-55303156 TGTTGGAGAGAGAATTCTGGAGG + Intergenic
1027887692 7:83930580-83930602 TGGAGGGGATTGGATTATGGGGG - Intergenic
1028222401 7:88213055-88213077 TGGTGGAGAGGGAATTGAGGAGG - Intronic
1028311064 7:89336585-89336607 TGGTGGTGATAGAAGTGTGCTGG - Exonic
1028856593 7:95600088-95600110 TGGAGATGATAGACTTGTGGGGG + Intergenic
1029792843 7:102863498-102863520 TAGAGGGGATAAAATTGGGGGGG + Intronic
1030608454 7:111663559-111663581 GGGAGGGGATTGAATTATGGGGG - Intergenic
1031089951 7:117342475-117342497 TTGTGGGGGTGGAATTTTGGTGG - Intergenic
1031432075 7:121684258-121684280 GGGAGGTGATTGAATTGTGGGGG - Intergenic
1031808236 7:126333565-126333587 TGGTGGGGATAGAAGAGAGGAGG - Intergenic
1031914700 7:127552104-127552126 GGGTGGAGAGAGAAATGTGGTGG + Intergenic
1032069145 7:128792923-128792945 TGGTGGGGATACACGTGTGTTGG - Intronic
1032311330 7:130790081-130790103 TGGTGGGGATAGGAGAGTGCTGG - Intergenic
1032494495 7:132350685-132350707 TGGTGGGAATGGAAGTGAGGTGG + Intronic
1033014135 7:137654455-137654477 TGGTAGTGATAGAATTGAAGGGG - Intronic
1033140398 7:138821328-138821350 TGATAGGGATTGAAGTGTGGAGG + Intronic
1033533190 7:142286937-142286959 GGGAGGTGATTGAATTGTGGGGG - Intergenic
1034813259 7:154150833-154150855 TGGTGGGGAAAGCACTTTGGTGG - Intronic
1035385825 7:158472027-158472049 TGGTGGGAATGGAACCGTGGTGG - Intronic
1037540765 8:19868332-19868354 AGGTGTGGATAGAAACGTGGTGG + Intergenic
1038974995 8:32685452-32685474 TGGTGGAGGTAGGAGTGTGGAGG - Intronic
1039404750 8:37302925-37302947 TGTTGGGAATAGGATTATGGGGG + Intergenic
1042045707 8:64649100-64649122 TAGTGGGCATAGAGTTTTGGTGG - Intronic
1043925376 8:86030698-86030720 GATGGGGGATAGAATTGTGGAGG + Intronic
1044760856 8:95515641-95515663 GGGTGGTGATTGAATTATGGGGG - Intergenic
1044827173 8:96209717-96209739 TGAAGGGGATAGAATGATGGAGG - Intergenic
1045190562 8:99878547-99878569 TGGTGGGCATAGAATTGAGAAGG - Intronic
1046169093 8:110481955-110481977 TGGAGGTGATTGAATTATGGGGG + Intergenic
1047346935 8:124037860-124037882 TGGAGGGGATGGAAATGAGGGGG - Intronic
1049286700 8:141779703-141779725 TGGTGGTGGTAGTATGGTGGTGG + Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1051040378 9:12802323-12802345 GGGAGGGGATAGAATCATGGTGG + Intronic
1054965957 9:71026814-71026836 TGGTGGTGTTAGAATGATGGCGG - Intronic
1056215226 9:84400184-84400206 TGGTGGGGATGCAATCATGGGGG - Intergenic
1056511407 9:87309709-87309731 TGGTGGGGATAGGAGTGGGTGGG - Intergenic
1056981677 9:91318580-91318602 TGCTCGGGAGAGAATTCTGGAGG - Intronic
1057269794 9:93644428-93644450 TGGTGTGCAAAGAATTCTGGCGG + Intronic
1057375523 9:94518626-94518648 AGCTGGGGATATATTTGTGGTGG + Intergenic
1057514081 9:95705973-95705995 TGGTGGTGATGGAATGGTGGTGG - Intergenic
1058065792 9:100546415-100546437 GGGGGGGGATTGAATTATGGGGG - Intronic
1060295569 9:122340786-122340808 TGGTGGGGATGGAGGTGGGGTGG + Intergenic
1062300697 9:135866577-135866599 TTGTGGAGATACAATTGTGCGGG - Intronic
1203461715 Un_GL000220v1:46882-46904 GGGTGGGGAGAGATTTGTGCAGG + Intergenic
1185500836 X:596132-596154 AGGTGGACATAGATTTGTGGGGG - Intergenic
1187018053 X:15350226-15350248 TGGTGGGGATATAATGGGTGGGG - Intronic
1188181263 X:27058760-27058782 TTGTGGGGATAGAATATTGCTGG - Intergenic
1189030515 X:37444864-37444886 TGGTTGAGATAGAATTGGGGGGG - Intronic
1193147939 X:78096690-78096712 TGCTGGGGAGAGAATCCTGGAGG + Intronic
1197887783 X:131236213-131236235 TGGTTGGGATGGAAGTGTGGGGG + Intergenic
1201897180 Y:19004392-19004414 AGGAGGGGAAAGAATTGAGGAGG + Intergenic
1202273114 Y:23089269-23089291 TCGTGGGGAAAGAATGTTGGTGG - Intergenic
1202292912 Y:23331413-23331435 TCGTGGGGAAAGAATGTTGGTGG + Intergenic
1202426111 Y:24723013-24723035 TCGTGGGGAAAGAATGTTGGTGG - Intergenic
1202444678 Y:24947073-24947095 TCGTGGGGAAAGAATGTTGGTGG + Intergenic