ID: 1126024541

View in Genome Browser
Species Human (GRCh38)
Location 15:44433198-44433220
Sequence TACTCAGCCCCGCTAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1247
Summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 1192}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126024541_1126024547 -1 Left 1126024541 15:44433198-44433220 CCAGCCACTAGCGGGGCTGAGTA 0: 1
1: 0
2: 0
3: 54
4: 1192
Right 1126024547 15:44433220-44433242 AGGGGGAATTGCTTGAGCCCAGG 0: 5
1: 128
2: 2397
3: 20152
4: 92305
1126024541_1126024552 26 Left 1126024541 15:44433198-44433220 CCAGCCACTAGCGGGGCTGAGTA 0: 1
1: 0
2: 0
3: 54
4: 1192
Right 1126024552 15:44433247-44433269 TGAGGCTGCAGTGAGCCGTGAGG 0: 2
1: 10
2: 53
3: 174
4: 630
1126024541_1126024549 8 Left 1126024541 15:44433198-44433220 CCAGCCACTAGCGGGGCTGAGTA 0: 1
1: 0
2: 0
3: 54
4: 1192
Right 1126024549 15:44433229-44433251 TGCTTGAGCCCAGGAGGTTGAGG 0: 1252
1: 6221
2: 24064
3: 68082
4: 127201
1126024541_1126024553 27 Left 1126024541 15:44433198-44433220 CCAGCCACTAGCGGGGCTGAGTA 0: 1
1: 0
2: 0
3: 54
4: 1192
Right 1126024553 15:44433248-44433270 GAGGCTGCAGTGAGCCGTGAGGG 0: 110
1: 1410
2: 9141
3: 19036
4: 15212
1126024541_1126024548 2 Left 1126024541 15:44433198-44433220 CCAGCCACTAGCGGGGCTGAGTA 0: 1
1: 0
2: 0
3: 54
4: 1192
Right 1126024548 15:44433223-44433245 GGGAATTGCTTGAGCCCAGGAGG 0: 37
1: 1734
2: 28296
3: 81614
4: 160467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126024541 Original CRISPR TACTCAGCCCCGCTAGTGGC TGG (reversed) Intronic
900279141 1:1854655-1854677 TCCTCAGCCTCGCTAGTAGGTGG - Intronic
900956871 1:5891775-5891797 TACTCAGCACCTCCAGTGCCAGG + Intronic
901181473 1:7344859-7344881 TACTCAGCCTCCCCAGTAGCTGG + Intronic
901307553 1:8243744-8243766 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
901377598 1:8850494-8850516 CACTCAGCCCCCCAAGTAGCTGG - Intergenic
901563417 1:10091718-10091740 GACTCAGCCTCCCTAGTAGCTGG + Intronic
901588253 1:10316613-10316635 ACCTCAGCCCCTCTAGTAGCTGG + Intronic
902291223 1:15436560-15436582 TCCTCAGCCTCGCGAGTAGCTGG - Intergenic
902365012 1:15967259-15967281 GACTCAGCCCCCCAAGTAGCTGG - Intronic
902668215 1:17953957-17953979 ACCTCAGCCCCACTAGTAGCTGG - Intergenic
902837583 1:19057112-19057134 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
903527837 1:24005882-24005904 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
903744927 1:25580621-25580643 TCCTCAGCCCCCCAAGTAGCTGG + Intergenic
903903109 1:26663163-26663185 ACCTCAGCCCCCCTAGTAGCTGG - Intergenic
904095988 1:27977731-27977753 TCCTCAGCCTCCCAAGTGGCTGG - Intronic
904116696 1:28167751-28167773 TTCTCAGCCTCCCTAGTAGCTGG + Intronic
904214293 1:28907177-28907199 TACTCAGCCTCCCAAGTAGCTGG + Intronic
904246519 1:29191975-29191997 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
904361775 1:29979590-29979612 GCCTCAGCCCCTCTAGTAGCTGG - Intergenic
904589157 1:31599339-31599361 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
905500646 1:38433749-38433771 GACTCAGCCTCGCGAGTAGCTGG + Intergenic
905574819 1:39035573-39035595 TCCTCAGCCTCGCGAGTAGCTGG + Intergenic
905622795 1:39463373-39463395 ACCTCAGCCCCCCAAGTGGCTGG - Intronic
905624906 1:39482969-39482991 ACCTCAGCCTCCCTAGTGGCTGG - Intronic
905661133 1:39726555-39726577 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
905739300 1:40355735-40355757 TTCTCAGCCCCTCAAGTAGCTGG + Intronic
905987502 1:42300083-42300105 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
906005006 1:42461659-42461681 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
906193860 1:43916695-43916717 ACCTCAGCCCCCCGAGTGGCTGG + Intronic
906486574 1:46240052-46240074 GCCTTAGCCCCGCTAGTAGCTGG - Intergenic
906629658 1:47355719-47355741 GCCTCAGCCCCGCAAGTAGCTGG + Intronic
907082334 1:51635205-51635227 AACTCAGCCTCTCCAGTGGCTGG - Intronic
907092001 1:51733658-51733680 GCCTCAGCCCCCCAAGTGGCTGG - Intronic
907179666 1:52558431-52558453 ACCTCAGCCCCCCGAGTGGCTGG + Intergenic
907383784 1:54112249-54112271 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
907404261 1:54244216-54244238 TACTCAGCCTCCCAAGTAGCTGG + Intronic
908011183 1:59778877-59778899 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
908244345 1:62215883-62215905 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
908361924 1:63377074-63377096 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
908551831 1:65216245-65216267 ACCTCAGCCTCCCTAGTGGCTGG + Intronic
908663928 1:66468041-66468063 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
908705750 1:66952754-66952776 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
908729661 1:67212986-67213008 GACTCAGCCTCCCTAGTAGCTGG + Intronic
909086708 1:71176952-71176974 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
909167628 1:72248695-72248717 TTCTCAGCCTCCCTAGTAGCTGG + Intronic
909442759 1:75716354-75716376 TCCTCAGCCTCCCAAGTGGCTGG - Intergenic
909620212 1:77659101-77659123 GACTCAGCCTCCCTAGTAGCTGG - Intronic
909668755 1:78164985-78165007 ACCTCAGCCCACCTAGTGGCTGG - Intergenic
909843859 1:80364977-80364999 GACTCAGCCTCGCGAGTAGCTGG - Intergenic
909901129 1:81137205-81137227 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
910106247 1:83634187-83634209 TCCTCAGCCCCCCGAGTAGCTGG + Intergenic
910175074 1:84420974-84420996 ACCTCAGCCCCTCTAGTAGCTGG - Intergenic
910388433 1:86710377-86710399 TCCTCAGCCCCTCTAGTAGCTGG + Intronic
910635012 1:89398244-89398266 TCCTCAGCCCCCCAAGTAGCTGG + Intergenic
910707531 1:90146076-90146098 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
910789225 1:91033948-91033970 TACTCAGCCTCCCGAGTAGCTGG + Intergenic
910853783 1:91673541-91673563 TCCTCAGCCCCTCAAGTAGCTGG - Intergenic
910917910 1:92310780-92310802 TACTCAGCCTCCCAAGTAGCTGG - Intronic
910920957 1:92346276-92346298 ACCTCAGCCTCTCTAGTGGCTGG + Intronic
910963203 1:92783695-92783717 GCCTCAGCCCCGCGAGTAGCTGG - Intronic
912781531 1:112553327-112553349 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
913027625 1:114861912-114861934 TCCTCAGCCTCGCGAGTAGCTGG + Intronic
913043674 1:115054870-115054892 GCCTCAGCCCCGCTAGTAGCTGG - Intronic
913134128 1:115871379-115871401 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
913592828 1:120345140-120345162 TGCTCAGCCTCCCTAGTAGCTGG + Intergenic
913977254 1:143471623-143471645 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
914701261 1:150136132-150136154 GCCTCAGCCCTGCTAGTAGCTGG - Intronic
915241812 1:154528336-154528358 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
915286851 1:154858693-154858715 TACTCAGCATTGTTAGTGGCAGG - Intronic
915400863 1:155620704-155620726 GCCTCAGCCCTGCTAGTAGCTGG + Intergenic
915415828 1:155742124-155742146 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
915506529 1:156360459-156360481 GCCTCAGCCCTGCTAGTAGCTGG + Intronic
915541338 1:156568635-156568657 TCCTCAGCCCCCCAAGTAGCTGG + Intronic
915761104 1:158314197-158314219 GATTCAGCCTCCCTAGTGGCTGG + Intergenic
915792574 1:158690573-158690595 GACTCAGCCCCCCTAGTAGCTGG + Intergenic
915905102 1:159871782-159871804 AACTCAGCCCCTCCTGTGGCTGG - Intronic
916097108 1:161360996-161361018 GCCTCAGCCCTGCCAGTGGCTGG - Intronic
916706309 1:167354404-167354426 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
916980705 1:170133815-170133837 TACCCAGTCCAGCTACTGGCAGG + Intergenic
917501255 1:175587347-175587369 TACTCAGCTATGCGAGTGGCTGG - Intronic
917832936 1:178913165-178913187 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
917844267 1:179007216-179007238 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
917866306 1:179198954-179198976 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
918460872 1:184775226-184775248 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
918525290 1:185458145-185458167 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
918634385 1:186757247-186757269 ACCTCAGCCTCCCTAGTGGCTGG - Intergenic
919285492 1:195553508-195553530 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
919397901 1:197073197-197073219 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
919638362 1:200025682-200025704 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
919657885 1:200214961-200214983 TCCTCAGCCCCCTTAGTAGCTGG - Intergenic
919693895 1:200553056-200553078 GCCTCAGCCCCCCTAGTAGCTGG + Exonic
919898645 1:202026498-202026520 CACTCAGCCTCCCCAGTGGCTGG - Intergenic
920691131 1:208147134-208147156 TACTCAGCCACCCAAGTAGCTGG + Intronic
920828065 1:209440541-209440563 ACCTCAGCCCCCCTAGTAGCTGG - Intergenic
921064407 1:211612491-211612513 TCCTCAGCCTCCCAAGTGGCTGG + Intergenic
921196715 1:212764729-212764751 TCCTCAGCCTCCCAAGTGGCTGG - Intronic
921477416 1:215628395-215628417 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
922070620 1:222189156-222189178 ATCTCAGCCCCCCTAGTAGCTGG - Intergenic
922268070 1:224005946-224005968 GACTCAGCCTCCCTAGTCGCTGG - Intergenic
922287153 1:224180637-224180659 TCCTCAGCCCCCCAAGTAGCTGG + Intronic
922502290 1:226106110-226106132 TCCTCAGCCTCCCAAGTGGCTGG + Intergenic
922688504 1:227667156-227667178 TCCTCAGCCCCCCAAGTAGCTGG + Intronic
923002240 1:230016938-230016960 ACCTCAGCCTCCCTAGTGGCTGG + Intergenic
923199485 1:231697552-231697574 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
923279269 1:232426543-232426565 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
923369839 1:233298772-233298794 TTCTCAGCCTCCCTAGTAGCTGG - Intergenic
923590629 1:235315928-235315950 GCCTCAGCCTCTCTAGTGGCTGG - Intronic
923695145 1:236241431-236241453 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
923740572 1:236651125-236651147 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
923808259 1:237284264-237284286 TACTCAGCCTCCCAAGTAGCTGG - Intronic
923873316 1:238019733-238019755 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
924063072 1:240196624-240196646 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
924143227 1:241047852-241047874 GTCTCAGCCCCCCTAGTAGCTGG + Intronic
924356135 1:243178212-243178234 GTCTCAGCCTCGCTAGTAGCTGG - Intronic
924520690 1:244803438-244803460 GCCTCAGCCCCTCTAGTAGCTGG - Intergenic
924560206 1:245152522-245152544 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1062914070 10:1234101-1234123 TACTCAGCCTCCCGAGTAGCTGG + Intronic
1064229508 10:13517636-13517658 TACTCAGCCTCCCAAGTAGCTGG - Intronic
1064249044 10:13692975-13692997 TACTCAGCCTCCCAAGTAGCTGG + Intronic
1064373203 10:14772237-14772259 GCCTCAGCCCCACGAGTGGCTGG - Intronic
1064458499 10:15510543-15510565 TCCTCAGCCCCCTTAGTAGCTGG - Intergenic
1064826896 10:19413834-19413856 GCCTCAGCCCCCCAAGTGGCTGG - Intronic
1065011953 10:21428827-21428849 ATCTCAGCCTCCCTAGTGGCCGG - Intergenic
1065292906 10:24248554-24248576 GTCTCAGCCCCCCTAGTAGCTGG - Intronic
1065791488 10:29264535-29264557 GCCTCAGCCACGCTAGTAGCTGG - Intergenic
1065812388 10:29454278-29454300 TCCTCAGCCTCCCAAGTGGCTGG + Intergenic
1066009675 10:31182936-31182958 GACTCAGCCCCCCTAGTAGCTGG + Intergenic
1066105326 10:32151353-32151375 GTCTCAACCCCGCAAGTGGCTGG + Intergenic
1066124343 10:32324876-32324898 GCCTCAGCCTCGCAAGTGGCTGG - Intronic
1066473447 10:35721866-35721888 GCCTCAGCCACGCAAGTGGCTGG + Intergenic
1066519856 10:36205244-36205266 GCCTCAGCCCCGCGAGTAGCTGG + Intergenic
1066687303 10:37993331-37993353 TGCTCAGCCTCCCTAGTAGCTGG + Intergenic
1066725627 10:38389659-38389681 GACTCAGCCTCCCTAGTCGCTGG + Intergenic
1067312893 10:45131739-45131761 TACTCAGCCTCCCTAGAAGCTGG + Intergenic
1067860649 10:49844028-49844050 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1068329568 10:55545388-55545410 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1068332014 10:55583546-55583568 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1068846807 10:61685673-61685695 AACTCAGCCCCCCAAGTAGCTGG + Intronic
1068993765 10:63179292-63179314 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1069018140 10:63454543-63454565 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1069231388 10:66013013-66013035 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1069434570 10:68369368-68369390 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1069450431 10:68512922-68512944 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1069455239 10:68548723-68548745 TACTCAGCCTCCCAAGTAGCCGG - Intergenic
1069516767 10:69083863-69083885 AACTCAGCCTCCCAAGTGGCTGG + Intergenic
1069733715 10:70637267-70637289 ACCTCAGCCTCGCTAGTAGCTGG - Intergenic
1070059771 10:72970654-72970676 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1070138567 10:73718220-73718242 TCTTCAGCCCCGCAAGTAGCTGG - Intergenic
1070141477 10:73741316-73741338 CACTCAGCCTCCCTAGTAGCTGG - Intergenic
1070184939 10:74052489-74052511 GCCTCAGCCCCGCAAGTAGCTGG + Intronic
1070609485 10:77923641-77923663 GCCTCAGCCCCGCAAGTAGCTGG - Intronic
1070805217 10:79266826-79266848 TACTCTGCCCGGCTGGAGGCTGG - Intronic
1071275313 10:84048859-84048881 GTCTCAGCCTCGCTAGTAGCTGG - Intergenic
1071308497 10:84321610-84321632 GACTCAGCCTCCCAAGTGGCTGG + Intergenic
1071672978 10:87627857-87627879 GCCTCAGCCTCGCTAGTAGCTGG - Intergenic
1071846850 10:89529660-89529682 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1071992165 10:91110357-91110379 TCCTCAGCCCCCCAAGTAGCTGG + Intergenic
1072669599 10:97419767-97419789 ACCTCAGCCTCCCTAGTGGCTGG + Intronic
1073198138 10:101711972-101711994 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
1073261776 10:102196050-102196072 GCCTCAGCCCCACTAGTAGCTGG + Intergenic
1073284344 10:102378510-102378532 TACTCAGCCTCCCCAGTAGCTGG - Intronic
1073331429 10:102672495-102672517 AACTCAGCCTCCCAAGTGGCTGG - Intergenic
1073422677 10:103437254-103437276 TCCTCAGCCTCCCAAGTGGCTGG + Intronic
1073520556 10:104124909-104124931 AACTCAGCCTCCCTAGTAGCTGG + Intronic
1074000188 10:109364577-109364599 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1074379628 10:112968691-112968713 ACCTCAGCCTCGCTAGTAGCTGG + Intronic
1075886777 10:125906399-125906421 GCCTCAGCCTCGCTAGTAGCTGG - Intronic
1075888058 10:125919318-125919340 GCCTCAGCCTCGCTAGTAGCTGG + Intronic
1075958979 10:126550622-126550644 TTCTCAGCCTCCCTAGTAGCTGG + Intronic
1076110719 10:127857000-127857022 GCCTCAGCCCCTCAAGTGGCTGG - Intergenic
1076359222 10:129875309-129875331 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1077067759 11:651075-651097 GCCTCAGCCCCGCTAGTAGCTGG + Intronic
1077104260 11:835124-835146 GACTCACCCCTGCTAGCGGCCGG - Intronic
1078247112 11:9583958-9583980 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1078432589 11:11299257-11299279 GACTCAGCCTCCCAAGTGGCTGG + Intronic
1078590415 11:12636345-12636367 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1079019702 11:16899380-16899402 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1079019865 11:16900957-16900979 TGCTCAGCCTCCCTAGTAGCTGG + Intronic
1079243785 11:18738855-18738877 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1080077000 11:28161235-28161257 TACTCAGCCTCCCAAGTAGCTGG + Intronic
1080439873 11:32282804-32282826 ACCTCAGCCCCCCTAGTAGCTGG - Intergenic
1080698399 11:34623198-34623220 AACTCAGCCCCCCGAGTAGCTGG + Intronic
1081176579 11:39934148-39934170 TTCTCAGCCTCTCTAGTAGCTGG - Intergenic
1081234696 11:40633501-40633523 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1081785583 11:45744571-45744593 TACTCAGCCTCCCCAGTAGCTGG - Intergenic
1081947080 11:47006701-47006723 CACTCAGCCTCCCAAGTGGCTGG + Intronic
1081948325 11:47019120-47019142 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1081978744 11:47253071-47253093 ACCTCAGCCCCCCAAGTGGCTGG + Intronic
1082051951 11:47777624-47777646 GCCTCAGCCCCTCTAGTAGCTGG + Intergenic
1082689959 11:56289734-56289756 ACCTCAGCCCCGCAAGTAGCTGG + Intergenic
1082859761 11:57844094-57844116 AACTCAGCCCCCCGAGTAGCTGG - Intergenic
1083601769 11:63953160-63953182 TGCTCAGCCTCCCAAGTGGCTGG + Intronic
1083711182 11:64549697-64549719 TCCTCAGCCCCCCAAGTAGCTGG - Intergenic
1084027500 11:66461110-66461132 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1084297183 11:68220415-68220437 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1084336982 11:68464244-68464266 GCCTCAGCCTCCCTAGTGGCGGG + Intronic
1085141821 11:74151439-74151461 TTCTCAGCCTCCCTAGTAGCTGG + Intronic
1085257823 11:75186321-75186343 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1085360974 11:75887082-75887104 CACTCAGCCTCCCTAGTAGCTGG + Intronic
1085677985 11:78543061-78543083 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1085798533 11:79565963-79565985 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1086114522 11:83233795-83233817 GACTCAGCCTCCCAAGTGGCTGG + Intronic
1087282536 11:96227985-96228007 ACCTCAGCCCCCCGAGTGGCTGG - Intronic
1087504861 11:99006935-99006957 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1088195895 11:107273165-107273187 TACTCAGCCTCCCAAGTAGCTGG - Intergenic
1088224541 11:107605312-107605334 AACTCAGCCTCCCTAGTAGCTGG + Intronic
1088289289 11:108219142-108219164 TACTGAGCCCAGCCAGTAGCAGG - Intronic
1088423976 11:109680931-109680953 TACACAGCCTCCCGAGTGGCTGG + Intergenic
1088599371 11:111461597-111461619 GACTCAGCCCCCCAAGTAGCTGG - Intergenic
1088931981 11:114361469-114361491 AACTCAGCCTCCCTAGTAGCTGG - Intergenic
1089024905 11:115259418-115259440 GCCTCAGCCCCCCAAGTGGCTGG + Intronic
1089266133 11:117263388-117263410 GCCTCAGCCCCGCAAGTGGCTGG + Intronic
1090045922 11:123333208-123333230 TGCTCAGCCTCCCTAGTAGCTGG + Intergenic
1090055233 11:123417820-123417842 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
1091423853 12:368615-368637 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1091454836 12:599267-599289 GCCTCAGCCCCGCAAGTAGCTGG - Intronic
1091458358 12:624992-625014 TACTCAGCCTCCCAAGTAGCCGG - Intronic
1091459662 12:634372-634394 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1091574879 12:1724094-1724116 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1092145883 12:6214459-6214481 TCCTCAGCCCCCCAAGTAGCTGG + Intronic
1092374416 12:7943443-7943465 ACCTCAGCCCCGCAAGTAGCTGG + Intergenic
1092411454 12:8256407-8256429 GACTCAGCCTCCCAAGTGGCTGG + Intergenic
1092457139 12:8654009-8654031 TTCTCAGCCTCCCAAGTGGCTGG - Intronic
1092486763 12:8908766-8908788 TTCTCAGCCTCCCTAGTAGCTGG + Intergenic
1093847374 12:23989275-23989297 ACCTCAGCCCCCCGAGTGGCAGG - Intergenic
1093915809 12:24801487-24801509 TCCTCAGCCTCCCAAGTGGCTGG - Intergenic
1094016282 12:25867934-25867956 TCCTCAGCCCCCCAAGTAGCTGG + Intergenic
1094364760 12:29668573-29668595 GCCTCAGCCCCTCTAGTAGCTGG + Intronic
1094418621 12:30245227-30245249 GACTCAGCCTCCCGAGTGGCTGG - Intergenic
1094542907 12:31377274-31377296 GTCTCAGCCCCCCTAGTAGCTGG - Intergenic
1094811300 12:34140835-34140857 ACCTCAGCCTCCCTAGTGGCTGG - Intergenic
1095587649 12:43865580-43865602 GCCTCAGCCCCTCTAGTAGCTGG - Intronic
1095604052 12:44045726-44045748 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1095903883 12:47357317-47357339 GACTCAGCCTCGCAAGTAGCTGG - Intergenic
1095934744 12:47665753-47665775 ACCTCAGCCCCCCTAGTAGCTGG + Intronic
1096055247 12:48645329-48645351 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1096059807 12:48687151-48687173 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1096151841 12:49318613-49318635 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1096359269 12:50969177-50969199 GTCTCAGCCCCCCTAGTAGCTGG - Intronic
1096733475 12:53633584-53633606 AACTCAGCCTCCCTAGTAGCTGG - Intronic
1097115635 12:56694829-56694851 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1097132804 12:56825547-56825569 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1097271152 12:57774988-57775010 TTCTCAGCCCCCCAAGTAGCTGG - Intronic
1097410597 12:59247921-59247943 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1097476519 12:60063687-60063709 GACTCAGCCTCTCTAGTAGCTGG - Intergenic
1097870409 12:64597245-64597267 TCCTCAGCCCCTCGAGTAGCTGG + Intergenic
1098132938 12:67369279-67369301 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1098331862 12:69361081-69361103 GCCTCAGCCCCTCTAGTAGCTGG - Intronic
1099121689 12:78697682-78697704 TACTCAGCCCCCCGAGTAGCTGG + Intergenic
1099622709 12:85025248-85025270 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1099682766 12:85848939-85848961 CACTCAGCCTCCCTAGTAGCTGG + Intergenic
1099791905 12:87346454-87346476 TTCTCAGCCCCCCGAGTAGCTGG - Intergenic
1100030035 12:90175596-90175618 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1100278631 12:93096206-93096228 GCCTCAGCCCCACTAGTAGCTGG + Intergenic
1100418830 12:94408692-94408714 GACTCAGCCTCTCTAGTAGCTGG + Intronic
1100990258 12:100244293-100244315 GCCTCAGCCCCCCGAGTGGCTGG + Intronic
1101075859 12:101129237-101129259 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
1101120236 12:101571615-101571637 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1101706085 12:107222687-107222709 CCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1102136476 12:110580451-110580473 GCCTCAGCCTCGCTAGTAGCTGG + Intronic
1102537839 12:113594471-113594493 TCCTCAGCCCCCCAAGTAGCTGG - Intergenic
1103187983 12:118978186-118978208 TTCTCAGCCTCACTAGTAGCTGG - Intergenic
1103296567 12:119892129-119892151 ACCTCAGCCCCCCTAGTAGCTGG + Intergenic
1103352692 12:120295970-120295992 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1103431899 12:120894830-120894852 GCCTCAGCCCCACTAGTAGCTGG - Intronic
1103468361 12:121160260-121160282 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1103541126 12:121667366-121667388 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1103714862 12:122939055-122939077 ATCTCAGCCCCCCTAGTAGCTGG - Intronic
1103762423 12:123260834-123260856 ATCTCAGCCTCCCTAGTGGCTGG - Intergenic
1103844853 12:123894203-123894225 ACCTCAGCCTCCCTAGTGGCTGG + Intronic
1104270097 12:127275687-127275709 TACTCTGCCCCACTATTGACGGG + Intergenic
1104465513 12:128986656-128986678 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1104546672 12:129719143-129719165 CACTCAGCCCCCCAAGTAGCTGG - Intronic
1104695427 12:130859965-130859987 GACTCAGCCTCGCGAGTAGCTGG + Intergenic
1104852701 12:131884996-131885018 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1105866584 13:24466294-24466316 AACTCAGCCCCTCAAGTAGCTGG + Intronic
1105885059 13:24634876-24634898 TACTCAGCCTCTCAAGTAGCTGG - Intergenic
1105897468 13:24728400-24728422 TTCTCAGCCTCCCGAGTGGCTGG + Intergenic
1106159060 13:27184357-27184379 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
1106510942 13:30412026-30412048 ACCTCAGCCCCGCAAGTAGCTGG - Intergenic
1106855040 13:33842171-33842193 ACCTCAGCCCCACTAGCGGCTGG - Intronic
1107297968 13:38933266-38933288 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
1107719741 13:43235615-43235637 GCCTCAGCCTCTCTAGTGGCTGG - Intronic
1107746266 13:43513192-43513214 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1107848894 13:44550465-44550487 TCCTCAGCCCCTCAAGTAGCTGG - Intronic
1108135355 13:47351370-47351392 GTCTCAGCCTCCCTAGTGGCTGG + Intergenic
1108248049 13:48536863-48536885 GACTCAGCCTCCCAAGTGGCTGG - Intergenic
1108632125 13:52294973-52294995 GACTCAGCCTCCCGAGTGGCTGG - Intergenic
1108649357 13:52460557-52460579 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1108654575 13:52517621-52517643 GACTCAGCCTCCCGAGTGGCTGG + Intergenic
1108762256 13:53582367-53582389 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1108873450 13:55015513-55015535 GACTCAGCCTCCCGAGTGGCTGG - Intergenic
1109289448 13:60455953-60455975 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1109487181 13:63041295-63041317 GACTCAGCCTCCCGAGTGGCTGG - Intergenic
1110195003 13:72779232-72779254 AACTCAGCCTCGCAAGTAGCTGG + Intronic
1110569576 13:76989989-76990011 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1110681312 13:78315659-78315681 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1110795467 13:79631939-79631961 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1110895329 13:80743880-80743902 GCCTCAGCCCCGCTAGTAGCTGG - Intergenic
1111049554 13:82862755-82862777 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1111250142 13:85591120-85591142 TACTCAGCCTCCCAAGTAGCTGG - Intergenic
1112370763 13:98791513-98791535 TCCTCAGCCTCCCAAGTGGCTGG + Intergenic
1112480402 13:99770200-99770222 TACTCAGCCGCCCAAGTAGCTGG + Intronic
1112485455 13:99815468-99815490 TCCTCAGCCCTGCAAGTAGCTGG - Intronic
1112532367 13:100217328-100217350 TACTCAGCCTCCCGAGTGGCTGG - Intronic
1113225967 13:108159700-108159722 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
1113479838 13:110612488-110612510 TACTCAGCCTCCCAAGTAGCTGG - Intergenic
1114508189 14:23233625-23233647 AACTCAGCCTCCCGAGTGGCTGG - Intronic
1114712528 14:24793118-24793140 TACATAGCCCTGCTTGTGGCAGG - Intergenic
1115269100 14:31532018-31532040 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1115586961 14:34823543-34823565 GCCTCAGCCCCTCTAGTAGCTGG - Intronic
1115629528 14:35230165-35230187 GCCTCAGCCTCTCTAGTGGCTGG + Intronic
1115631039 14:35245528-35245550 TCCTCAGCCCCCCAAGTAGCTGG - Intronic
1115697014 14:35910112-35910134 CACTCAGCCTCCCTAGTAGCTGG + Intronic
1116269895 14:42750024-42750046 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1116833236 14:49742955-49742977 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1116885843 14:50220289-50220311 TCCTCAGCCACCCTAGTAGCTGG - Intronic
1116895213 14:50309795-50309817 GCCTCAGCCCCACAAGTGGCTGG + Intronic
1116930297 14:50684110-50684132 TGCTCAGCCTCCCTAGTTGCTGG + Intergenic
1117236467 14:53782397-53782419 TACTCAGCCTCCCAAGTAGCTGG - Intergenic
1117367279 14:55041587-55041609 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1117388264 14:55238342-55238364 GGCTCAGCCCCGCGAGTAGCTGG + Intergenic
1117432103 14:55677811-55677833 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1117519598 14:56537534-56537556 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1118175221 14:63433150-63433172 ACCTCAGCCCCGCAAGTAGCTGG + Intronic
1118265451 14:64290184-64290206 AACTCAGCCCCCCAAGTAGCTGG + Intronic
1118387112 14:65265179-65265201 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1118429551 14:65702859-65702881 TACTCAGCCTCCCAAGTAGCTGG + Intronic
1118742864 14:68753286-68753308 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1119012010 14:71003196-71003218 ACCTCAGCCCCGCAAGTAGCTGG + Intronic
1119263054 14:73249557-73249579 GCCTCAGCCCCCCTAGTAGCCGG - Intronic
1119290866 14:73493721-73493743 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1119327276 14:73768043-73768065 CACTCAGCCCCCCAAGTAGCTGG - Intronic
1119362127 14:74059578-74059600 GCCTCAGCCCCCCTAGTAGCTGG - Exonic
1119449345 14:74695192-74695214 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1119822820 14:77633311-77633333 TCCTCAGCCCCCCGAGTAGCTGG + Intergenic
1120590413 14:86367607-86367629 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1121012777 14:90531502-90531524 GACTCAGCCTCCCGAGTGGCTGG - Exonic
1121296569 14:92830712-92830734 ACCTCAGCCCCCCAAGTGGCTGG + Intronic
1121851057 14:97221339-97221361 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1122485577 14:102077425-102077447 TACTCAGCCTCCCAAGTGGCTGG + Intergenic
1122493129 14:102133596-102133618 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1122728800 14:103779674-103779696 TCCTCAGCCTCGTGAGTGGCTGG - Intronic
1123003836 14:105311971-105311993 TCCTCAGCCCAGCTCCTGGCAGG + Exonic
1123721902 15:23067830-23067852 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1123928892 15:25148025-25148047 GCCTCAGCCCCACTAGTAGCTGG + Intergenic
1124072102 15:26404985-26405007 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1124946365 15:34270686-34270708 TCCTCAGCCTCCCAAGTGGCTGG - Intronic
1124953824 15:34346766-34346788 GCCTCAGCCCCGCAAGTAGCTGG - Intronic
1125013478 15:34906254-34906276 GCCTCAGCCCTGCTAGTAGCTGG - Intronic
1125426893 15:39557596-39557618 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1125624842 15:41099665-41099687 TCCTCAGCCTCCCAAGTGGCTGG - Intronic
1125655858 15:41356467-41356489 GACTCAGCCTCCCTAGTAGCTGG + Intronic
1125657013 15:41366396-41366418 TTCTCAGCCTCCCGAGTGGCTGG + Intronic
1125660782 15:41393237-41393259 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1125717106 15:41825648-41825670 TCCACAGCCCCTCCAGTGGCAGG + Exonic
1125811414 15:42544697-42544719 CCCTCAGCCCCCCTAGTAGCTGG - Intronic
1126024541 15:44433198-44433220 TACTCAGCCCCGCTAGTGGCTGG - Intronic
1126524463 15:49635605-49635627 GCCTCAGCCTCGCTAGTAGCTGG + Intronic
1126764710 15:52000689-52000711 TCCTCAGCCTCCCCAGTGGCTGG - Intronic
1126816303 15:52458503-52458525 ACCTCAGCCTCTCTAGTGGCGGG - Intronic
1126967824 15:54075368-54075390 GACTCAGCCTCCCGAGTGGCTGG - Intronic
1127470467 15:59285470-59285492 GCCTCAGCCCCCCGAGTGGCTGG + Intronic
1127513799 15:59671959-59671981 ACCTCAGCCTCCCTAGTGGCTGG - Intronic
1127589511 15:60409608-60409630 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1127621581 15:60739454-60739476 TACTCAGCCCCTCGAGTAGCAGG - Intronic
1128019210 15:64375523-64375545 ACCTCAGCCTCCCTAGTGGCTGG + Intronic
1128189405 15:65677322-65677344 TTCTCAGCCTCCCGAGTGGCTGG + Intronic
1128271169 15:66311246-66311268 ACCTCAGCCCCCCAAGTGGCTGG - Intronic
1128651949 15:69422913-69422935 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1128709086 15:69858449-69858471 TGCTCACCCCAGCTAGGGGCAGG - Intergenic
1128861843 15:71080743-71080765 GCCTCAGCCCCACAAGTGGCTGG + Intergenic
1128947767 15:71841748-71841770 ATCTCAGCCTCCCTAGTGGCTGG + Intronic
1128956908 15:71956529-71956551 GCCTCAGCCTCGCTAGTAGCTGG - Intronic
1129286385 15:74528491-74528513 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1129439330 15:75568720-75568742 TCCTCAGCCTCTATAGTGGCTGG - Intronic
1130005863 15:80097112-80097134 GCCTCAGCCCCTCTAGTAGCTGG + Intronic
1130021434 15:80234996-80235018 GACTCTGCCCCCCTGGTGGCTGG + Intergenic
1130547296 15:84866487-84866509 TACTCAGCCCTGTTAGTGAAAGG + Intronic
1130686037 15:86038771-86038793 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1130795432 15:87203590-87203612 TACTCAACCCCTCTAGAGGAAGG - Intergenic
1130839077 15:87680877-87680899 GCCTCAGCCACCCTAGTGGCTGG + Intergenic
1130995297 15:88900125-88900147 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1131129361 15:89886224-89886246 TACTCAGCCTCTCGAGTAGCTGG - Intronic
1131134401 15:89922565-89922587 GCCTCAGCCCCGCAAGTAGCTGG + Intergenic
1131152045 15:90053460-90053482 CACTCAGCCCCCCAAGTAGCTGG + Intronic
1131214118 15:90522663-90522685 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1131424644 15:92335538-92335560 TACTCAGCCTCCCGAGTAGCTGG + Intergenic
1131953542 15:97706702-97706724 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1131972925 15:97910626-97910648 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1132509389 16:330173-330195 ATCTCAGCCTCCCTAGTGGCTGG + Intronic
1132872210 16:2120585-2120607 TCCTCAGCCCCCCGAGTAGCTGG - Intronic
1132978636 16:2723010-2723032 GCCTCAGCCCCGCTAGTAGCTGG + Intergenic
1133045421 16:3085893-3085915 GCCTCAGCCCCTCTAGTAGCGGG - Intergenic
1133208522 16:4249105-4249127 GCCTCAGCCCCACTAGTAGCTGG + Intergenic
1133240332 16:4410308-4410330 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1133250928 16:4480457-4480479 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1133251224 16:4482913-4482935 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1133358861 16:5157560-5157582 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1133379044 16:5314613-5314635 TTCTCAGCCTCCCTAGTAGCTGG + Intergenic
1134009806 16:10843539-10843561 TTCTCAGTCCCGCGAGTAGCTGG + Intergenic
1134176256 16:12008854-12008876 GACTCAGCCTCCCTAGTAGCTGG + Intronic
1134369007 16:13606267-13606289 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1134426575 16:14154218-14154240 ACCTCAGCCCCGCAAGTAGCAGG - Intronic
1134477709 16:14590134-14590156 GACTCAGCCCCCCGAGTAGCTGG - Intronic
1134490289 16:14691080-14691102 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1134495670 16:14730197-14730219 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1134501218 16:14770510-14770532 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1134579362 16:15358522-15358544 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1134603315 16:15550445-15550467 ACCTCAGCCCCGCAAGTTGCTGG + Intronic
1134651500 16:15912472-15912494 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1134723220 16:16399029-16399051 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1134751661 16:16630075-16630097 CACTCAGCCTCCCTAGTAGCTGG + Intergenic
1134944208 16:18312841-18312863 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1134993798 16:18723548-18723570 CACTCAGCCTCCCTAGTAGCTGG - Intergenic
1135006566 16:18828881-18828903 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1135434047 16:22413280-22413302 GACTCAGCCTCCCTAGTAGCTGG + Intronic
1135578485 16:23604957-23604979 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1135986238 16:27186539-27186561 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1136038068 16:27555719-27555741 GCCTCAGCCCCCCAAGTGGCTGG - Intronic
1136165631 16:28451187-28451209 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1136197341 16:28663822-28663844 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1136213680 16:28777969-28777991 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1136258413 16:29057893-29057915 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1136320082 16:29478423-29478445 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1136342141 16:29651280-29651302 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1136369672 16:29828492-29828514 GTCTCAGCCCCCCTAGTAGCTGG + Intronic
1136434653 16:30217764-30217786 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1136577807 16:31134740-31134762 ACCTCAGCCTCCCTAGTGGCTGG - Intronic
1136583384 16:31168318-31168340 GACTCAGCCCCCCGAGTAGCTGG + Intergenic
1136665169 16:31804766-31804788 TCCTCAGCCTCCCAAGTGGCTGG + Intergenic
1137344895 16:47647610-47647632 TTCTCAGCCTCCCTAGTAGCTGG + Intronic
1137631683 16:49950782-49950804 TTCTCAGCCTCTCTAGTAGCTGG - Intergenic
1137815523 16:51394339-51394361 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1137988019 16:53127067-53127089 AACTCAGCCTCCCTAGTAGCTGG + Intronic
1138018624 16:53456059-53456081 AACTCAGCCTCGCAAGTAGCTGG - Intronic
1138053506 16:53808217-53808239 AACTCAGCCTCGCAAGTAGCTGG - Intronic
1138081100 16:54092166-54092188 AACTCAGCCCCCCAAGTAGCTGG - Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138122314 16:54410552-54410574 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1138838564 16:60469315-60469337 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1139054292 16:63163294-63163316 GCCTCAGCCCCGCGAGTAGCTGG + Intergenic
1139103412 16:63797702-63797724 GTCTCAGCCCCCCTAGTAGCTGG + Intergenic
1139565205 16:67770821-67770843 ACCTCAGCCCCTCAAGTGGCTGG - Intronic
1139586487 16:67907373-67907395 GCCTCAGCCCCCCAAGTGGCTGG + Intronic
1139626791 16:68196232-68196254 TCCTCAGCCCCCCGAGTAGCTGG + Intronic
1139643648 16:68311302-68311324 GACAGAGCCCCGCGAGTGGCAGG - Exonic
1139844943 16:69913955-69913977 TCCTCAGCCTCGCGAGTAGCTGG - Intronic
1140083524 16:71773826-71773848 TACTCAGCCTCCCAAGTAGCTGG - Intronic
1140084814 16:71785765-71785787 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1140511154 16:75509398-75509420 TCCTCAGCCTCCCAAGTGGCTGG - Intergenic
1140685220 16:77426897-77426919 AACTCAGCCCCCCAAGTAGCTGG - Intronic
1141072964 16:80974770-80974792 TATTCAGTCCCCCTAGTGTCAGG - Exonic
1141111484 16:81274376-81274398 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1141204856 16:81925770-81925792 GCCTCAGCCCCGCCAGTAGCTGG - Intronic
1141547896 16:84784483-84784505 TCCTCAGCCTCCCTAGTAGCCGG + Intergenic
1141571486 16:84936603-84936625 TACTCAGCCTCCCAAGTAGCCGG - Intergenic
1142626346 17:1194766-1194788 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1142647060 17:1321066-1321088 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1142819298 17:2452020-2452042 ACCTCAGCCCCCCTAGTAGCTGG - Intronic
1143044855 17:4069714-4069736 TCCTCAGCCCCCCGAGTAGCTGG - Intronic
1143897915 17:10151252-10151274 GCCTCAGCCCTGCTAGTAGCTGG + Intronic
1144361187 17:14495134-14495156 TCCTCAGCCCCCCTAGCAGCTGG + Intergenic
1144463666 17:15479260-15479282 TCCCCAGCCCCGCTATTGTCTGG - Intronic
1144531302 17:16041849-16041871 GCCTCAGCCCCCCGAGTGGCTGG + Intronic
1144878147 17:18413403-18413425 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1145154082 17:20531006-20531028 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1145184311 17:20780848-20780870 CACTCAGCCTCCCCAGTGGCTGG + Intergenic
1145413635 17:22694870-22694892 GCCTCAGCCCCGCAAGGGGCGGG + Intergenic
1146099517 17:29966523-29966545 TACTCAGCCTCCCAAGTAGCTGG - Intronic
1146195469 17:30808705-30808727 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1146325554 17:31882898-31882920 ACCTCAGCCCCGCAAGTAGCTGG + Intronic
1146369076 17:32253527-32253549 TACTCAGCCTCCCAAGTGGCCGG + Intergenic
1146437982 17:32869102-32869124 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1147111017 17:38261600-38261622 TCCTCAGCCTCGCGAGTAGCTGG + Intergenic
1147145278 17:38481088-38481110 GCCTCAGCCCCGCTAGTAACTGG + Intronic
1147195417 17:38763237-38763259 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1147280490 17:39356468-39356490 ATCTCAGCCCCCCAAGTGGCTGG + Intronic
1147353380 17:39869517-39869539 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1147870033 17:43580703-43580725 GCCTCAGCCCCCCAAGTGGCTGG - Intergenic
1147939099 17:44033084-44033106 GCCTCAGCCCCGCGAGTAGCTGG - Intergenic
1147948989 17:44096586-44096608 GCCTCAGCCCCGCAAGTAGCTGG + Intronic
1148004698 17:44417327-44417349 GACTCAGCCCCTCTAGCAGCTGG + Intronic
1148014063 17:44508355-44508377 GTCTCAGCCCCCCTAGTAGCTGG - Intergenic
1148235589 17:45966472-45966494 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1148418494 17:47526841-47526863 TCCTCAGCCTCGCGAGTAGCTGG - Intronic
1148650580 17:49247433-49247455 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1148696712 17:49564462-49564484 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1148901070 17:50877644-50877666 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1149711362 17:58745377-58745399 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1149883160 17:60313134-60313156 TACTCAGCCTCCCGAGTAGCTGG - Intronic
1149965125 17:61154548-61154570 AACTCAGCCACCCCAGTGGCTGG + Intronic
1150163062 17:62915545-62915567 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1150518821 17:65844897-65844919 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1150664730 17:67122429-67122451 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1150779772 17:68111961-68111983 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1151283691 17:73094738-73094760 CACTCAGCCTCCCTAGTAGCTGG - Intergenic
1151285823 17:73110319-73110341 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1151577371 17:74959478-74959500 TTCTCACCCCAGCTAGTGGCAGG - Intronic
1151642009 17:75402958-75402980 GCCTCAGCCTCGCTAGTAGCTGG - Intronic
1151913813 17:77102914-77102936 TACTCAGCCTCCCAAGTAGCTGG + Intronic
1152266838 17:79300017-79300039 AACTCAGCCTCCCGAGTGGCTGG + Intronic
1152442400 17:80317021-80317043 CAGTCAGCCATGCTAGTGGCCGG - Intronic
1152868740 17:82739401-82739423 GTCTCAGCCTCGCGAGTGGCTGG + Intronic
1153197892 18:2620947-2620969 TCCTCAGCCTCCCAAGTGGCTGG - Intergenic
1153297982 18:3565718-3565740 GACTCAGCCTCCCGAGTGGCTGG - Intronic
1153301879 18:3598580-3598602 GACTCAGCCTCCCTAGTAGCTGG + Intronic
1153307676 18:3647137-3647159 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1153475935 18:5498477-5498499 TACTCAGCCTCCCAAGTAGCTGG - Intronic
1153882374 18:9432611-9432633 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1154012963 18:10591260-10591282 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1154293802 18:13132688-13132710 TCCTCAGCCTCTCTAGTAGCTGG + Intergenic
1155000169 18:21678070-21678092 TACTCAGCCTCCCAAGTAGCTGG + Intronic
1155131704 18:22941284-22941306 GGCTCAGCCCCGCAAGTAGCTGG + Intronic
1155219826 18:23674194-23674216 GCTTCAGCCCCGCTAGTAGCTGG + Intergenic
1155316493 18:24577127-24577149 GCCTCAGCCCCCCTAGTGGCTGG + Intergenic
1155538627 18:26843515-26843537 TCCTCAGCCCCCCGAGTAGCTGG - Intergenic
1156202543 18:34851214-34851236 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1157246580 18:46059914-46059936 GTCTCAGCCTCCCTAGTGGCTGG - Intronic
1157253289 18:46115342-46115364 GCCTCAGCCCCTCTAGTAGCTGG - Intronic
1157373253 18:47138049-47138071 TTCTCAGCCTCCCTAGTAGCTGG - Intronic
1157823725 18:50793322-50793344 TCCTCAGCCTCCCAAGTGGCTGG - Intergenic
1157828626 18:50835746-50835768 TACTGAGCCCAGCCAGTGGTAGG + Intergenic
1158495249 18:57949471-57949493 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1158579227 18:58667140-58667162 TACTCAGCCTCCCGAGTAGCTGG + Intergenic
1158635956 18:59158168-59158190 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1158715291 18:59873581-59873603 ACCTCAGCCCCGTGAGTGGCTGG - Intergenic
1158723804 18:59949819-59949841 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
1158978440 18:62735157-62735179 ACCTCAGCCTCCCTAGTGGCTGG + Intronic
1159556072 18:69946067-69946089 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1159753193 18:72328363-72328385 ACCTCAGCCTCCCTAGTGGCTGG + Intergenic
1159971770 18:74664378-74664400 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1160176738 18:76601011-76601033 GCCTCAGCCCCGCAAGTAGCTGG - Intergenic
1160311101 18:77790959-77790981 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1160801084 19:969420-969442 TACTCAGCCTCCCGAGTAGCTGG - Intronic
1160837056 19:1129722-1129744 AACTCACCCCCGCTCCTGGCTGG - Intronic
1160855746 19:1216751-1216773 ATCTCAGCCCCGCAAGTAGCTGG - Intronic
1161000616 19:1908988-1909010 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1161054333 19:2182424-2182446 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1161309143 19:3584484-3584506 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1161856682 19:6769731-6769753 TCCTCAGCCTCCCTAGTAGCCGG - Intergenic
1161930209 19:7334418-7334440 ACCTCAGCCTCCCTAGTGGCTGG - Intergenic
1162022898 19:7875876-7875898 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
1162066676 19:8130010-8130032 GACTCAGCCCCCCAAGTAGCTGG + Intronic
1162102792 19:8350296-8350318 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1162318679 19:9957671-9957693 TTCTCAGCCTCGCGAGTAGCTGG - Intergenic
1162527518 19:11215055-11215077 GCCTCAGCCTCGCTAGTAGCTGG + Intronic
1162575058 19:11494573-11494595 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1162586487 19:11562294-11562316 GCCTCAGCCTCGCTAGTAGCTGG - Intronic
1162647022 19:12057314-12057336 TCCTCAGCCCCCCAAGTAGCTGG - Intergenic
1162752238 19:12835876-12835898 GCCTCAGCCTCGCTAGTAGCTGG + Intronic
1162865923 19:13546925-13546947 TACTCAGCCTCCCGAGTAGCTGG + Intronic
1162878691 19:13640562-13640584 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1162945151 19:14038767-14038789 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1163028425 19:14527996-14528018 TTCTCAGCCTCCCTAGTAGCTGG + Intronic
1163065807 19:14793824-14793846 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1163274981 19:16277899-16277921 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1163347922 19:16756136-16756158 TACTCAGCCTCCCAAGTAGCTGG - Intronic
1163416418 19:17189515-17189537 GCCTCAGCCCCGCAAGTAGCTGG - Intronic
1163434519 19:17287314-17287336 GCCTCAGCCCCCCTAGTAGCTGG - Exonic
1163537462 19:17885119-17885141 ACCTCAGCCCCCCTAGTTGCTGG + Intronic
1163859013 19:19730795-19730817 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1163864789 19:19763871-19763893 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1164032544 19:21420864-21420886 GCCTCAGCCCCCCGAGTGGCTGG + Intronic
1164042964 19:21510021-21510043 TACTCAGCCTCCCAAGTAGCTGG + Intronic
1164062344 19:21686560-21686582 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1164139698 19:22448164-22448186 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1164988975 19:32670869-32670891 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1165238384 19:34442544-34442566 TGCTCAGCCTCTCGAGTGGCTGG + Intronic
1165457610 19:35922880-35922902 GCCTCAGCCCCGCTAGTAGCTGG + Intergenic
1165685318 19:37814834-37814856 GACTCAGCCCCTCTAGTAGCTGG - Intronic
1166035379 19:40164441-40164463 ATCTCAGCCCCACAAGTGGCTGG + Intergenic
1166056227 19:40290993-40291015 TCCTCAGCCTCCCAAGTGGCTGG + Intergenic
1166189257 19:41164833-41164855 TGCTCAGCCCCCCTAGTAGCTGG - Intergenic
1166287607 19:41841549-41841571 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1166567329 19:43773180-43773202 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1166850811 19:45759914-45759936 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1166858909 19:45798242-45798264 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1166997519 19:46726828-46726850 TTCTGAGCCCCGCTAGGGGAGGG - Intronic
1167147323 19:47690114-47690136 GACTCAGCCTCCCTAGTAGCTGG + Intronic
1167287387 19:48606194-48606216 AACTCAGCCTCCCGAGTGGCTGG - Intronic
1167326411 19:48828945-48828967 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1167328400 19:48838650-48838672 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1167379727 19:49131705-49131727 GCCTCAGCCTCTCTAGTGGCTGG - Intronic
1167394047 19:49215704-49215726 TCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1167659698 19:50789436-50789458 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1167929031 19:52848663-52848685 TACTCAGCCTCTCTAGGAGCTGG + Intronic
1168095591 19:54112976-54112998 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1168108087 19:54176441-54176463 GTCTCAGCCCCCCTAGTAGCTGG - Intronic
1168152705 19:54457453-54457475 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1168668386 19:58221754-58221776 CGCTCAGCCCCACTAGTAGCTGG + Intergenic
925341012 2:3136279-3136301 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
925558636 2:5162537-5162559 TCCTCAGCCTCTCTAGTAGCTGG - Intergenic
926029543 2:9574046-9574068 ACCTCAGCCTCCCTAGTGGCTGG + Intergenic
927179606 2:20435432-20435454 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
927247588 2:20970006-20970028 TCCTCAGCCCCCCAAGTAGCTGG + Intergenic
927360396 2:22225534-22225556 CACTCAGCCTCCCTAGTGGCTGG + Intergenic
927549345 2:23983788-23983810 GCCTCAGCCCCTCTAGTAGCTGG + Intronic
927625268 2:24710206-24710228 GCCTCAGCCCCACTAGTAGCTGG + Intronic
927774591 2:25892526-25892548 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
928045219 2:27924497-27924519 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
928153511 2:28854803-28854825 TCCTCAGCCTCCCAAGTGGCTGG - Intronic
928440988 2:31291857-31291879 TACTCAGCCTCCCTAGTTACTGG + Intergenic
928642444 2:33314432-33314454 TCCTCAGCCTCTCGAGTGGCTGG - Intronic
928643301 2:33323520-33323542 TCCTCAGCCTCGCAAGTAGCTGG - Intronic
929306252 2:40365882-40365904 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
929499655 2:42479529-42479551 GCCTCAGCCCCCCAAGTGGCTGG - Intronic
929676412 2:43935966-43935988 TCCTCAGCCCCCCGAGTAGCTGG - Intronic
929836096 2:45401196-45401218 TCCTCACCCTCCCTAGTGGCTGG - Intronic
929957686 2:46471219-46471241 TACTCTGCCCAGTTAGTGGGAGG - Intronic
929971212 2:46578639-46578661 TCCTCAGCCCCCCAAGTAGCTGG - Intronic
930049129 2:47200373-47200395 GCCTCAGCCTCTCTAGTGGCTGG - Intergenic
930513101 2:52370961-52370983 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
930816453 2:55603065-55603087 GCCTCAGCCACCCTAGTGGCTGG + Intronic
930819740 2:55633525-55633547 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
930836538 2:55799762-55799784 GACTCAGCCTCGCGAGTAGCTGG - Intergenic
932093313 2:68825658-68825680 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
932270827 2:70407822-70407844 TACTCAGCCTCCCAAGTAGCTGG - Intergenic
932896974 2:75649742-75649764 TACTCAGTCTCCCAAGTGGCTGG + Intronic
932900975 2:75699688-75699710 AGCTCAGCCCCGCAAGTGGCTGG + Intronic
933237970 2:79886394-79886416 TATTCAGCCTTGCAAGTGGCTGG + Intronic
933240595 2:79916695-79916717 GCCTCAGCCTCGCTAGTAGCTGG + Intronic
933255508 2:80076391-80076413 TGCTCAGCCTCCCTAGTAGCTGG + Intronic
933489971 2:82973524-82973546 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
933508887 2:83214601-83214623 GCCTCAGCCCCGCAAGTAGCTGG + Intergenic
933730442 2:85452194-85452216 ACCTCAGCCCCCCTAGTAGCTGG - Intergenic
933866114 2:86519257-86519279 TACTCAGCCTCCCAAGTAGCTGG - Intronic
934083138 2:88486718-88486740 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
935160850 2:100528230-100528252 TGCTCAGCCTCTCTAGTAGCTGG - Intergenic
935193632 2:100797843-100797865 GACTCAGCCTCCCGAGTGGCTGG - Intergenic
935318885 2:101865837-101865859 TCCTCAGCACTGCTAATGGCAGG + Intronic
936477461 2:112851779-112851801 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
936623906 2:114127760-114127782 AACTCAGCCTCCCTAGTAGCTGG + Intergenic
936747302 2:115592639-115592661 GCCTCAGCCTCGCTAGTAGCTGG - Intronic
937255712 2:120553982-120554004 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
937754424 2:125518433-125518455 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
938211394 2:129468185-129468207 AACTCAGCCTCCCTAGTAGCTGG - Intergenic
938213910 2:129492010-129492032 GCCTCAGCCCCCCGAGTGGCTGG + Intergenic
938296058 2:130180384-130180406 TACTCAGCCTCCCAAGTGGCTGG + Intronic
938793374 2:134696888-134696910 TCCTCAGCCCCCCGAGTAGCTGG + Intronic
939059340 2:137400895-137400917 TATTCAGGCCCACTAGTGGCAGG + Intronic
939114964 2:138049937-138049959 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
939992047 2:148885098-148885120 TTCTCAGCCTCCCTAGTAGCTGG + Intronic
940058425 2:149537958-149537980 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
940207466 2:151219731-151219753 TCCTCAGCCCCCCAAGTAGCTGG + Intergenic
940648854 2:156420284-156420306 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
940957422 2:159743791-159743813 GCCTCAGCCCCTCAAGTGGCTGG - Intronic
941488663 2:166115242-166115264 GTCTCAGCCCCCCAAGTGGCGGG - Intronic
941538862 2:166757575-166757597 TCCTCAGCCTCTCAAGTGGCTGG - Intergenic
941818248 2:169820070-169820092 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
941897709 2:170646154-170646176 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
942415785 2:175758086-175758108 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
942640668 2:178057970-178057992 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
942766184 2:179459987-179460009 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
942986243 2:182145612-182145634 GCCTCAGCCCCGCAAGTAGCTGG - Intronic
943157618 2:184204383-184204405 GCCTCAGCCTCGCTAGTAGCTGG + Intergenic
943666382 2:190613700-190613722 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
943699207 2:190971825-190971847 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
944143078 2:196477935-196477957 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
944494441 2:200292010-200292032 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
944714748 2:202367405-202367427 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
944789557 2:203110557-203110579 AACTCAGCCTCCCAAGTGGCTGG - Intronic
945149459 2:206773198-206773220 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
945302939 2:208231096-208231118 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
945751953 2:213798366-213798388 GCCTCAGCCTCGCTAGTAGCTGG + Intronic
946711057 2:222505818-222505840 TCCTCAGCCCCCCAAGTAGCTGG - Intronic
946853366 2:223929300-223929322 GCCTCAGCCCCGCTAGTAGCTGG + Intronic
946915930 2:224521543-224521565 GCCTCAGCCCCGCTAGTAGCTGG + Intronic
947387443 2:229605775-229605797 TCCTCAGCCCCTCAAGTAGCTGG - Intronic
947427664 2:229998505-229998527 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
947442946 2:230139374-230139396 GACTCAGCCCCCCAAGTAGCTGG + Intergenic
947627910 2:231632577-231632599 ACCTCAGCCCCGCAAGTAGCTGG + Intergenic
947631180 2:231654143-231654165 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
947725706 2:232398695-232398717 AACTCAGCCTCGCAAGTAGCTGG + Intergenic
947816048 2:233037737-233037759 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
948984229 2:241510131-241510153 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
949069837 2:242017828-242017850 TCCTCAGCCTCCCCAGTGGCTGG - Intergenic
1168791121 20:576757-576779 TCCTCAGCCCCCCAAGTAGCTGG + Intergenic
1169365685 20:4990484-4990506 TACTCAGCCTCCTGAGTGGCAGG + Intronic
1169431381 20:5539349-5539371 ACCTCAGCCCCGCAAGTAGCTGG - Intergenic
1169442703 20:5646231-5646253 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1169477902 20:5949244-5949266 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1170640451 20:18147697-18147719 GCCTCAGCCCCTCTAGTAGCTGG + Intronic
1170759427 20:19236639-19236661 TCCTCAGCCTCCCCAGTGGCTGG - Intronic
1171217337 20:23362075-23362097 TCCTCAGCCCCGCCAGGGGCGGG + Intergenic
1171463800 20:25313665-25313687 AACTCAGCCTCCCTAGTAGCTGG - Intronic
1171465503 20:25325089-25325111 TCCTCAGCCTCACAAGTGGCTGG - Intronic
1171956314 20:31466483-31466505 GTCTCAGCCCCCCGAGTGGCTGG - Intronic
1172050326 20:32112298-32112320 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1172267052 20:33625370-33625392 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1172311420 20:33921247-33921269 GCCTCAGCCCCGCAAGTAGCTGG + Intergenic
1172527616 20:35609776-35609798 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1172566836 20:35937351-35937373 TCCTCAGCCTCCCAAGTGGCTGG - Intronic
1172721849 20:37004926-37004948 TGCTCAGCCTCCCGAGTGGCAGG - Intronic
1173786151 20:45794261-45794283 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1173980807 20:47222419-47222441 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1174365850 20:50055779-50055801 ACCTCAGCCTCGCGAGTGGCTGG + Intergenic
1174552096 20:51369440-51369462 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
1174732337 20:52930108-52930130 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1174827145 20:53778603-53778625 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1174845136 20:53936542-53936564 TCCTCAGCCCCCCGAGTAGCTGG + Intergenic
1175200531 20:57273954-57273976 TCCTCAGCCCCCCGAGTAGCTGG + Intergenic
1175276876 20:57777543-57777565 GCCTTAGCCCCGCTAGTAGCTGG + Intergenic
1175871041 20:62209613-62209635 TCCCCAGCCCCGCCAGTGGGCGG - Intergenic
1176815886 21:13602652-13602674 GCCTCAGCCCCACTAGTAGCTGG - Intergenic
1176914268 21:14605954-14605976 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1176982978 21:15404618-15404640 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1177563964 21:22794679-22794701 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1177639142 21:23824152-23824174 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1178494943 21:33078560-33078582 AACTCAGCCTCCCCAGTGGCTGG - Intergenic
1178560251 21:33632490-33632512 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1178565686 21:33682328-33682350 TTCTCAGCCTCCCTAGTAGCTGG + Intronic
1178711555 21:34921744-34921766 ACCTCAGCCTCCCTAGTGGCTGG + Intronic
1179205974 21:39278982-39279004 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1179453938 21:41485532-41485554 GCCTCAGCCCCCCAAGTGGCTGG - Intronic
1180642113 22:17307299-17307321 GCCTCAGCCTCGCTAGTAGCTGG - Intergenic
1180757954 22:18176165-18176187 TCCTCAGCCTCCCGAGTGGCTGG - Intronic
1180768242 22:18359958-18359980 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
1180778067 22:18502432-18502454 TCCTCAGCCTCCCGAGTGGCTGG + Intergenic
1180810791 22:18759743-18759765 TCCTCAGCCTCCCGAGTGGCTGG + Intergenic
1180878517 22:19187044-19187066 TTCTCAGCCTCCCGAGTGGCTGG + Intronic
1181096214 22:20506990-20507012 AACTCAGCCTAGCTAGTTGCTGG - Intronic
1181196940 22:21193998-21194020 TCCTCAGCCTCCCGAGTGGCTGG + Intergenic
1181295695 22:21836753-21836775 ACCTCAGCCCCCCAAGTGGCTGG - Intronic
1181554529 22:23660817-23660839 TCCTCAGCCCCGCAAGTAGCTGG - Intergenic
1181564202 22:23724313-23724335 TTCTCAGCCTCCCTAGTAGCTGG - Intergenic
1181645303 22:24227932-24227954 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1181926940 22:26367456-26367478 ACCTCAGCCTCGCGAGTGGCTGG + Intronic
1182491467 22:30675066-30675088 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1182493390 22:30689260-30689282 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1182741954 22:32574229-32574251 TGCTCAGCCTCCCGAGTGGCTGG - Intronic
1182809963 22:33107438-33107460 ACCTCAGCCCCGCAAGTAGCTGG - Intergenic
1183193971 22:36340544-36340566 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1183275758 22:36896482-36896504 TCCTCAGCCTCCCAAGTGGCTGG - Intergenic
1183324010 22:37181571-37181593 GCCTCAGCCTCCCTAGTGGCTGG - Exonic
1183399186 22:37591492-37591514 TCCTCAGCCACCCAAGTGGCTGG + Intergenic
1183461944 22:37956529-37956551 GACTCAGCCCCCCAAGTAGCTGG + Intronic
1183643736 22:39109847-39109869 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1183792671 22:40085983-40086005 ACCTCAGCCCCTCTAGTAGCTGG + Intronic
1183854359 22:40620237-40620259 TACTCAGCCTCCCGAGTAGCTGG + Intronic
1183881579 22:40836334-40836356 TCCTCAGCCTCCCAAGTGGCTGG - Intronic
1183913939 22:41101524-41101546 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1184208570 22:43021685-43021707 TCCTCAGCCTCCCAAGTGGCTGG - Intergenic
1184219840 22:43092755-43092777 GCCTCAGCCCCCCTAGTGGCTGG - Intergenic
1184222367 22:43109416-43109438 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1184223503 22:43115575-43115597 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1184440985 22:44514972-44514994 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
1184487189 22:44786900-44786922 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1184771844 22:46601679-46601701 TCCTCAGCCTCCCGAGTGGCTGG - Intronic
1185229457 22:49671854-49671876 TCCTCAGCCCCGCTGGAGCCAGG + Intergenic
1185353491 22:50351153-50351175 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1185378026 22:50491373-50491395 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1203229860 22_KI270731v1_random:100845-100867 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
949305599 3:2637054-2637076 AACTCAGCCTCCCTAGTAGCTGG + Intronic
950237440 3:11335810-11335832 GACTCAGCCTCCCGAGTGGCTGG + Intronic
950362902 3:12462383-12462405 TCCCCAGCCCCGGTGGTGGCAGG - Intergenic
950649791 3:14400183-14400205 GCCTCAGCCCCGCTAGTAGCTGG - Intergenic
951207158 3:19936751-19936773 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
952069986 3:29623000-29623022 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
952299366 3:32090250-32090272 GCCTCAGCCTCGCTAGTAGCTGG - Intergenic
953003359 3:38954872-38954894 TGCTCAGCCTCCCGAGTGGCTGG - Intergenic
953004082 3:38961171-38961193 TATTCAGCGCCCCTTGTGGCAGG - Intergenic
953219944 3:40960458-40960480 GCCTCAGCCTCTCTAGTGGCTGG + Intergenic
953542113 3:43829915-43829937 ACCTCAGCCTCCCTAGTGGCTGG - Intergenic
953573013 3:44087392-44087414 GCCTCAGCCCCGCTAGTAGCTGG - Intergenic
953962378 3:47276439-47276461 GCCTCAGCCCTGCTAGTAGCTGG - Intronic
953975388 3:47378239-47378261 ACCTCAGCCTCCCTAGTGGCTGG - Intergenic
954017345 3:47705208-47705230 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
954063149 3:48085935-48085957 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
954110484 3:48430239-48430261 TTCACAGCCCCGCTAGAGGTGGG - Intergenic
954174458 3:48833148-48833170 TCCTCAGCCCCCCAAGTAGCTGG + Intronic
954184771 3:48908552-48908574 ATCTCAGCCCCACTAGTAGCTGG + Intergenic
954349906 3:50034644-50034666 GACTCAGCCTCCCTAGTAGCTGG - Intronic
954485800 3:50850243-50850265 GCCTCAGCCCCCCTAGTGGCTGG - Intronic
954814847 3:53272533-53272555 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
955293128 3:57711241-57711263 TACTCAGCCTCCCAAGTGGCGGG + Intergenic
955950517 3:64238371-64238393 TACTCAGCCTCCCGAGTAGCTGG - Intronic
956128323 3:66032323-66032345 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
956182807 3:66533323-66533345 ACCTCAGCCCCGCTAGTAGCTGG + Intergenic
956328134 3:68075809-68075831 TCCTCAGCCTCCCTACTGGCTGG + Intronic
956392584 3:68789114-68789136 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
956816984 3:72916652-72916674 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
956853036 3:73248830-73248852 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
957926775 3:86824192-86824214 GCCTCAGCCTCGCTAGTAGCTGG - Intergenic
958195643 3:90239051-90239073 TCCTCAGCCCCCCGAGTAGCTGG - Intergenic
958436011 3:94096611-94096633 GCCTCAGCCCCCCAAGTGGCTGG + Intronic
959244518 3:103847553-103847575 TACTCAGCCTCCCTAGTAGCTGG + Intergenic
959910746 3:111761068-111761090 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
960144683 3:114188324-114188346 GCCTCAGCCCCTCAAGTGGCTGG + Intronic
960262144 3:115580169-115580191 ACCTCAGCCCCGCAAGTAGCTGG - Intergenic
960951139 3:122999339-122999361 TACTCAGCCTCCCAAGTAGCTGG + Intronic
961320655 3:126071883-126071905 TTCTCAGCCCCCCAAGTAGCTGG + Intronic
962780440 3:138710072-138710094 TCCTCAGCCCCCCAAGTAGCTGG - Intronic
963149133 3:142025847-142025869 TCCTCAGCCCCCCAAGTAGCTGG - Intronic
963153456 3:142071269-142071291 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
963175968 3:142298087-142298109 ACCTCAGCCTCCCTAGTGGCTGG - Intergenic
963880611 3:150524397-150524419 GACTCAGCCCCCCGAGTAGCTGG + Intergenic
964373831 3:156030029-156030051 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
966776953 3:183551004-183551026 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
966797463 3:183729155-183729177 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
967128599 3:186449693-186449715 AACTCAGCCTCCCTAGTAGCTGG + Intergenic
968012489 3:195293724-195293746 TACTCAGCCTCCCAAGTAGCTGG - Intronic
968049067 3:195641825-195641847 TCCTCAGCCTCCCCAGTGGCTGG - Intergenic
968098332 3:195947805-195947827 TCCTCAGCCTCCCCAGTGGCTGG + Intergenic
968106860 3:196007397-196007419 TCCTCAGCCTCCCCAGTGGCTGG + Intergenic
968244359 3:197127306-197127328 GCCTCAGCCCCCCTAGTAGCAGG - Intronic
968305551 3:197648109-197648131 TCCTCAGCCTCCCCAGTGGCTGG + Intergenic
968748638 4:2374496-2374518 ACCTCAGCCTCCCTAGTGGCTGG - Intronic
968783805 4:2603397-2603419 TCCTCAGCCGCCCTAGTAGCTGG + Intronic
969919230 4:10522141-10522163 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
971278715 4:25223053-25223075 GCCTCAGCCTCGCTAGTAGCTGG - Intronic
972500098 4:39669969-39669991 GCCTCAGCCCCTCTAGTAGCTGG + Intergenic
972620649 4:40745257-40745279 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
972924631 4:43987855-43987877 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
973270405 4:48256476-48256498 TCCTCAGCCTCTCTAGTGGCTGG - Intronic
973313386 4:48733158-48733180 TCCTCAGCCTCCCGAGTGGCTGG - Intronic
973701344 4:53540266-53540288 TCCTAAGCCCCCCGAGTGGCTGG - Intronic
973741004 4:53919412-53919434 TCCTCAGCCTCCCAAGTGGCTGG - Intronic
973789159 4:54362788-54362810 ACCTCAGCCCCGCTAGTAGCTGG + Intergenic
974434513 4:61839833-61839855 ACCTCAGCCCCACGAGTGGCTGG - Intronic
974732781 4:65890823-65890845 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
974924792 4:68283527-68283549 TTCTCAGCCGCCCCAGTGGCTGG - Intergenic
975414928 4:74095143-74095165 GCCTCAGCCTCGCTAGTAGCTGG + Intergenic
975484408 4:74918394-74918416 TTCTCAGCCTCTCAAGTGGCAGG - Intergenic
975590341 4:75993664-75993686 AACTCAGCCTCCCTAGTAGCTGG + Intergenic
975606318 4:76158038-76158060 ACCTCAGCCTCCCTAGTGGCTGG - Intergenic
976047937 4:80974814-80974836 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
976244347 4:82992667-82992689 GCCTCAGCCCCGCAAGTAGCTGG + Intronic
976291969 4:83428444-83428466 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
976422725 4:84865002-84865024 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
976535995 4:86218293-86218315 TCCTCAGCCTCCCGAGTGGCTGG + Intronic
976613621 4:87054191-87054213 AACTCAGCCCCCCTAGGGGAGGG - Intronic
977554429 4:98474460-98474482 TCCTCAGCCCCCCAAGTAGCTGG + Intronic
978177762 4:105755131-105755153 TGCTCAGCCTCCCTAGTAGCAGG - Intronic
978369658 4:108017667-108017689 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
978521366 4:109619188-109619210 TCCTCAGCCTCCCGAGTGGCTGG + Intronic
978790574 4:112659619-112659641 ACCTCAGCCTCCCTAGTGGCTGG - Intergenic
978812700 4:112869390-112869412 ACCTCAGCCCCGCAAGTTGCTGG + Intronic
979060478 4:116053380-116053402 TGCTCAGCCTCCCTAGTAGCTGG + Intergenic
979245679 4:118501425-118501447 GTCTCAGCCTCGCTAGTAGCTGG + Intergenic
979583255 4:122385385-122385407 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
979623137 4:122818113-122818135 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
979661042 4:123255400-123255422 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
979680276 4:123451775-123451797 ACCTCAGCCCCACTAGTAGCTGG - Intergenic
979923287 4:126527381-126527403 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
980112893 4:128651390-128651412 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
980653105 4:135746669-135746691 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
980789496 4:137601493-137601515 ACCTCAGCCCCCCAAGTGGCTGG - Intergenic
980892025 4:138825864-138825886 CACTCAGCCTCTCTAGTAGCTGG + Intergenic
980902893 4:138921831-138921853 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
981258981 4:142696746-142696768 TACTGAGCCTCTCTACTGGCTGG - Intronic
981718674 4:147777371-147777393 GACTCAGCCTCCCTAGTAGCTGG + Intronic
981975015 4:150716330-150716352 GCCTCAGCCTCACTAGTGGCTGG - Intronic
981975326 4:150721727-150721749 TACTCAGCCTCCCGAGTAGCTGG + Intronic
982028782 4:151278380-151278402 CACTCAGCCTCCCTAGTAGCTGG + Intronic
982106549 4:152016439-152016461 TATTCAGCTCCGAAAGTGGCGGG - Intergenic
982449083 4:155531013-155531035 TACTCAGCCCCGGTGTTGGTGGG - Intergenic
982561629 4:156935110-156935132 TCCTCAGCCTCCCGAGTGGCTGG + Intronic
982768618 4:159375737-159375759 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
983995895 4:174181265-174181287 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
984007486 4:174330372-174330394 GCCTCAGCCCCACTAGTAGCTGG - Intronic
984137993 4:175965726-175965748 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
984569983 4:181380532-181380554 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
984935909 4:184889225-184889247 CACTCAGCCTCCCAAGTGGCTGG + Intergenic
984971404 4:185194372-185194394 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
985505606 5:278596-278618 TCCTCAGCCTCCCCAGTGGCTGG - Intronic
985700040 5:1365613-1365635 GCCTCAGCCTCGCTAGTAGCTGG - Intergenic
985742575 5:1627252-1627274 TCCTCAGCCTCCCCAGTGGCTGG + Intergenic
986117917 5:4798547-4798569 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
986463066 5:7993105-7993127 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
986668262 5:10121581-10121603 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
987267248 5:16269313-16269335 GCCTCAGCCCCGCAAGTAGCTGG + Intergenic
987324793 5:16802988-16803010 ACCTCAGCCTCCCTAGTGGCTGG - Intronic
987473151 5:18357125-18357147 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
987647229 5:20689648-20689670 GCCTCAGCCCTGCTAGTGGCTGG - Intergenic
987674157 5:21052439-21052461 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
987702135 5:21414310-21414332 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
988684276 5:33512838-33512860 TCCTCAGCCTCCCAAGTGGCTGG + Intergenic
988749128 5:34177076-34177098 TCCTCAGCCCCCCAAGTAGCTGG - Intergenic
988947371 5:36219323-36219345 AACTCAGCCCCGCAAGTAGCTGG + Intronic
989373305 5:40732721-40732743 GCCTCAGCCCCCCGAGTGGCTGG + Intronic
989380427 5:40804623-40804645 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
989625924 5:43429469-43429491 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
989647529 5:43651461-43651483 GCCTCAGCCCCCCGAGTGGCTGG - Intronic
989806282 5:45611163-45611185 GACTCAGCCCCCCAAGTAGCTGG + Intronic
990384874 5:55250787-55250809 ACCTCAGCCCCCCAAGTGGCTGG + Intergenic
990444447 5:55881185-55881207 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
990822730 5:59860971-59860993 GACTCAGCCTCCCAAGTGGCTGG + Intronic
991060402 5:62368660-62368682 ACCTCAGCCCCCCAAGTGGCTGG - Intronic
991088041 5:62666425-62666447 TCCTCAGCCCCCCAAGTGGCTGG + Intergenic
991483853 5:67113197-67113219 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
991712634 5:69423010-69423032 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
991729604 5:69571782-69571804 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
991776825 5:70093492-70093514 GTCTCAGCCGCCCTAGTGGCTGG + Intergenic
991806038 5:70426922-70426944 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
991856112 5:70968937-70968959 GTCTCAGCCGCCCTAGTGGCTGG + Exonic
991865349 5:71056098-71056120 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
991870126 5:71101710-71101732 GTCTCAGCCGCCCTAGTGGCTGG + Intergenic
992283136 5:75203059-75203081 AACTCAGCCTCCCTAGTAGCTGG + Intronic
992776523 5:80093899-80093921 GACTCAACCCCTCTTGTGGCAGG + Intergenic
993041194 5:82816609-82816631 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
993740423 5:91531690-91531712 TCCTCAGCCCCCCGAGTAGCTGG - Intergenic
994401658 5:99288032-99288054 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
994779517 5:104071387-104071409 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
994790732 5:104223306-104223328 GACTCAGCCTCCCAAGTGGCTGG + Intergenic
995213679 5:109570433-109570455 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
995475626 5:112545285-112545307 TCCTCAGCCTCCCAAGTGGCTGG + Intergenic
996061868 5:119041265-119041287 TGCTCAGCCTCCCTAGTAGCTGG - Intronic
996741271 5:126801096-126801118 GCCTCAGCCCCTCTAGTAGCTGG + Intronic
996886965 5:128368783-128368805 ACCTCAGCCCCCCTAGTAGCTGG + Intronic
997034911 5:130178365-130178387 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
997128913 5:131257100-131257122 TACCCAGCCCAGCTAGTGGTGGG + Intronic
997511945 5:134460164-134460186 GCCTCAGCCCCACTAGTAGCTGG - Intergenic
997558690 5:134824471-134824493 TACTCAGCCTCTCGAGTAGCTGG - Intronic
998052604 5:139048488-139048510 AACTCAGCCCCACGAGTAGCTGG + Intronic
998439971 5:142150609-142150631 GCCTCAGCCCCGCAAGTGACTGG - Intronic
998656163 5:144181977-144181999 TACTCAGCCTCCCAAGTAGCTGG - Intronic
999154232 5:149446853-149446875 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
999187848 5:149726213-149726235 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
999825835 5:155273052-155273074 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
1000062484 5:157669629-157669651 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1000135944 5:158351042-158351064 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1000298220 5:159931277-159931299 CACTCAGCCTCCCTAGTAGCTGG - Intronic
1000623834 5:163516158-163516180 TACTCAGCCTCCCAAGTAGCTGG + Intronic
1000783406 5:165512882-165512904 ACCTCAGCCCCCCTAGTAGCTGG - Intergenic
1001410939 5:171511160-171511182 ATCTCAGCCCCTCTAGTAGCTGG + Intergenic
1002033960 5:176451254-176451276 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1002486452 5:179541087-179541109 GCCTCAGCCCCTCTAGTAGCTGG + Intergenic
1002627039 5:180536723-180536745 TCCTCAGCCCCTCAAGTAGCTGG + Intronic
1002721561 5:181264431-181264453 TCCTCAGCCTCGCAAGTAGCTGG - Intergenic
1002952827 6:1832274-1832296 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1003085785 6:3060132-3060154 TACTCAGCCTCCCAAGTAGCTGG - Intergenic
1003184237 6:3816746-3816768 TCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1003246091 6:4383464-4383486 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1003557676 6:7155423-7155445 CACTCAGCCTCCCGAGTGGCTGG + Intronic
1003576676 6:7303019-7303041 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1003597651 6:7488348-7488370 TCCTCAGCCTCCCAAGTGGCTGG - Intergenic
1003602824 6:7533559-7533581 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1003907337 6:10714072-10714094 GGCTCAGCCCCCCTAGTAGCTGG - Intergenic
1004182471 6:13392945-13392967 GCCTCAGCCCCCCAAGTGGCTGG - Intronic
1004379222 6:15117803-15117825 ACCTCAGCCTCCCTAGTGGCTGG - Intergenic
1004384775 6:15163168-15163190 TACTCAGCCTCCCAAGTAGCTGG - Intergenic
1004450532 6:15741157-15741179 ACCTCAGCCTCCCTAGTGGCTGG - Intergenic
1004478113 6:15993213-15993235 GCCTCAGCCCCTCAAGTGGCTGG + Intergenic
1004688374 6:17970035-17970057 GCCTCAGCCCCGCAAGTAGCTGG + Intronic
1004786786 6:18976696-18976718 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1005322413 6:24668021-24668043 CACTCAGCCTCCCGAGTGGCTGG + Intronic
1005516694 6:26561603-26561625 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
1005720340 6:28595230-28595252 AACTCAGCCTCCTTAGTGGCTGG - Intronic
1005985548 6:30872278-30872300 GCCTCAGCCCCCCAAGTGGCTGG + Intergenic
1006031841 6:31181752-31181774 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1006095666 6:31655054-31655076 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1006100954 6:31686057-31686079 GCCTCAGCCCCTCTAGTAGCTGG - Intergenic
1006265554 6:32919202-32919224 TACTCAGCCTCCCGAGTAGCTGG + Intergenic
1006309409 6:33247520-33247542 GACTCAGCCACCCTAGTAGCTGG + Intergenic
1006347731 6:33497060-33497082 AACTCAGCCTCCCTAGTAGCTGG + Intergenic
1006482360 6:34307157-34307179 TACCCAGCCTCCCAAGTGGCTGG - Intronic
1006546065 6:34782570-34782592 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1006656998 6:35604120-35604142 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1006660242 6:35635355-35635377 AACTCAGCCCCGCAAATAGCTGG - Intronic
1006781541 6:36635872-36635894 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1006958619 6:37902350-37902372 TCCTCAGCCCCCCGAGTGCCTGG - Intronic
1007440560 6:41855931-41855953 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1007489709 6:42209631-42209653 GTCTCAGCCTCGCTAGTAGCTGG - Intronic
1007538251 6:42615563-42615585 TTCTCAGCCTCCCTAGTAGCTGG + Intronic
1007569049 6:42875896-42875918 GACTCAGCCCCCCAAGTAGCTGG - Intergenic
1007653770 6:43439515-43439537 ACCTCAGCCCCTCAAGTGGCTGG + Intronic
1007755807 6:44098685-44098707 TGCTCAGCCTCCCAAGTGGCTGG + Intergenic
1008118295 6:47579218-47579240 AACTCAGCCTCCCAAGTGGCTGG - Intronic
1008282059 6:49608490-49608512 GACTCAGCCTCGCAAGTAGCTGG + Intronic
1008690911 6:53977481-53977503 GCCTCAGCCCCGCTACTAGCTGG - Intronic
1009004460 6:57765459-57765481 GACTCAGCCCCTCGAGTAGCTGG - Intergenic
1009463656 6:63944817-63944839 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1009498684 6:64383184-64383206 ACCTCAGCCCCCCTAGTAGCTGG - Intronic
1010186249 6:73146508-73146530 TTCTCAGCCTCCCAAGTGGCTGG - Intronic
1010188429 6:73168586-73168608 GCCTCAGCCCCGCAAGTAGCTGG - Intronic
1010237063 6:73583844-73583866 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1010265505 6:73861474-73861496 ACCTCAGCCCCCCTAGTAGCTGG + Intergenic
1010415783 6:75609900-75609922 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1010736048 6:79444520-79444542 GCCTCAGCCCCTCTAGTAGCTGG - Intergenic
1010852061 6:80789549-80789571 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1010913644 6:81589028-81589050 TCCTCAGCCTCCCGAGTGGCTGG - Intronic
1011362889 6:86547549-86547571 ACCTCAGCCCCCCAAGTGGCTGG - Intergenic
1011603088 6:89078226-89078248 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1011644528 6:89445383-89445405 GCCTCAGCCCCACTAGTAGCTGG + Intronic
1011752022 6:90463139-90463161 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
1011854708 6:91675371-91675393 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1012011311 6:93789282-93789304 TCCTCAGCCCCCCGAGTAGCTGG - Intergenic
1012108248 6:95193430-95193452 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
1012130598 6:95486957-95486979 TCCTCAGCCTCCCGAGTGGCTGG + Intergenic
1013019507 6:106198660-106198682 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1013184473 6:107745876-107745898 ACCTCAGCCCCACAAGTGGCTGG - Intronic
1013245462 6:108283196-108283218 GCCTCAGCCTCCCTAGTGGCAGG + Intergenic
1013279458 6:108622142-108622164 GCCTCAGCCTCGCAAGTGGCTGG - Intronic
1013359922 6:109384139-109384161 GCCTCAGCCCTGCTAGTAGCTGG - Intergenic
1013365675 6:109435808-109435830 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1014007015 6:116430654-116430676 TCCTCAGCCCCCCAAGTAGCTGG + Intronic
1014616840 6:123612497-123612519 TACTCAGCCTCCCGAGTAGCTGG - Intronic
1015114906 6:129637177-129637199 GCCTCAGCCCCGCAAGTAGCTGG + Intronic
1015398355 6:132760287-132760309 ACCTCAGCCTCGCTAGTAGCTGG + Intronic
1015767320 6:136732308-136732330 GCCTCAGCCTCCCTAGTGGCTGG - Intronic
1015919090 6:138248709-138248731 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1015934480 6:138394908-138394930 ACCTCAGCCCCACTAGTAGCTGG + Intergenic
1016068715 6:139711507-139711529 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1016222389 6:141691249-141691271 TCCTCAGCCTCCCAAGTGGCTGG + Intergenic
1017116829 6:150985544-150985566 TCCTCAGCCCCCCAAGTAGCTGG - Intronic
1017186498 6:151606014-151606036 TACTCAGCCACCCAAGTAGCTGG + Intronic
1017238228 6:152139454-152139476 GCCTCAGCCCCACTAGTAGCTGG - Intronic
1017658818 6:156654521-156654543 TGCTCAGCCCCACTTGTGCCTGG + Intergenic
1018263341 6:161992223-161992245 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1018303834 6:162432409-162432431 GCCTCAGCCCTGCTAGTAGCTGG - Intronic
1018437110 6:163771866-163771888 GCCTCAGCCTCGCTAGTAGCTGG + Intergenic
1019383839 7:742150-742172 CACTCAGCCCCGCGAGAGGAGGG - Intronic
1019464323 7:1178617-1178639 TCCTCAGCCTCCCCAGTGGCTGG - Intergenic
1019502642 7:1372444-1372466 GCCTCAGCCCCGCAAGTAGCTGG + Intergenic
1019571072 7:1712544-1712566 TCCTCAGCCTCCCAAGTGGCTGG + Intronic
1019808698 7:3148494-3148516 TCCTCAGCCTCCCAAGTGGCTGG + Intronic
1019895889 7:3982723-3982745 GACTCAGCCCCCCGAGTAGCTGG - Intronic
1020100227 7:5390248-5390270 GACTCAGCCCCCCAAGTAGCTGG - Intronic
1020185279 7:5954251-5954273 TCCTCAGCCTCCCGAGTGGCTGG + Intronic
1020230597 7:6315380-6315402 ACCTCAGCCTCGCTAGTAGCTGG + Intergenic
1020252247 7:6478901-6478923 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1020297634 7:6770494-6770516 TCCTCAGCCTCCCGAGTGGCTGG - Intronic
1020327713 7:6987969-6987991 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1020855689 7:13419775-13419797 TCCTCAGCCTCCCAAGTGGCTGG + Intergenic
1021497379 7:21290974-21290996 TGCTCAGCCTCCCTAGTAGCTGG + Intergenic
1021824971 7:24540993-24541015 AACTCAGCCCCCTAAGTGGCTGG + Intergenic
1022116482 7:27265435-27265457 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1022444076 7:30455714-30455736 TCCTCAGCCTCCCAAGTGGCTGG + Intronic
1022726658 7:32987378-32987400 ACCTCAGCCCCTCAAGTGGCTGG - Intronic
1022803872 7:33802406-33802428 GCCTCAGCCCCACTAGTAGCTGG + Intergenic
1023431836 7:40101438-40101460 TTCTCAGCCTCCCAAGTGGCTGG + Intergenic
1023439961 7:40175332-40175354 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1023841104 7:44098022-44098044 TACTCAGCCTCCCCAGTAGCTGG + Intergenic
1024067740 7:45755731-45755753 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1024479793 7:49851741-49851763 TACTCAGCCTCCCAAGTAGCTGG - Intronic
1024645278 7:51365938-51365960 TCCTCAGCCTCGCAAGTAGCTGG + Intergenic
1024726582 7:52203906-52203928 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1024786454 7:52912491-52912513 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1025046927 7:55700255-55700277 ACCTCAGCCCCTCAAGTGGCTGG + Intergenic
1025617655 7:63136734-63136756 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1025619863 7:63158732-63158754 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1025795387 7:64734897-64734919 TTCTCAGCCCCCCAAGTAGCTGG - Intergenic
1025822820 7:64985843-64985865 TACTCAGCCTCCCGAGTAGCTGG - Intronic
1025851234 7:65245889-65245911 GCCTCAGCCCCTCTAGTAGCTGG - Intergenic
1025998273 7:66542233-66542255 CACTCAGCCTCTCTAGTAGCTGG - Intergenic
1026687049 7:72520142-72520164 TACTAAACCCCGTTAGTAGCTGG + Intergenic
1026961779 7:74412958-74412980 GCCTCAGCCTCGCTAGTAGCAGG - Intergenic
1027212275 7:76159765-76159787 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
1027449306 7:78311883-78311905 GACTCAGCCTCCCTAGTAGCTGG + Intronic
1027587373 7:80075250-80075272 ACCTCAGCCCCTCTAGTAGCTGG - Intergenic
1027913835 7:84288581-84288603 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1028719678 7:94014550-94014572 GTCTCAGCCCCGCCAGTAGCTGG + Intergenic
1028778190 7:94704687-94704709 GCCTCAGCCTCCCTAGTGGCCGG - Intergenic
1028965512 7:96797339-96797361 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1029089001 7:98033477-98033499 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1029120979 7:98268089-98268111 GACTCAGCCTCCCGAGTGGCTGG - Intronic
1029231279 7:99071172-99071194 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1029395504 7:100305569-100305591 GCCTCAGCCCCGCAAGTAGCTGG + Intergenic
1029431255 7:100532204-100532226 TCCTCAGCCCCCCAAGTAGCTGG - Intergenic
1029444871 7:100606212-100606234 GCCTCAGCCCCGCAAGTTGCTGG - Intronic
1029471302 7:100756002-100756024 GCCTCAGCCCCGCAAGTAGCTGG + Intronic
1029560893 7:101302469-101302491 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1029572999 7:101383647-101383669 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1030040337 7:105444058-105444080 GCCTCAGCCCCGCTAGTAGCTGG + Intronic
1030253858 7:107484163-107484185 TGCTCAGCCTCTCGAGTGGCTGG + Intronic
1030577642 7:111310118-111310140 GCCTCAGCCCCGCGAGTAGCTGG - Intronic
1031010007 7:116516137-116516159 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1031022330 7:116641562-116641584 TTCTCAGCCTCCCTAGTAGCTGG - Intergenic
1031531281 7:122879419-122879441 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1031959076 7:127972692-127972714 ACCTCAGCCTCCCTAGTGGCTGG + Intronic
1032109352 7:129062323-129062345 GCCTCAGCCCCTCAAGTGGCGGG + Intergenic
1032398400 7:131607114-131607136 ACCTCAGCCTCGCTAGTGGCTGG + Intergenic
1032717218 7:134519690-134519712 ATCTCAGCCTCCCTAGTGGCTGG - Intergenic
1032898477 7:136279540-136279562 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1032973408 7:137192432-137192454 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1033020556 7:137720370-137720392 GCCTCAGCCCCCCGAGTGGCTGG + Intronic
1033072121 7:138213020-138213042 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
1033183300 7:139201841-139201863 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1033198030 7:139343818-139343840 GCCTCAGCCCCGCAAGTAGCTGG - Intronic
1033240041 7:139670873-139670895 GCCTCAGCCACCCTAGTGGCGGG + Intronic
1034030600 7:147758728-147758750 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1034184210 7:149162134-149162156 GACTCAGCCTCCCGAGTGGCTGG + Intronic
1034866786 7:154648802-154648824 GCCTCAGCCTCCCTAGTGGCCGG - Intronic
1035358302 7:158292951-158292973 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1035420861 7:158728417-158728439 TGCTCAGCCTCCCGAGTGGCTGG + Intergenic
1035890264 8:3335560-3335582 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1036581601 8:10080638-10080660 AACTCAGCCTCCTTAGTGGCTGG + Intronic
1037828293 8:22173197-22173219 TCCTCAGCCTCTCCAGTGGCTGG - Intronic
1037966851 8:23141388-23141410 TCCTCAGCCCCCCTAGTTGCTGG - Intronic
1038062865 8:23931472-23931494 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1038294142 8:26275366-26275388 TCCTCAGCCTCCCAAGTGGCTGG - Intergenic
1038630925 8:29243230-29243252 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1038969991 8:32622515-32622537 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1040717431 8:50274199-50274221 ACCTCAGCCCCCCTAGTAGCTGG + Intronic
1040720951 8:50322999-50323021 GCCTCAGCCCCCCGAGTGGCTGG - Intronic
1040905505 8:52465609-52465631 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1040927200 8:52696886-52696908 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1041249963 8:55924475-55924497 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1041298244 8:56384088-56384110 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1042068508 8:64904761-64904783 TCCTCAGCCCCTCGAGTAGCTGG + Intergenic
1042376533 8:68058546-68058568 GTCTCAGCCTCCCTAGTGGCTGG + Intronic
1042538995 8:69888504-69888526 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1042557252 8:70043869-70043891 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1042566347 8:70116070-70116092 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1042921453 8:73924014-73924036 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1042976219 8:74472860-74472882 TCCTCAGCCTCCCAAGTGGCTGG + Intronic
1043538433 8:81232084-81232106 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1043760313 8:84060572-84060594 TACTTAGCCTCCCTAGTAGCTGG + Intergenic
1043846906 8:85174108-85174130 ACCTCAGCCTCTCTAGTGGCTGG + Intergenic
1043858452 8:85288445-85288467 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1044346200 8:91107247-91107269 TCCTCAGCCTCCCGAGTGGCTGG + Intronic
1044586431 8:93873106-93873128 GACTCAGCCTCCCTAGTAGCTGG - Intronic
1044684746 8:94816052-94816074 TACTCAGCCTCCCAAGTAGCTGG + Intronic
1044831462 8:96253891-96253913 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1044951102 8:97436259-97436281 GACTCAGCCTCCCAAGTGGCTGG + Intergenic
1044974407 8:97649716-97649738 ACCTCAGCCCCTCGAGTGGCTGG + Intronic
1045086587 8:98693281-98693303 GCCTCAGCCCCGCAAGTAGCTGG - Intronic
1045321377 8:101084418-101084440 CACTCAGCCTCCCTAGTAGCTGG + Intergenic
1045747915 8:105445717-105445739 ACCTCAGCCCCGCAAGTAGCTGG + Intronic
1045917723 8:107492448-107492470 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1046179188 8:110620736-110620758 GCCTCAGCCTCGCTAGTAGCTGG - Intergenic
1046645625 8:116782614-116782636 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1047092301 8:121587753-121587775 GCCTCAGCCCCGCAAGTAGCTGG + Intergenic
1047189629 8:122666353-122666375 GCCTCAGCCCCGCAAGTAGCTGG + Intergenic
1047226610 8:122960421-122960443 GCCTCAGCCCCACAAGTGGCAGG - Intronic
1047331457 8:123892404-123892426 GTCTCAGCCCCGCAAGTAGCTGG + Intronic
1047994219 8:130318194-130318216 ACCTCAGCCCCCCAAGTGGCTGG + Intronic
1048328887 8:133458998-133459020 TCCTCAGCCTCCCTAGTAGCTGG + Exonic
1048623895 8:136163750-136163772 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1048721966 8:137335748-137335770 GCCTCAGCCCCGCAAGTAGCAGG + Intergenic
1048761905 8:137804632-137804654 GACTCAGCCTCCCAAGTGGCTGG + Intergenic
1048884257 8:138896856-138896878 GCCTCAGCCCCGCAAGTAGCTGG - Intronic
1049162997 8:141109598-141109620 ACCTCAGCCCCCCAAGTGGCAGG - Intergenic
1049179431 8:141214091-141214113 TACTCAGCCTCCCGAGTAGCTGG - Intronic
1049462136 8:142735127-142735149 GACACAGCCCCGCTTGTGCCTGG - Intronic
1049908978 9:246863-246885 TTCTCAGCCTCCCTAGTAGCTGG + Intronic
1049939057 9:527414-527436 TCCTCAGCCCCTCAAGTAGCTGG + Intronic
1050382797 9:5048254-5048276 GACTCAGCCTCCCTAGTAGCTGG + Intronic
1050401984 9:5266122-5266144 CACTCAGGCCCCCTAGAGGCAGG + Intergenic
1050536396 9:6634412-6634434 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1050557497 9:6801988-6802010 ATCTCAGCCTCCCTAGTGGCTGG - Intronic
1050874626 9:10618344-10618366 TCCTCAGCCTCTCAAGTGGCTGG - Intergenic
1051224529 9:14885037-14885059 GCCTCAGCCCCCCGAGTGGCTGG + Intronic
1051240183 9:15046827-15046849 TACTCAGCCTCCCAAGTAGCTGG - Intergenic
1051302299 9:15664811-15664833 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1051399143 9:16660337-16660359 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1051752614 9:20359028-20359050 GCCTCAGCCCCGCGAGTAGCTGG - Intronic
1052458852 9:28736675-28736697 GCCTCAGCCCCGCAAGTAGCTGG - Intergenic
1052800623 9:32964125-32964147 GCCTCAGCCCCGCGAGTAGCTGG - Intergenic
1052906941 9:33843591-33843613 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1053131991 9:35620713-35620735 TTCTCAGCCTCCCTAGTAGCTGG - Intronic
1053252469 9:36586226-36586248 ACCTCAGCCCCGCAAGTAGCTGG - Intronic
1053449993 9:38185411-38185433 TACTCAGCCTCCCAAGTAGCTGG - Intergenic
1053505285 9:38637886-38637908 TCCTCAGCCCCCCAAGTAGCTGG + Intergenic
1055053299 9:72000841-72000863 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1055482186 9:76719759-76719781 CACTCAGCCTCCCTAGTAGCCGG + Intronic
1055583499 9:77732478-77732500 GCCTCAGCCTCCCTAGTGGCTGG + Intronic
1055656001 9:78451079-78451101 GCCTCAGCCTCGCTAGTAGCTGG - Intergenic
1055941947 9:81659021-81659043 TCCTCAGCCTCGCGAGTAGCTGG + Intronic
1056066326 9:82939358-82939380 TCCTCAGCCCCCCAAGTAGCTGG + Intergenic
1056169121 9:83965777-83965799 TAAAGAGCCCAGCTAGTGGCTGG - Intergenic
1056842765 9:90011891-90011913 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1056890897 9:90491047-90491069 GACTCAGCCTCCCAAGTGGCTGG - Intergenic
1057096677 9:92317065-92317087 AACTCAGCCTCCCCAGTGGCAGG + Intronic
1057255853 9:93546489-93546511 TACTCTGCCCCTCCTGTGGCTGG + Intronic
1057449964 9:95149591-95149613 GACTCAGCCCCCCTAGTAGCTGG + Intronic
1057502725 9:95608517-95608539 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1058151022 9:101463854-101463876 GCCTCAGCCTCCCTAGTGGCTGG + Intergenic
1058954185 9:109930338-109930360 GCCTCAGCCCCTCTAGTAGCTGG + Intronic
1059183790 9:112246095-112246117 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1059203918 9:112445637-112445659 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1059279834 9:113123168-113123190 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1059289625 9:113211271-113211293 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1060145067 9:121245469-121245491 GCCTCAGCCCCTCTAGTAGCTGG + Intronic
1060231546 9:121829065-121829087 GACTCAGCCTCCCTAGTAGCTGG + Intronic
1060257168 9:122042127-122042149 GCCTCAGCCCCCCGAGTGGCTGG + Intronic
1060499404 9:124141700-124141722 TACTCAGCCTCCCAAGTAGCCGG + Intergenic
1060838055 9:126772666-126772688 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1060850597 9:126872059-126872081 TACTCAGCCTCCCGAGTAGCTGG + Intronic
1060863362 9:126974734-126974756 CGCTCAGCCCCACTACTGGCCGG + Intronic
1061093100 9:128438265-128438287 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1061114541 9:128601096-128601118 TCCTCAGCTCCCCTAGTAGCTGG + Intronic
1061138295 9:128749211-128749233 GCCTCAGCCCCCCTAGTGGCTGG - Intronic
1061784900 9:133021771-133021793 GACTCAGCCTCCCTAGTAGCTGG - Intergenic
1061928344 9:133818857-133818879 TACTCAGCCTCCCGAGTAGCTGG + Intronic
1062063968 9:134515991-134516013 GCCTCAGCCCCCCGAGTGGCTGG - Intergenic
1062223385 9:135433273-135433295 TCCTCAGCCTCCCTAGTAGCTGG - Intergenic
1062735075 9:138132310-138132332 ATCTCAGCCTCCCTAGTGGCTGG + Intergenic
1203531472 Un_GL000213v1:146809-146831 GCCTCAGCCCCACTAGTAGCTGG + Intergenic
1203572439 Un_KI270744v1:143780-143802 GACTCAGCCTCCCTAGTAGCTGG + Intergenic
1185617379 X:1430655-1430677 ACCTCAGCCCCACTAGTGGCTGG - Intronic
1185862611 X:3593060-3593082 TACTCAGCCTCCCAAGTAGCTGG - Intergenic
1185890789 X:3820035-3820057 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1186562628 X:10629310-10629332 GCCTCAGCCACTCTAGTGGCTGG + Intronic
1188331143 X:28873223-28873245 TACTCAGCCTCCCAAGTAGCTGG + Intronic
1188476108 X:30593967-30593989 GCCTCAGCCCCACTAGTAGCTGG + Intergenic
1189278772 X:39806248-39806270 TCCTCAGCCCCCCAAGTAGCTGG - Intergenic
1189395542 X:40619335-40619357 GCCTCAGCCTCGCTAGTAGCTGG - Intergenic
1189471874 X:41321224-41321246 TCCTCAGCCTCTCTAGTAGCTGG + Intergenic
1189472016 X:41321958-41321980 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1189778934 X:44495455-44495477 ACCTCAGCCCCCCTAGTAGCTGG + Intergenic
1190082779 X:47369931-47369953 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1190270972 X:48863382-48863404 TCCTCAGCCCCGCAAGTAACTGG + Intergenic
1190309081 X:49103676-49103698 TCCTCAGCCCCTCAAGTAGCTGG - Intergenic
1190796226 X:53745855-53745877 TCCTCAGCCTCCCGAGTGGCTGG + Intergenic
1190868621 X:54406051-54406073 GCCTCAGCCCCGCTAGTAGCTGG - Intergenic
1191946646 X:66541448-66541470 GCCTCAGCCCCCCTAGTAGCTGG + Intergenic
1192413366 X:70954457-70954479 GCCTCAGCCCCGCTAGTAGCTGG - Intergenic
1192500965 X:71651923-71651945 ACCTCAGCCCCACAAGTGGCTGG + Intergenic
1192527346 X:71859019-71859041 CCTTCAGCCCCGCAAGTGGCTGG + Intergenic
1192806923 X:74519290-74519312 GCCTCAGCCTCGCTAGTAGCTGG + Intronic
1193248869 X:79264424-79264446 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
1193798538 X:85907013-85907035 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1193824456 X:86205673-86205695 TCCTCAGCCTCCCTAGTAGCTGG + Intronic
1193918404 X:87396128-87396150 TCCTCAGCCTCCCAAGTGGCGGG - Intergenic
1194290799 X:92069794-92069816 GCCTCAGCCCCGCAAGTAGCTGG + Intronic
1194488061 X:94511170-94511192 GCCTCAGCCTCCCTAGTGGCTGG - Intergenic
1194872115 X:99145026-99145048 GCCTCAGCCCCCCTAGTAGCTGG - Intergenic
1195218708 X:102725639-102725661 GCCTCAGCCCCGCTAGTAGCTGG + Intronic
1195389259 X:104343991-104344013 CACTCAGCCTCCCTAGTGGCTGG - Intergenic
1195390498 X:104357142-104357164 TCCTCAGCCTCCCAAGTGGCTGG - Intergenic
1195637533 X:107134566-107134588 ACCTCAGCCTCCCTAGTGGCTGG + Intronic
1195797784 X:108670925-108670947 TTCTCAGCCTCCCTAGTAGCTGG - Intronic
1195912399 X:109901739-109901761 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1196060598 X:111403929-111403951 TCCTCAGCCTCCCTAGTAGCTGG - Intronic
1196089325 X:111723068-111723090 TCCTCAGCCTCTCTAGTGGCTGG + Intronic
1196177786 X:112659343-112659365 GACTCAGCCTCTCAAGTGGCTGG - Intronic
1196347908 X:114688204-114688226 GCCTCAGCCTCGCTAGTAGCTGG - Intronic
1196397425 X:115279873-115279895 TCCTCAGCCCCGCGTGTAGCTGG - Intergenic
1196440411 X:115714904-115714926 TACTCAGCCTCCCGAGTAGCTGG + Intergenic
1196818083 X:119680864-119680886 AACTCAGCCTCCCGAGTGGCTGG - Intronic
1196825093 X:119734658-119734680 TCCTCAGCCTCCCTAGTAGCTGG + Intergenic
1197214603 X:123856360-123856382 TACTCAGCCTCCCGAGTAGCTGG - Intergenic
1197743445 X:129913864-129913886 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1197844296 X:130784700-130784722 GCCTCAGCCCCCCTAGTAGCTGG + Intronic
1198460242 X:136856286-136856308 GACTCAGCCCCCTGAGTGGCTGG - Intronic
1198466129 X:136906279-136906301 TCCTCAGCCCCGTTAGTAGCTGG - Intergenic
1198554842 X:137782219-137782241 TACTCAGCCTCCCAAGTAGCTGG + Intergenic
1198719983 X:139606470-139606492 TCCTCAGCCTCCCTAGTGGCTGG + Intronic
1198749788 X:139927487-139927509 GCCTCAGCCCCCCTAGTAGCTGG - Intronic
1199977547 X:152903272-152903294 GCCTCAGCCTCCCTAGTGGCCGG - Intergenic
1200422352 Y:2985214-2985236 TACTCAGCCTCCCGAGTAGCTGG + Intergenic
1200608312 Y:5294369-5294391 GCCTCAGCCCCGCAAGTAGCTGG + Intronic
1200847546 Y:7847083-7847105 TACTCAGCCCCCTGAGTAGCTGG + Intergenic
1200926211 Y:8657325-8657347 TCCTCAGCCCCCCGAGTAGCTGG + Intergenic
1201288397 Y:12398708-12398730 GCCTCAGCCCCGCTAGTACCTGG - Intergenic