ID: 1126033892

View in Genome Browser
Species Human (GRCh38)
Location 15:44529587-44529609
Sequence AAACCAACCCCTTTTAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126033892_1126033894 -2 Left 1126033892 15:44529587-44529609 CCAGAATTAAAAGGGGTTGGTTT No data
Right 1126033894 15:44529608-44529630 TTTGAAAAGGAGAGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126033892 Original CRISPR AAACCAACCCCTTTTAATTC TGG (reversed) Intergenic
No off target data available for this crispr