ID: 1126035961

View in Genome Browser
Species Human (GRCh38)
Location 15:44545991-44546013
Sequence GGTTTTAAATATGCATCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126035960_1126035961 -8 Left 1126035960 15:44545976-44545998 CCTGTTTCTCAGAAGGGTTTTAA 0: 1
1: 0
2: 2
3: 16
4: 252
Right 1126035961 15:44545991-44546013 GGTTTTAAATATGCATCTTCTGG 0: 1
1: 0
2: 0
3: 20
4: 238
1126035957_1126035961 5 Left 1126035957 15:44545963-44545985 CCTTGTTACTACACCTGTTTCTC 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1126035961 15:44545991-44546013 GGTTTTAAATATGCATCTTCTGG 0: 1
1: 0
2: 0
3: 20
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126035961 Original CRISPR GGTTTTAAATATGCATCTTC TGG Intronic
900798697 1:4724745-4724767 GTTTTTTAAAATGCAACTTCTGG + Intronic
907129119 1:52079489-52079511 GGTCTAAAAGATGCAGCTTCAGG - Intronic
908073547 1:60490112-60490134 GGCTTTAAAAATGTACCTTCCGG + Intergenic
909314130 1:74194646-74194668 GCTGTTTAATATCCATCTTCTGG - Intronic
910043660 1:82886057-82886079 GGGTATAAATGTGCATCTACAGG - Intergenic
911483017 1:98468353-98468375 CATTTTAAATAAGCTTCTTCAGG - Intergenic
912309483 1:108605501-108605523 ACTTTTAAAAATGCATCTGCTGG - Intronic
913315462 1:117547415-117547437 TATTTTAAATATGCAACTTAAGG + Intergenic
913377873 1:118174500-118174522 GGATTTCCATATGCATCTACTGG - Intronic
914322092 1:146574930-146574952 GGTTTTAAAAATGGCACTTCAGG + Intergenic
916004419 1:160646534-160646556 GGTTTTACATGGGCATCTTCTGG - Intronic
916360825 1:163966134-163966156 CATTTTAATTATGCATCTTAAGG + Intergenic
917506359 1:175630635-175630657 TGTTTCAAATATACTTCTTCAGG + Intronic
918716579 1:187795984-187796006 GGTTTTAAATAAGCCTCTACAGG + Intergenic
919064221 1:192672817-192672839 GGTTTTCCATAAGCATCTTAGGG - Intergenic
920356902 1:205380491-205380513 ATTTTTAAATAAGCATTTTCAGG + Intergenic
921262346 1:213395239-213395261 GGTATTAAATATCCAGCTGCAGG + Intergenic
1063726342 10:8641655-8641677 TTTTAGAAATATGCATCTTCAGG + Intergenic
1064325739 10:14349553-14349575 GGTTTTAAATTTGGACCTTTGGG - Intronic
1064774041 10:18755651-18755673 TGTTTTAAATGTGCAATTTCTGG - Intergenic
1064799867 10:19057508-19057530 GGTTTTAAATATGAATTTGAGGG + Intronic
1066556104 10:36615449-36615471 TGTTTTAAATATGTTTTTTCAGG - Intergenic
1068217616 10:54003178-54003200 GTTTTTAAAGATGCATCATTAGG - Intronic
1068531202 10:58188564-58188586 GGTTTTGAATATGTTTCTTGGGG - Intergenic
1068961069 10:62867159-62867181 ACTTTTAAATATGCATCCTTGGG - Intronic
1071118328 10:82249627-82249649 AGTTGTAAATAAGCATTTTCTGG + Intronic
1071836135 10:89419249-89419271 AATTTTAAATATGTAACTTCAGG + Exonic
1074320909 10:112401318-112401340 TGTTTAAAATATATATCTTCTGG + Intronic
1079879683 11:25909895-25909917 GGTTTTATATATGCATATCCAGG + Intergenic
1079953662 11:26835874-26835896 GTTTTTAAATTTGTATTTTCAGG + Intergenic
1080036525 11:27718410-27718432 TGTTTTAAATACGGATCTGCAGG - Intronic
1082077181 11:47982942-47982964 GATTTTGAAGATGCTTCTTCTGG - Intronic
1085373366 11:76033608-76033630 GGTTTTAAAAATATATATTCTGG - Intronic
1085542492 11:77285344-77285366 GGTTGTAAATAGGCATATACAGG - Intronic
1088684702 11:112274897-112274919 CATTTTAAATAAGCATCTTGTGG - Intergenic
1090034946 11:123240975-123240997 GGTGTTAAATATGCATTTGTAGG + Intergenic
1090464293 11:126920283-126920305 GGATCTAAAGATGCATCTTATGG - Intronic
1090607684 11:128438795-128438817 TGTTTTAAAAATCCAGCTTCTGG - Intergenic
1091013854 11:132031455-132031477 GGTATGAAATAGTCATCTTCTGG + Intronic
1091067157 11:132525651-132525673 AGTTTAAAATTTGCATCTGCAGG - Intronic
1091317750 11:134626392-134626414 GGTTTTCCATATCCACCTTCAGG + Intergenic
1091899105 12:4129420-4129442 GGTTTTAAATAGTTATATTCAGG + Intergenic
1092186083 12:6479448-6479470 GGTTTTGAATATAGATATTCTGG - Intergenic
1092955371 12:13544467-13544489 AATTTTAAATATGTATCTTCAGG + Exonic
1093727179 12:22527616-22527638 GGTTTAAAATATGTATCTTTAGG - Intronic
1093890169 12:24510576-24510598 GCTTTTAACTATTCATCTTCTGG - Intergenic
1094696314 12:32822535-32822557 GGTTTTGAATATAGATATTCTGG + Exonic
1095423920 12:42054694-42054716 GGTTTGAATTTTGCATCTTTGGG - Intergenic
1097930865 12:65184373-65184395 GGTTTTAAATAGGCTTCTGTGGG - Intronic
1098077601 12:66749688-66749710 GAATTCACATATGCATCTTCCGG + Intronic
1099284303 12:80696913-80696935 TGATTTAAATATGCATCTTTTGG + Intergenic
1099924609 12:89002226-89002248 GGTCTTAAACATACATCATCTGG - Intergenic
1100572113 12:95852577-95852599 GGTTTTAAAACCACATCTTCAGG + Intergenic
1100724009 12:97389314-97389336 TGTTTTCAATATTTATCTTCAGG + Intergenic
1101152772 12:101898468-101898490 GGTTTTAAATACCAAACTTCTGG + Intronic
1102658667 12:114505510-114505532 GGTTTTCAATATGTATGTTTTGG - Intergenic
1103854963 12:123960953-123960975 CCTTTTAAATATGCATCTGGAGG + Intronic
1105712924 13:23030381-23030403 ATTTTTAAAAATGCATGTTCTGG - Intergenic
1106598207 13:31165090-31165112 GGTTTAAAAGATACATTTTCAGG - Intergenic
1108740807 13:53336222-53336244 AGTTTTACATATGCATCAACAGG - Intergenic
1109285188 13:60400440-60400462 GTTTTTGAAAATGTATCTTCTGG + Intronic
1109389448 13:61673621-61673643 TGTTTTAAAAATGCATCTACTGG + Intergenic
1109437923 13:62330750-62330772 GGTTATAAATATGCAGCATGAGG - Intergenic
1110154849 13:72304031-72304053 CATTTCAAATGTGCATCTTCCGG + Intergenic
1112276280 13:98023911-98023933 GGTATTAAAAATGCTTCTGCAGG - Exonic
1112721306 13:102249132-102249154 GCTCTTAAATCTTCATCTTCAGG - Intronic
1114215090 14:20651630-20651652 GGTTTAAGAAATGCATCATCAGG - Intergenic
1114393785 14:22338300-22338322 GGTTCTAAACATGAAGCTTCTGG - Intergenic
1114994125 14:28326407-28326429 GATTTTAATTATGGATCTCCTGG - Intergenic
1120743832 14:88136018-88136040 TGTTTTAAATATGCAGAGTCTGG - Intergenic
1121433846 14:93906006-93906028 GGTCTCAAAAATGCATCTGCAGG + Intergenic
1124391696 15:29264547-29264569 GATTTGAATTATGCATCTTTGGG - Intronic
1125350338 15:38760130-38760152 GGTTTTAAATACTCATTTCCTGG - Intergenic
1126035961 15:44545991-44546013 GGTTTTAAATATGCATCTTCTGG + Intronic
1128158565 15:65408079-65408101 AATTTTAAAAATGCATCTGCTGG + Intronic
1128589475 15:68882161-68882183 GATGGTAAATATACATCTTCAGG + Intronic
1128602851 15:69012288-69012310 GCTTTTAAAAATACATTTTCTGG + Intronic
1128770492 15:70278156-70278178 GATTTTAAATGTGCATTTCCAGG + Intergenic
1131742428 15:95408716-95408738 GATTTTAAATATACATCTTGAGG + Intergenic
1132176484 15:99719696-99719718 ATTTTTAAAGATGTATCTTCAGG + Intronic
1135224320 16:20642428-20642450 GGTTTTAAAGTTGCAACTACAGG - Intronic
1136924284 16:34357371-34357393 TGTATAGAATATGCATCTTCTGG + Intergenic
1136980289 16:35054435-35054457 TGTATAGAATATGCATCTTCTGG - Intergenic
1138770352 16:59655462-59655484 GGATTCAACTAGGCATCTTCTGG - Intergenic
1139978544 16:70834545-70834567 GGTTTTTAAAATGCAGATTCCGG + Intronic
1140011535 16:71136235-71136257 GGTTTTAAAAATGGCACTTCAGG - Intronic
1140527328 16:75633814-75633836 AGTTGGAAATAAGCATCTTCAGG - Intronic
1140619552 16:76712639-76712661 GTTTTAAAATATACATCTGCTGG + Intergenic
1141691339 16:85598452-85598474 GGTTTCTAATATGCATCGTTTGG - Intergenic
1141947644 16:87321588-87321610 GGTTGTAAATAAGCACCATCAGG - Intronic
1142932217 17:3296093-3296115 GGTTTTATATATGCTGTTTCTGG - Intergenic
1144368131 17:14564748-14564770 GCTTTTAAATATAAATCTCCAGG + Intergenic
1144625754 17:16843705-16843727 GGTTCTCAATGTGCATCTCCAGG + Intergenic
1144880678 17:18429015-18429037 GGTTCTCAATGTGCATCTCCGGG - Intergenic
1145151559 17:20515372-20515394 GGTTCTCAATGTGCATCTCCGGG + Intergenic
1146162908 17:30569630-30569652 GGTTCTCAATCTGCATCTCCAGG + Intergenic
1147275095 17:39309347-39309369 GGTTTTAAATATATATATCCAGG - Intronic
1147579909 17:41622396-41622418 GGTTCTCAATCTGCATCTCCAGG + Exonic
1147581610 17:41630460-41630482 GGTTCTCAATCTGCATCTCCAGG + Intergenic
1147984067 17:44294403-44294425 GGTTTTAAAAAATAATCTTCTGG - Intergenic
1149216433 17:54359431-54359453 GGTTTTAAATATGTTTATTTTGG + Intergenic
1149613365 17:57975465-57975487 GGTTTTAAAAATGCATAATTGGG + Intronic
1149928067 17:60722458-60722480 GGTTTTAAAAATGCTTTTTAGGG + Intronic
1150796680 17:68243931-68243953 GGGTTTTAATATATATCTTCTGG + Intergenic
1150981511 17:70147481-70147503 GTTTCTAAATGTGCATCTTATGG - Intergenic
1151109156 17:71654620-71654642 GGTATTAACCATCCATCTTCTGG + Intergenic
1151887158 17:76929886-76929908 TGTTCTAAATCTGCCTCTTCTGG + Intronic
1156705479 18:39876327-39876349 GGATTTACGTATGCATCTTGGGG + Intergenic
1158244605 18:55417316-55417338 CGTTTTAAAAATGCAGCTGCAGG - Intronic
1158401216 18:57123007-57123029 GGTTTTACATTTGCTTCTGCTGG + Intergenic
1159270043 18:66137186-66137208 GGTTTTAAAAAGGTCTCTTCTGG - Intergenic
1159336129 18:67069297-67069319 GTTTATAAATATGCATTTTATGG - Intergenic
1159455632 18:68657418-68657440 GCATTTAGATATGTATCTTCTGG + Intergenic
1159675554 18:71280854-71280876 GTTTTTCAATATGCATATTGTGG + Intergenic
925791764 2:7496151-7496173 GAATTTAAATATCCATCATCTGG - Intergenic
926347067 2:11956767-11956789 GAATTTAAAAATGCATCTTTAGG + Intergenic
928484431 2:31715675-31715697 GTTTTTAAAGATGCATCATTCGG - Intergenic
928918081 2:36495267-36495289 GGATTTAAATGAGAATCTTCTGG + Intronic
929862023 2:45686666-45686688 GGTTTAAAATATGCAATATCTGG - Intronic
929876532 2:45801312-45801334 GGATTTAAAAATGAATTTTCAGG + Intronic
929884470 2:45866210-45866232 GGTTTTACATGTGAATCATCTGG + Intronic
931298595 2:60955053-60955075 GGTTTTAATTTTTCATCCTCTGG - Exonic
933337649 2:80979165-80979187 GGAATTAAATCTCCATCTTCAGG + Intergenic
933733931 2:85479969-85479991 GGTTTTAAAAATATATATTCTGG + Intergenic
933993096 2:87647637-87647659 GGTTTTATGTATGTATTTTCTGG + Intergenic
935869495 2:107429972-107429994 ATTTTTAAATTTGTATCTTCTGG - Intergenic
936300762 2:111303246-111303268 GGTTTTATGTATGTATTTTCTGG - Intergenic
939567706 2:143804125-143804147 GGTTTTTAATCTTCAGCTTCTGG + Intergenic
939849273 2:147284528-147284550 GGTTTTTAAAATGCAGCTTTGGG - Intergenic
939988235 2:148853210-148853232 GGTTTCAAATATGAATTTTAGGG + Intergenic
942660287 2:178256766-178256788 TGTTTTAAATAAGCATATTCTGG - Intronic
943557470 2:189423061-189423083 GTTTTTAAATATCCATTTTTTGG - Intergenic
944232885 2:197413537-197413559 GGTTTTATATATCCCTGTTCTGG + Intronic
945842446 2:214904140-214904162 AGTTTTAAATATGCTTCTAGTGG + Intergenic
948032488 2:234830562-234830584 GAATTTAAATATTCATCATCAGG + Intergenic
1173908088 20:46643228-46643250 TGTTTTAATTATGTATCTGCTGG - Intronic
1175790032 20:61735261-61735283 AGTTTTAAAAAAGCAGCTTCTGG - Intronic
1177115865 21:17086116-17086138 GGTATAAAATATGCATAATCTGG - Intergenic
1178022380 21:28423986-28424008 GGTTTTATTTATGCCTCCTCAGG + Intergenic
1178489385 21:33039096-33039118 GGTTTTTAAAAAGCATTTTCTGG - Intergenic
1179097149 21:38326113-38326135 GGCTCTAAATATGTATCTTGCGG + Intergenic
1180116228 21:45707213-45707235 GGTTTTTAAAATGCAGATTCTGG + Intronic
1181371648 22:22423754-22423776 TGTTGTGCATATGCATCTTCTGG + Intergenic
1183638581 22:39079816-39079838 GGTTTTGAATATCTAACTTCAGG - Intronic
951593900 3:24296570-24296592 TGTTATAAATATTTATCTTCTGG - Intronic
951774160 3:26290224-26290246 TGTTTTAATTATACATCTTTTGG + Intergenic
955130897 3:56167326-56167348 GGTGTTTATTATGCAACTTCAGG + Intronic
955904329 3:63790769-63790791 TGTTTTTGATATGTATCTTCAGG + Intergenic
957435597 3:80171515-80171537 GTTTTAAAAAATACATCTTCAGG + Intergenic
958146864 3:89636577-89636599 GTTTTTAAATAGGAATTTTCTGG + Intergenic
959859925 3:111205452-111205474 GGTGTGAAATATGCACCTTCAGG + Intronic
960748038 3:120911226-120911248 GGTTTTAAATAAAAAACTTCAGG + Intronic
960956026 3:123031608-123031630 GGATTTAAAGAAGTATCTTCAGG - Intergenic
962024443 3:131532406-131532428 GGATTTAAATATGGATACTCTGG - Intergenic
964140480 3:153393312-153393334 GTTTCTAAAGATGCATCTTTAGG + Intergenic
964651738 3:159018889-159018911 GGCTTTGAATAAGCAACTTCTGG - Intronic
965761937 3:172087667-172087689 AGTTTTAAAAATGCAACATCAGG - Intronic
965897112 3:173592018-173592040 GGTTTTAAAAATGTATCCTGTGG + Intronic
967368830 3:188719658-188719680 AGTGCTAATTATGCATCTTCTGG + Intronic
967633450 3:191774208-191774230 TGTTTTAAATATTCATGTGCAGG - Intergenic
967848194 3:194061076-194061098 GGTTTTACATATGCATATACAGG + Intergenic
972039756 4:34578273-34578295 TCTTTTAAATATTCATTTTCTGG + Intergenic
972384139 4:38547259-38547281 GGATTTAAATGTGCAAATTCAGG + Intergenic
972692704 4:41415330-41415352 GGTTTTAAAAATCCATTATCAGG - Intronic
974139734 4:57870284-57870306 GTTTTGAAAAATGCATCATCAGG - Intergenic
974264751 4:59570852-59570874 GGTTGTAAATATTCCTCTTTAGG + Intergenic
974700163 4:65433434-65433456 CATTTTAACTATGCATGTTCTGG - Intronic
976334714 4:83871924-83871946 GGTTTCAATTATGCATTTTGGGG + Intergenic
976496118 4:85732038-85732060 GGTTTTAATTATGCATTCTCAGG + Intronic
978046985 4:104142029-104142051 GTTTTTAAAGATGCATCATTAGG + Intergenic
978046989 4:104142121-104142143 GTTTTTAAAGATGCATCATTAGG + Intergenic
978282905 4:107037833-107037855 GGATTAAAATATGCACCCTCTGG + Intronic
979040230 4:115781826-115781848 CGTTTTAAATCTTCATCTTGTGG + Intergenic
979544165 4:121921059-121921081 TGTTTTATATATTCATTTTCTGG + Intronic
979569068 4:122194432-122194454 GGATTTAAATTTTCCTCTTCTGG + Intronic
980982094 4:139663381-139663403 GGTTTAAAATCTACAACTTCCGG - Intergenic
981475982 4:145187765-145187787 GGTTTTTAATATCCTACTTCAGG + Intergenic
981676579 4:147349904-147349926 TGTTTGAAATGTGCATATTCAGG - Intergenic
986386356 5:7237929-7237951 GGATTTCCATATGCATCTTGAGG - Intergenic
986632290 5:9785258-9785280 TTGTGTAAATATGCATCTTCAGG + Intergenic
987443836 5:17991671-17991693 GGGTTTAAAAATGTATTTTCTGG + Intergenic
988098758 5:26652048-26652070 TGTTTTAAATATGCCTTTTTAGG - Intergenic
990791825 5:59489514-59489536 GGTTTAAAATATGTATATTAAGG + Intronic
990926215 5:61027334-61027356 GGTGTTAAATAAGCATAATCAGG + Intronic
991212779 5:64125527-64125549 GGTAGTAAATATGGATTTTCTGG + Intergenic
991459292 5:66840666-66840688 GGCTTAAAATATGCTTCTGCAGG + Intronic
993792712 5:92226184-92226206 GGTTTTAAATCTGCATCTATTGG + Intergenic
994427648 5:99613811-99613833 GTGTTCAAATATTCATCTTCAGG - Intergenic
994521167 5:100837832-100837854 GGTATCAAATATACATCTTTCGG - Intronic
994653012 5:102552948-102552970 GCTTTAAAATATGCATATTTTGG + Intergenic
995433155 5:112105049-112105071 GGTTTCAAATATGCTGTTTCCGG - Intergenic
995908873 5:117161468-117161490 TGTCTGAAATATGCTTCTTCGGG - Intergenic
998270038 5:140698135-140698157 TGTAAGAAATATGCATCTTCTGG + Intronic
998998795 5:147896469-147896491 GTATTTCAATATGCATTTTCAGG + Intronic
999021683 5:148173033-148173055 AGTTTAAAATATGAAACTTCAGG + Intronic
999035002 5:148338456-148338478 GGTTTTTAATATGTTTTTTCAGG + Exonic
999840139 5:155415810-155415832 GTGTTTAAATAAGCATTTTCAGG + Intergenic
1000273197 5:159706542-159706564 GGATTTATATCTGCTTCTTCAGG - Intergenic
1000679592 5:164166654-164166676 TGTTTTAAAAATGCATTTTAGGG - Intergenic
1001601121 5:172929211-172929233 GGTTTTAAGAATGCAGATTCTGG + Intronic
1002768796 6:269396-269418 TTTTTTAAATATGGATGTTCAGG + Intergenic
1003104493 6:3204988-3205010 GGAGTAAAATATACATCTTCAGG + Intergenic
1004940668 6:20553175-20553197 GCTTTTAAATATGCAAATTCAGG + Intronic
1005726143 6:28650805-28650827 GGATTTAAACATGAATTTTCAGG - Intergenic
1005886951 6:30104207-30104229 TGTTTTTAATTTGCAGCTTCTGG - Intronic
1007006305 6:38366600-38366622 CGTTTTAAATATGTGTCTTTTGG - Intronic
1009314977 6:62207474-62207496 GGTTTTACATACTCACCTTCAGG - Intronic
1009455151 6:63848362-63848384 GGTTTTAAATATGCCACTTTGGG + Intronic
1009538307 6:64919920-64919942 GATTTTAAATATGAATATACTGG - Intronic
1010113655 6:72273992-72274014 GTTCTTAAAGATGCATCTTTAGG - Intronic
1011366603 6:86588941-86588963 TGTTTTAAATAAGCATCTCTGGG + Intergenic
1012029969 6:94046779-94046801 TGATTTAAATGTGCATCTTTAGG + Intergenic
1012221435 6:96653631-96653653 GGTTCCAAATATGCATCTCCTGG - Intergenic
1012746103 6:103091506-103091528 TGTTTTAAACTTGCATCATCGGG - Intergenic
1012805822 6:103891453-103891475 GGCTTTCAATATCAATCTTCCGG - Intergenic
1014646690 6:123982569-123982591 GGTTTTATGTTTCCATCTTCTGG - Intronic
1016230074 6:141792589-141792611 GGTTTTTAAGATGCATCATTGGG - Intergenic
1020520679 7:9182531-9182553 AGTTTAAAATATGCATATGCGGG - Intergenic
1022293479 7:29026389-29026411 TTTTTTAAAGATGCATCTTTAGG - Intronic
1023586378 7:41734385-41734407 AGTTTTAAAAATGCATATTTTGG + Intergenic
1023755376 7:43411567-43411589 GGATTTAAACATGCTTCTTGTGG - Intronic
1025621086 7:63171593-63171615 GTTTTAAAAAATGCAGCTTCTGG + Intergenic
1026176122 7:67998538-67998560 GGTTTTAAATATGACTCAACAGG + Intergenic
1028096497 7:86767361-86767383 GGTTTTAAATAAACATCCTTAGG + Intronic
1028299509 7:89180468-89180490 GGTCTTGAATATGCATTATCAGG - Intronic
1028628618 7:92906729-92906751 TGTTTTCAATTTGCATTTTCTGG + Intergenic
1028984081 7:96996421-96996443 GGTTTTAATTAAACATCTTCCGG + Intergenic
1029866385 7:103635196-103635218 AGTTTTAAATATGGATCTAAGGG - Intronic
1031062616 7:117069193-117069215 AGTTTTAAATTTTCATCTACAGG - Intronic
1032320750 7:130884500-130884522 GTTTTTAAAAATGCATCTGTTGG - Intergenic
1032393527 7:131572564-131572586 GGGTTGAAATATGCAGCTTAAGG + Intergenic
1032441180 7:131944318-131944340 GGTTTTACATCTGCAATTTCTGG + Intergenic
1032640943 7:133767263-133767285 AGTTTAAAACATGCCTCTTCAGG + Intronic
1032940945 7:136790681-136790703 GATTTTAAATGTGCTTGTTCAGG + Intergenic
1039982040 8:42416028-42416050 GGTGTGAAAAATGCATCTTGTGG - Intergenic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1042341337 8:67683175-67683197 GGTTTCAAATATGGAACATCAGG - Intronic
1044643850 8:94416654-94416676 GGTTTTTAATATGTATTTTCTGG - Intronic
1047236318 8:123045255-123045277 AGTTTTATATATGCACCTGCCGG - Intronic
1050899018 9:10921268-10921290 AGTTTAAAATATGCATCATTGGG + Intergenic
1052095469 9:24379038-24379060 AGTTTAAAAGATCCATCTTCTGG + Intergenic
1052636598 9:31114563-31114585 TGTTATAAATATCCATGTTCAGG - Intergenic
1056413840 9:86357719-86357741 GATTTTTAATATGCATTTTCTGG - Intergenic
1061924348 9:133798602-133798624 GGTTTTAAAGATGAAGTTTCAGG - Intronic
1062230923 9:135480737-135480759 GGTTGTAAAATTGCAGCTTCTGG + Intronic
1185936373 X:4261798-4261820 GGTATCACATATGCATCTTGGGG - Intergenic
1185958393 X:4518340-4518362 TGTTTTAAGTTTGCTTCTTCTGG + Intergenic
1188696812 X:33203755-33203777 GGATTTAAATATGCAACTCATGG - Intronic
1191889568 X:65926338-65926360 GCTTTTAAATATGCAAATGCAGG + Intergenic
1192000309 X:67142886-67142908 GGTTTTACAAATGCAACTACAGG - Intergenic
1192824069 X:74676289-74676311 GTTTTTAAAAATTCATCTTAAGG + Intergenic
1194429109 X:93778712-93778734 GGGTTTTAATGTGCATTTTCTGG + Intergenic
1194606783 X:95990001-95990023 GGTTTTAACTATGTTCCTTCTGG - Intergenic
1194984596 X:100476954-100476976 GGTTTTGAATATGGATCGTTTGG + Intergenic
1196413127 X:115441077-115441099 AGTGTTAAATATGCATCATTTGG - Intergenic
1198325367 X:135565884-135565906 GGCTTCAAATATCCATCTCCAGG + Intronic
1198710598 X:139497700-139497722 GGTTTTCAATATGTATCTCAGGG - Intergenic
1202329327 Y:23730405-23730427 GGTTTTAAATATATATCTGATGG - Intergenic
1202541444 Y:25939649-25939671 GGTTTTAAATATATATCTGATGG + Intergenic