ID: 1126037194

View in Genome Browser
Species Human (GRCh38)
Location 15:44557698-44557720
Sequence TGTTCTCTTCAGGAGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126037190_1126037194 1 Left 1126037190 15:44557674-44557696 CCTCTGGGTAGATTTTTAGTAGG 0: 1
1: 0
2: 2
3: 29
4: 501
Right 1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG 0: 1
1: 0
2: 1
3: 24
4: 221
1126037189_1126037194 2 Left 1126037189 15:44557673-44557695 CCCTCTGGGTAGATTTTTAGTAG 0: 1
1: 0
2: 1
3: 27
4: 209
Right 1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG 0: 1
1: 0
2: 1
3: 24
4: 221
1126037188_1126037194 3 Left 1126037188 15:44557672-44557694 CCCCTCTGGGTAGATTTTTAGTA 0: 1
1: 0
2: 2
3: 18
4: 172
Right 1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG 0: 1
1: 0
2: 1
3: 24
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126037194 Original CRISPR TGTTCTCTTCAGGAGGTTGA AGG Intronic
900841354 1:5051036-5051058 TGAGTTCTTCAGGAGGGTGAAGG - Intergenic
901333527 1:8428994-8429016 TGTACTCATCAGTAGGTTAATGG - Intronic
904678986 1:32215785-32215807 TGCCCTCTGCAGGAGGTGGAAGG - Exonic
905020077 1:34804022-34804044 TGTTTTCCTCAGGATTTTGAAGG - Intronic
905159960 1:36023800-36023822 TTTTCTGTTGAGGATGTTGAAGG + Intronic
905271233 1:36789133-36789155 GTTTTTCTTCAGGAGGTAGAAGG - Intergenic
906145697 1:43558794-43558816 CTTTCCCTCCAGGAGGTTGAGGG + Intronic
906525533 1:46491123-46491145 GGTTCACTTAAGGAGCTTGAGGG + Intergenic
908641714 1:66230916-66230938 TGTGCTACTCAGGAGGCTGAGGG + Intronic
910566333 1:88647256-88647278 TTTCCTCTGCAGGAGGTTGTGGG + Intergenic
911239792 1:95452629-95452651 TGTCCTATTCAGGATTTTGACGG + Intergenic
911239925 1:95453924-95453946 TGTCCTATTCAGGATTTTGATGG + Intergenic
917267674 1:173239030-173239052 TGTTATCTCCAAGATGTTGATGG + Intergenic
919161897 1:193840870-193840892 GGTTCTATTCATGAGGATGATGG - Intergenic
920228913 1:204457525-204457547 TCTCCTCTTCCTGAGGTTGAGGG - Intronic
920814466 1:209318544-209318566 TGTTCTCTTTTTGAGGATGAGGG - Intergenic
921602852 1:217124988-217125010 TGGTCTCTTCAGCTGGGTGATGG - Intronic
921784733 1:219216613-219216635 TCTTCCTTTCAGGAGGTTCATGG + Intergenic
922477735 1:225918427-225918449 TCTTCTCAGCAGGAGGGTGAAGG + Intronic
922958830 1:229626879-229626901 TGTTCTCTGCAGTAGAGTGAAGG + Intronic
923225903 1:231938537-231938559 TGTTCTCTTCTGGAGGCTCTGGG - Intronic
1062803570 10:397806-397828 AGGTCTCTTCAGTTGGTTGAGGG - Intronic
1063152687 10:3351078-3351100 TGTTCACTTCACGGGGTTGGGGG - Intergenic
1065469553 10:26063403-26063425 TGTTATCTTCTGGAGTTTTATGG + Intronic
1066078960 10:31910355-31910377 TGTTATCCTCAGGAGAATGATGG - Intronic
1066522236 10:36234282-36234304 TGTTTTCTTCTGGAAGTTTATGG - Intergenic
1068626186 10:59250631-59250653 TTTTCAGTTCAGCAGGTTGAGGG - Intronic
1068832519 10:61512972-61512994 TGTTTTCTTCTAGAGGTTGTGGG + Intergenic
1072764411 10:98083992-98084014 CTGTCTCTTCAGGAGGTGGAAGG + Intergenic
1073128572 10:101169444-101169466 TGTTCTCTTCAGTAAATTGTTGG + Intergenic
1073315371 10:102577028-102577050 TGGTCTCTTCAGGAAGAAGATGG + Intronic
1073739395 10:106389481-106389503 TGTTCTCTTAAGAAAGTTGGGGG - Intergenic
1074547471 10:114412459-114412481 TGATCTCTTCTGGAGGGTGAAGG - Intergenic
1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG + Intronic
1077429108 11:2507153-2507175 TGTTTTCTTCTGGAGGTTTGGGG + Intronic
1078548988 11:12267570-12267592 TGTTTTGTTGAGGAGGTTGAGGG - Intergenic
1078956802 11:16207293-16207315 TGTTCTTTTCATCAGTTTGAGGG - Intronic
1080972723 11:37298758-37298780 TGTTCTATTCAGGCATTTGAGGG + Intergenic
1082649623 11:55773225-55773247 GCTTCTGTTCAGAAGGTTGATGG + Intergenic
1082881281 11:58040821-58040843 TGTTCTTTTCAGGATGGAGAAGG + Intronic
1087493116 11:98852690-98852712 TGTTCTCTACAGCAGAGTGACGG + Intergenic
1088280897 11:108133579-108133601 AGTTCTCTACAGGAGGTTTGAGG - Intronic
1088535532 11:110856632-110856654 TGTTCTCCTCTGGGTGTTGACGG - Intergenic
1089968328 11:122672192-122672214 TGTCTTCTTCAAGAGGTTGAGGG - Intronic
1090049147 11:123362126-123362148 TGTTGTCTTCAGAAAGTTGCTGG + Intergenic
1090617380 11:128527594-128527616 TGGACTCTTGAGGAGGTAGAGGG + Intronic
1090774427 11:129950581-129950603 GGTTCTGGTGAGGAGGTTGAGGG - Intronic
1094210567 12:27885691-27885713 TGTTCTCTACAGCAGGCTGCTGG + Intergenic
1096442971 12:51661537-51661559 TGTTCTCTTGAGGAGCCTCAAGG + Intronic
1096949959 12:55457992-55458014 TTTTTTCTTCAGGACTTTGAAGG - Intergenic
1097438480 12:59579894-59579916 TCTTGTCTTCAGGAGTCTGATGG - Intergenic
1100029840 12:90173092-90173114 TGGTTTCTTCTGGAGGTTGAAGG + Intergenic
1100931984 12:99619739-99619761 AGTTCTCTGCAGGGGGATGAGGG - Intronic
1103450485 12:121025321-121025343 TGCTCTGTTGAGGAGGTAGATGG - Intronic
1105420525 13:20248052-20248074 TGTTTTCTTCAGGATGATGTAGG + Intergenic
1105616890 13:22027237-22027259 TGTTTTCTTCAAGAGATTGTGGG + Intergenic
1106114989 13:26810006-26810028 TTTTCTCCCAAGGAGGTTGATGG + Intergenic
1106819979 13:33454128-33454150 TCTTCACATCAGGAGGATGACGG - Intergenic
1107309900 13:39065618-39065640 TGTTTTCTTCTGGAGTTTTATGG + Intergenic
1109154894 13:58896812-58896834 TGTTTTCTTCAGGAGGCTCTTGG - Intergenic
1109910031 13:68897574-68897596 TGTTTACTTCAGGTGGTTGTTGG + Intergenic
1112157150 13:96830755-96830777 TGTTCTTTTCAGAATATTGAGGG + Intronic
1112377141 13:98853909-98853931 TGTTGTCCTCAGGAGGTGGTTGG - Intronic
1112595463 13:100803479-100803501 TGTTCTCAGGATGAGGTTGAGGG + Intergenic
1113886151 13:113659267-113659289 CCATCTCTGCAGGAGGTTGATGG + Intergenic
1114729996 14:24982410-24982432 TGCTCTGTTCACCAGGTTGAAGG - Intronic
1114793668 14:25687342-25687364 TTTTCTCTGCAGTAGATTGAAGG - Intergenic
1119521733 14:75291329-75291351 TGTTCTGTTCAGAAGATGGATGG - Intergenic
1121055837 14:90851719-90851741 TGTTTTCTTCTAGAGGATGAAGG + Exonic
1121477963 14:94230086-94230108 TGTTCTCTTCAGTTGTTTAAAGG + Intronic
1121704837 14:95983772-95983794 TCCTCTCTTCAGGGGGCTGATGG + Intergenic
1121927168 14:97938232-97938254 TGATCTTTTTTGGAGGTTGAAGG + Intronic
1126037194 15:44557698-44557720 TGTTCTCTTCAGGAGGTTGAAGG + Intronic
1126535854 15:49763409-49763431 TGTTCTTTTCAGGAGCTAAAAGG - Intergenic
1127842670 15:62844501-62844523 TGTTTTCTTCTGGATCTTGAAGG - Exonic
1128922912 15:71628574-71628596 ATTCCTCTTCAGGAGGTTTAGGG + Intronic
1129011818 15:72426202-72426224 TGTTCTCAACAGCAGGTTGGAGG - Intergenic
1130651170 15:85762961-85762983 TCTTCTCTTCAGGGTGTTGCTGG - Intronic
1130924485 15:88375002-88375024 TGACCTGTTCAGGAGTTTGAGGG - Intergenic
1131788688 15:95940649-95940671 TGGTCTCTTCAGGAGGGCGTTGG + Intergenic
1132999708 16:2842704-2842726 CGCGCTCTTCCGGAGGTTGAGGG + Intergenic
1133585765 16:7193341-7193363 TGTTCTTTTCTGGAGGTTCTAGG - Intronic
1133708792 16:8381194-8381216 TGTTCTCTTATGGATGTTGAGGG - Intergenic
1134866289 16:17610361-17610383 GGGTCTCTTCAGGTGGTTGGGGG - Intergenic
1136087622 16:27896813-27896835 TGTTCCTTTCTGGAGGTTCAAGG - Intronic
1136373033 16:29847944-29847966 GGTTGTCTCCAGGAGCTTGAGGG - Exonic
1137959524 16:52868199-52868221 TGTTTTCCTCAAGAGTTTGAGGG + Intergenic
1140801683 16:78494248-78494270 TGTTCTCTGCAGGAACTAGACGG - Intronic
1141525722 16:84610059-84610081 TGTTGTCTTCAGATGTTTGAGGG - Intronic
1141526558 16:84615466-84615488 TGTTCTCTCCAGCAAGTAGAAGG - Intronic
1142612526 17:1117039-1117061 TGGTCTCTTCAGAAGGCTTAGGG - Intronic
1142749002 17:1976436-1976458 TTCTCTCTGCATGAGGTTGAGGG + Intronic
1144855545 17:18265415-18265437 TGTTTTCTTCAGGCAGCTGAGGG + Exonic
1146516773 17:33495680-33495702 TGTTAGCTTCAGGAGGGTGGGGG - Intronic
1147445754 17:40474425-40474447 TGTTCTCTCCAGGAGGCTCCAGG - Intergenic
1148533436 17:48417267-48417289 TTTCCTCTACAGGAGGTAGAAGG - Intronic
1151140590 17:71987970-71987992 TGTTGTATTCAGCAGGTTGAGGG - Intergenic
1152079651 17:78178864-78178886 TGTTCTCTTCAAGAAGTTCCGGG - Intronic
1153592463 18:6688042-6688064 TGTTATCTTCAGGAGTTTTATGG - Intergenic
1154000924 18:10481904-10481926 TGGTCACTTCAGGAGGTTGATGG - Intronic
1154371987 18:13772360-13772382 TGCTCACTTTAGGAGGCTGAGGG + Intergenic
1154408563 18:14120430-14120452 TGTTTTCTTCAGGAGTTTTAAGG - Intronic
1155179703 18:23333808-23333830 TGTTCTTTTCTGGAGGTGGAGGG + Intronic
1155658477 18:28219592-28219614 ACTTCTCTTCAGGAGGTTAAGGG - Intergenic
1157033352 18:43940443-43940465 TGTTCCCTTCTGGAGGTTCTAGG + Intergenic
1159619948 18:70625511-70625533 TGTTTTCATCAGGGGTTTGATGG + Intergenic
1160207775 18:76850292-76850314 TGTTCTCTAAAGGAGGTCCATGG - Intronic
1163161218 19:15465159-15465181 TGAGCTATTCAGGAGGCTGAGGG + Intergenic
1163586632 19:18167967-18167989 TGAGGTCTTCAGGAGGTTGGTGG - Intronic
1164190140 19:22907593-22907615 TTAGCACTTCAGGAGGTTGAGGG - Intergenic
1165185384 19:34016224-34016246 TTTTCTCTTCTTGAGGTTTATGG - Intergenic
1167623059 19:50569284-50569306 TCTTCTCTTCATGAGGTGGAGGG - Intergenic
1168481892 19:56727104-56727126 TTTTCACTTCGGGAGGCTGATGG - Intergenic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925627189 2:5852978-5853000 TGTTCTGTTCAGGCTGTTGATGG - Intergenic
928212300 2:29332338-29332360 AGATTTGTTCAGGAGGTTGAGGG - Intronic
930887818 2:56348273-56348295 TGTTGGCTTCAAGAGGTGGATGG - Intronic
934112572 2:88756871-88756893 TGGTCTCTTCAGGAGGCAAAGGG + Intergenic
934515009 2:94981021-94981043 TGGTCTCTTCAGGAGGTGATGGG - Intergenic
935422415 2:102883552-102883574 TGTGCTCTTCAAGATGTGGAAGG + Intergenic
936163781 2:110103332-110103354 TGGTCTCTTCAGGAGGCAAAGGG + Intronic
939359454 2:141149766-141149788 TGTTCTTTCCTGGAGGTTGCAGG - Intronic
941078562 2:161033936-161033958 TTTTATCTTAGGGAGGTTGATGG - Intergenic
941104175 2:161333679-161333701 TGTCCACTTGAGGAGGTTGAAGG - Intronic
942066864 2:172279703-172279725 TCTTCTGTTCAGGAGTTTTAGGG - Intergenic
943865721 2:192922822-192922844 TGAGCTCTTCAGGAGGGTAAAGG - Intergenic
945644586 2:212474867-212474889 TGAGCCCATCAGGAGGTTGAAGG - Intronic
946597233 2:221319546-221319568 TGTTTTATTCAGGAAGGTGAGGG - Intergenic
947107370 2:226681551-226681573 TGTTCTATTCAGGCTGTTAACGG + Intergenic
947812064 2:233010926-233010948 TGGTGTCTTCAGGAGGCTGCTGG - Intronic
948335483 2:237203825-237203847 TGTTCTCCCCAGGAGGGTCACGG + Intergenic
948362102 2:237429358-237429380 TGTTCTCCTCAGGAAGTTTGTGG - Intergenic
1169010368 20:2245175-2245197 TGTTCTGTGCAGGAAGTGGAGGG + Intergenic
1169256212 20:4101491-4101513 TGTTCTTTTCTGGAGGTTCTGGG + Intergenic
1169933318 20:10857175-10857197 CCTTCTCTTCAGGAGATTGAAGG - Intergenic
1170139138 20:13107950-13107972 TGTTTTCTTAAGGATGTTAAAGG + Intronic
1174324967 20:49771770-49771792 TGTTCACTGTAGGAGGTTTAGGG + Intergenic
1174686309 20:52458825-52458847 TGTTCTCTACCAGAGGTGGATGG - Intergenic
1175153284 20:56952170-56952192 TGTTCTTTTCTGGAGGTTCTAGG - Intergenic
1176173435 20:63706848-63706870 TCTGCTCTTCAGGAGGCTGGTGG + Intronic
1178606268 21:34038627-34038649 GGTTCCCTTGAGGAGGATGAGGG - Intergenic
1178786867 21:35661738-35661760 TGTTCTGTTCAGCAAGCTGATGG + Intronic
1180217180 21:46332497-46332519 TGTCCTCTTAAGGAAGTGGATGG + Intronic
1181492358 22:23268566-23268588 TGTTCTCCTCGGGAGGTGGAGGG - Intronic
1182505926 22:30782308-30782330 GGTTGTCTGCAGGAGGTGGAAGG - Intronic
1182718343 22:32377758-32377780 TGTTCATGTCAGGAGGTTGGGGG + Intronic
1184121015 22:42450353-42450375 TGTTCTCTTCAGGCTTTCGATGG + Intergenic
1184530444 22:45051952-45051974 TGACCTCCTGAGGAGGTTGAAGG - Intergenic
950108061 3:10400872-10400894 TGTCCCCTTCATGAGGCTGAAGG - Intronic
951055377 3:18141120-18141142 AGTTCTCTTCACGTTGTTGAAGG - Intronic
951991341 3:28678866-28678888 TGTGCACTTCAGGAGTTAGAGGG + Intergenic
954704281 3:52470847-52470869 TGTTCTCTGCAGGAGATAAATGG + Exonic
957939562 3:86988917-86988939 TGTTGTCTTCAGTATGTTGACGG + Intronic
959128669 3:102323099-102323121 TGTAGTCTTCAGGAAGTTTATGG + Intronic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
960639710 3:119813630-119813652 TGGTTTCTTCAGCAGGTTGAGGG + Intronic
963043995 3:141089203-141089225 TGCTCTCTTCAGGTGGACGAGGG + Intronic
965060261 3:163775619-163775641 TGGTCACTTCTGGAGGTTGAGGG + Intergenic
967604312 3:191426037-191426059 TCTTCTCTTCATAAAGTTGAAGG - Intergenic
968394569 4:222505-222527 TGTTTTCTTGAGGAGTTTTAAGG + Intergenic
968412062 4:398412-398434 TGTTTTCTTCAGGAGTTTTAAGG + Intergenic
972586348 4:40440281-40440303 TGTTTTCTTGAGGAGGTGGGAGG + Intronic
972727423 4:41757383-41757405 TGTTTTCTTTAGGAGGTTTGTGG + Intergenic
973884581 4:55307380-55307402 TCTGCTCTTCAGGAAGTTGTAGG - Intergenic
975199462 4:71568876-71568898 TGTTCTATGAAGGAGATTGAGGG + Exonic
977008097 4:91597836-91597858 TGCTCTCTTCAGGAGGAATATGG + Intronic
977821512 4:101477363-101477385 TGTCATCTTCAGTAGGTTGAAGG - Intronic
978223276 4:106303559-106303581 TGGTCTCTTCAGTCAGTTGAAGG - Intronic
980345115 4:131604773-131604795 TGTTCTTTTCTGGAGGGTGAGGG + Intergenic
980616777 4:135238059-135238081 TGTTCTCTTTAGGATCTTCAAGG + Intergenic
983526852 4:168768468-168768490 TGTTCTATTTAGTAGGTTCAGGG + Intronic
983632736 4:169866033-169866055 TGTTCTATTCAAGAGTTTGCAGG + Intergenic
984404411 4:179308626-179308648 TTTTTTCTTCAGCAGTTTGAAGG - Intergenic
984567132 4:181344534-181344556 TGTTTACTTCATGAGGTTTAAGG + Intergenic
985998644 5:3612828-3612850 TGAGCCCTTCAGGAGGTGGAAGG - Intergenic
986170490 5:5310698-5310720 TGGTGCCTTCTGGAGGTTGAGGG - Intronic
986431678 5:7687477-7687499 GGTTCTCTTTAGCAGGGTGAGGG + Intronic
987296727 5:16559441-16559463 TGCTCTCTGCAGGAAGTGGATGG - Intronic
987561039 5:19520325-19520347 TTCTCTCTTAATGAGGTTGATGG - Intronic
988435274 5:31167072-31167094 TGTTCTCATGGGGAGGTTCAAGG + Intergenic
990444240 5:55879197-55879219 TGTTCTCTTTAGTTGGTAGAAGG + Intronic
992059750 5:73030696-73030718 TGTTCTATTCAGAAGGTCTAGGG - Intronic
992940756 5:81758964-81758986 TGATCTAATCAGGAGGTTTAGGG - Intergenic
994049750 5:95349103-95349125 TGTTCTCATCTGGAGGCAGAGGG - Intergenic
994699179 5:103111823-103111845 TGGTCTCTCCAGGAGGTAAATGG - Intronic
995145359 5:108782367-108782389 TGGTCTATGCAGGAGGTTGAAGG - Intronic
995823393 5:116264707-116264729 TTTTTTCTTTAGGAGCTTGATGG + Intronic
997718467 5:136059481-136059503 CCTTCTCTTAAGGAGGTTGTAGG + Intronic
998878250 5:146621457-146621479 TGTTCTCAGCACCAGGTTGAAGG - Intronic
998880406 5:146639572-146639594 TGTTCTTTGCAGGATGTTGCTGG - Intronic
1000201013 5:159011189-159011211 TGTTTTCTTAAGGAAGTTGAAGG + Intronic
1001249109 5:170132502-170132524 TATTCTGGTCAGGAGGATGAAGG + Intergenic
1001706921 5:173748240-173748262 AGTTCACTTCAGAAGGTAGATGG - Intergenic
1003356985 6:5382942-5382964 TATTCTATTCAGGTGCTTGATGG + Intronic
1006419831 6:33925949-33925971 TGCTGTCTTCAGGAGGAGGAGGG + Intergenic
1009888430 6:69652699-69652721 TGTTCTTTGCAGGAGGATGTTGG - Intergenic
1010452764 6:76021017-76021039 TATTCTCTTCAGGATTTGGAGGG - Intronic
1012109027 6:95202783-95202805 AGATCTGTTCATGAGGTTGAAGG - Intergenic
1012122837 6:95388539-95388561 TGTACTCCTCACAAGGTTGAGGG - Intergenic
1012797047 6:103775709-103775731 TGTTCTTTTCAGGAGCATCAAGG + Intergenic
1013166856 6:107602415-107602437 TTCTCTCATCAGGAGATTGAAGG - Intronic
1014024515 6:116629882-116629904 TGTTCTCTGACAGAGGTTGAAGG + Intronic
1015373516 6:132483161-132483183 TGTTGTCTTTGGGAGGTGGATGG - Intronic
1015534055 6:134249169-134249191 TTTTTTCTGCAGGAGGTTTATGG - Intronic
1016246145 6:141983617-141983639 TGTCCTGTTCAGGAGGCTGGTGG + Intergenic
1019138289 6:169926133-169926155 TGTTCTCTTCAGGAGGGCATGGG - Intergenic
1021286910 7:18791650-18791672 GGGTTTCTTCAGGAGGGTGATGG + Intronic
1021511197 7:21434276-21434298 TTTACTCTTCAGGAGATTAAGGG + Intronic
1022270601 7:28804186-28804208 TGTTCTGTTTCAGAGGTTGAAGG + Exonic
1023816266 7:43952576-43952598 TGTTCTCTGCAGCACATTGAAGG + Intronic
1025164277 7:56697297-56697319 TGTTCTTTTCAGAAGGTTAAAGG - Intergenic
1025706002 7:63864751-63864773 TGTTCTTTTCAGAAGGCTAAAGG + Intergenic
1025799433 7:64771770-64771792 TATTTTCTTCAGGAGTTTTAAGG + Intergenic
1028750184 7:94374244-94374266 TTTTCTCTTCATGAACTTGAAGG - Intergenic
1029404868 7:100368627-100368649 TCTGTGCTTCAGGAGGTTGAGGG + Intronic
1032479753 7:132236826-132236848 AGTTCAGTACAGGAGGTTGACGG - Intronic
1032696022 7:134337097-134337119 TTTTCTCATCAGCAGGTTTATGG - Intergenic
1037022587 8:13992246-13992268 TGCTATCTTAAGGAGGTTCAAGG - Intergenic
1037614400 8:20504562-20504584 TGTAGTCCTCAGGAGGCTGAGGG - Intergenic
1038888162 8:31688930-31688952 TCTTCCCTTCTGGAGGTTCAGGG + Intronic
1039877431 8:41598979-41599001 CCTTCTATTCAGGCGGTTGAAGG + Exonic
1041407439 8:57515679-57515701 TGATCTCTGCTGGAGGGTGAAGG + Intergenic
1042494254 8:69438447-69438469 TGTTCCCTTCAGAAGTTTAAAGG - Intergenic
1043115742 8:76251904-76251926 TGCTCTTTCCAGGTGGTTGAAGG - Intergenic
1043578553 8:81686300-81686322 TCGTCTCTTCCGGAGGTAGAGGG + Intronic
1045236991 8:100360778-100360800 TGTTTTGGTGAGGAGGTTGAAGG + Intronic
1047669485 8:127129058-127129080 TCTTCTCTTTTTGAGGTTGAGGG - Intergenic
1048351464 8:133620004-133620026 GGGTCTCTTCAGGAGGGGGAAGG - Intergenic
1048497332 8:134946231-134946253 CGGTCTCTTTAGGAGGATGAGGG + Intergenic
1049245123 8:141558302-141558324 TGTTTTCTTCATGGTGTTGAAGG + Intergenic
1049412683 8:142480365-142480387 TGTTCTCATCTGTAGGATGAGGG + Intronic
1055924529 9:81496091-81496113 TGTTTTCATCAGGCGATTGAGGG - Intergenic
1056945005 9:90986998-90987020 TGTGATCTTGTGGAGGTTGATGG - Intergenic
1058376553 9:104328788-104328810 TGTTCCCTACTGGTGGTTGAGGG + Intergenic
1062080238 9:134619907-134619929 TATTATCCTCAGGAAGTTGATGG - Intergenic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1185933736 X:4232330-4232352 TGACCTCTACAGTAGGTTGAGGG + Intergenic
1186877770 X:13833610-13833632 AGTCCTATTCAGGAGGCTGAGGG + Intronic
1188495406 X:30778335-30778357 TGTTCTATTCAGGCCCTTGATGG - Intergenic
1193383878 X:80848115-80848137 GGTTCTGTTCAGATGGTTGAGGG + Intergenic
1196928145 X:120654670-120654692 TGTACTCAACTGGAGGTTGATGG - Intergenic
1198807961 X:140507990-140508012 TCTTCTCCTGAAGAGGTTGAAGG - Intergenic
1198820789 X:140646121-140646143 TGTTATCCTCAGTATGTTGATGG + Intergenic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic
1200474526 Y:3628474-3628496 AGGTCTCTGCAGGAGGGTGAGGG + Intergenic
1201297818 Y:12479680-12479702 AGGTCTCTTCAGGACTTTGATGG + Intergenic