ID: 1126047173

View in Genome Browser
Species Human (GRCh38)
Location 15:44653005-44653027
Sequence AGTATGTATGTGGGTATAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126047168_1126047173 7 Left 1126047168 15:44652975-44652997 CCAGAGGAATGCATAAGAACTAG 0: 1
1: 0
2: 2
3: 11
4: 128
Right 1126047173 15:44653005-44653027 AGTATGTATGTGGGTATAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126047173 Original CRISPR AGTATGTATGTGGGTATAGG TGG Intronic
901407666 1:9060493-9060515 TGTATGTATGTGTGCATATGTGG - Intronic
902272478 1:15314626-15314648 AGGATGTATGTGGGTGTGTGGGG + Intronic
904339578 1:29826122-29826144 AGTATGTATGTGTGAATGTGGGG - Intergenic
905387082 1:37612574-37612596 AGTATGTATGGTTGTATATGTGG + Exonic
905938710 1:41845397-41845419 CGTGTGTGTGTGTGTATAGGAGG - Intronic
906518428 1:46453077-46453099 AGCGTGTATGTGAGTATGGGAGG - Intergenic
912131509 1:106607768-106607790 AGTAAATATGTGGATCTAGGAGG - Intergenic
912240208 1:107899078-107899100 AGTATGTATGTGGTTCTGAGAGG + Intronic
912307714 1:108587322-108587344 TGTGTGTATGTGGGGACAGGAGG - Intronic
917040034 1:170795346-170795368 AGTATATATTTGAGTATAGTAGG - Intergenic
917121701 1:171650213-171650235 TGTGTGTATGTGGGTGTGGGTGG - Intronic
917381377 1:174412573-174412595 AGTGTGTTTTTGGGTAGAGGAGG + Intronic
917640213 1:176976243-176976265 TGTGTGTATGTGTGCATAGGTGG - Intronic
918315462 1:183319063-183319085 AGTGTGTATGTGGGGGTATGGGG - Intronic
918664888 1:187138605-187138627 TGTATGTATGTGTGTTTTGGAGG + Intergenic
920088117 1:203432780-203432802 AGTACGTGTGTGGGTGGAGGGGG + Intergenic
923822591 1:237462016-237462038 AGTATATATTTAGGTATATGTGG - Intronic
923948428 1:238918936-238918958 AGTATGTATGTGGCAAAGGGGGG + Intergenic
924526168 1:244851777-244851799 AGGCTGTATGTGAGTATATGAGG + Intronic
924632508 1:245754034-245754056 AGTCTGGATGTGGGTGTAGCAGG - Intronic
1062975624 10:1680389-1680411 TGTATGTATGTGGGTGGAGAAGG - Intronic
1063257247 10:4341893-4341915 TGTATGTATGTGTGTTTATGTGG - Intergenic
1063728622 10:8669321-8669343 AGTGTGTATGGTGGGATAGGAGG - Intergenic
1064682170 10:17821395-17821417 AGTATATTTTTGGGTAAAGGTGG - Intronic
1066122813 10:32307612-32307634 AGTCTTTATGTGTGTATATGGGG + Intronic
1066927913 10:41720755-41720777 AGTTTTTATGTGGGTATATTTGG - Intergenic
1068317955 10:55371887-55371909 AGGAAGTATGTAGGTAAAGGTGG + Intronic
1069266617 10:66466300-66466322 TGTGTGTGTGTGGGTGTAGGTGG - Intronic
1069266622 10:66466332-66466354 TGTGTGTGTGTGTGTATAGGTGG - Intronic
1069838492 10:71324698-71324720 TGTGTGGATTTGGGTATAGGTGG + Intronic
1071485328 10:86097719-86097741 ACCATGTATGTGGGAAAAGGTGG + Intronic
1074121343 10:110496437-110496459 CGTATGTGTGTGGCTCTAGGCGG + Intergenic
1076643724 10:131936927-131936949 AGTGTGTCTGTGGGTAAGGGCGG + Intronic
1076745943 10:132514276-132514298 GGTATGTATGTGTGTATGTGTGG + Intergenic
1077417987 11:2433947-2433969 AGTGTATATGTGTGTGTAGGTGG + Intergenic
1078183288 11:9030330-9030352 AGCACGTCTGTGAGTATAGGGGG + Intronic
1078471588 11:11591659-11591681 TGAATGTATGTGGTTAAAGGAGG + Intronic
1078477739 11:11646492-11646514 AAAATGTGTGTGGGTTTAGGTGG - Intergenic
1079756012 11:24263582-24263604 AGTATGTATGTGTGTGTGGATGG + Intergenic
1080591293 11:33724962-33724984 AGTATGTGTATGTGTATGGGGGG + Intronic
1081831113 11:46115427-46115449 TGTATGTTTGTGTGTATATGTGG - Intronic
1083547106 11:63557210-63557232 AGAATGTATGAGGGGATATGTGG + Intronic
1084461315 11:69298154-69298176 AGTATGTACGTGGGAGGAGGTGG - Intronic
1084495014 11:69498470-69498492 CGGATGGGTGTGGGTATAGGTGG + Intergenic
1086150863 11:83609257-83609279 AGCCTGTATGTTGGTATAGAAGG - Intronic
1086257584 11:84896852-84896874 AGTATGTATGTATGCATAGCTGG + Intronic
1087568255 11:99891214-99891236 AATCTGGATGTGGGTATATGGGG + Intronic
1088629388 11:111760006-111760028 AGTCTGTCTGTGTGTATGGGGGG - Intronic
1088846546 11:113673113-113673135 TGTATGTGTGTGTGTATTGGAGG - Intergenic
1088856506 11:113759749-113759771 AGTAGGCTTGTGGGTAGAGGAGG - Intronic
1089903062 11:122008674-122008696 GGTATGTATGTGGGTGTGTGTGG - Intergenic
1090515176 11:127417354-127417376 TGAATTTTTGTGGGTATAGGAGG + Intergenic
1090873922 11:130772108-130772130 CGAATGTATGTGTGTATATGAGG + Intergenic
1091196845 11:133738802-133738824 TGTATGTATGTGGGTGTGTGTGG + Intergenic
1092495980 12:8995555-8995577 AGTGTGTATGTGGGGCAAGGAGG + Intronic
1093744435 12:22723623-22723645 AGTGTCTAAGTGGGTATAGAAGG - Intergenic
1094075459 12:26468074-26468096 AGTAAGTATGTGGTTCTAGTTGG + Intronic
1095221243 12:39618881-39618903 AGTTTGAATGAGTGTATAGGAGG + Exonic
1096087190 12:48873627-48873649 TGTATGCATGTGTGAATAGGAGG + Intergenic
1096177380 12:49531637-49531659 AGTATGAATGTATGTATGGGAGG + Intergenic
1096422034 12:51466970-51466992 TGTGTGTATGTGTGTGTAGGGGG + Intronic
1097124544 12:56763414-56763436 GGTATGTAGGTGGGTAAGGGTGG + Exonic
1097556293 12:61142729-61142751 AGTGTGTATGTGTGCATGGGAGG - Intergenic
1098511462 12:71318995-71319017 TGTATGTGTGTGTTTATAGGAGG - Intronic
1099747235 12:86720965-86720987 AGTATGTAAGTGGGAGTATGAGG - Intronic
1099831260 12:87845592-87845614 TGTGTGTATGAGGGTATAGATGG - Intergenic
1100420927 12:94432587-94432609 AGTATGTGTGTGGGGGAAGGTGG + Intronic
1104142417 12:126001688-126001710 TGCATGTGTGTGGGTACAGGGGG - Intergenic
1104684431 12:130775644-130775666 AGTATGTTTTGGGGGATAGGTGG - Intergenic
1106270947 13:28152900-28152922 AGTGTTTGTGTGGGTATGGGGGG + Intronic
1106448370 13:29857400-29857422 AGTTTGTGTGTGGGTGTGGGAGG - Intergenic
1106585650 13:31054266-31054288 ACTTTGTATGTGTGTATGGGGGG - Intergenic
1106700957 13:32228231-32228253 AGTGTGTATTTGGGAATAGGAGG - Intronic
1107185922 13:37520030-37520052 TGTATGTATGTGTGCATATGGGG + Intergenic
1108034209 13:46271160-46271182 TGTGTGTATTTGGGTATATGTGG + Intronic
1108617040 13:52143385-52143407 GGTATGTGTGTGGGGACAGGTGG - Intronic
1109816958 13:67597264-67597286 AGTATGTATGTATGTGGAGGGGG + Intergenic
1111131008 13:83975673-83975695 AGTGTGTATGTGTGGGTAGGTGG + Intergenic
1111216281 13:85146505-85146527 AGTATTTATGTGTGTGTTGGAGG - Intergenic
1111231077 13:85344815-85344837 TGTATGTATGTATGTATACGTGG - Intergenic
1112516151 13:100054885-100054907 AGTAAGGATGTGGGTAAGGGAGG + Intergenic
1112876482 13:104046536-104046558 TGTGTGTATGTGTGTATATGAGG - Intergenic
1112986037 13:105451406-105451428 AGTATGTGTGTGGGTAAATAGGG - Intergenic
1114473306 14:22978291-22978313 AGTGTGTATGTGGGCAGGGGAGG + Intronic
1115056119 14:29129271-29129293 TGTGTGTATGTGTGTGTAGGGGG - Intergenic
1115447444 14:33507897-33507919 AATGTGGATGTGGGTATATGTGG + Intronic
1116029537 14:39554242-39554264 AGAATGTATGTGGGTTGAAGTGG - Intergenic
1117106256 14:52399901-52399923 TGTATGTAAGTGGGTGTGGGTGG - Intergenic
1118352377 14:64982254-64982276 AGTTTGTATTAGGGTACAGGGGG + Intronic
1118554021 14:66993254-66993276 TGTATGTGTGTGTGTAGAGGGGG - Intronic
1118851269 14:69585624-69585646 AGTAAGTTTGCGGTTATAGGGGG - Intergenic
1121466856 14:94121350-94121372 AATGTGTGTGTGGGTTTAGGGGG + Intergenic
1122315354 14:100822982-100823004 AGTATGTACATGTGGATAGGAGG + Intergenic
1202881654 14_KI270722v1_random:66449-66471 AGTTTGTAGGTGGGTAGATGGGG - Intergenic
1124011859 15:25845401-25845423 AGTGTGTATGTTGGTGGAGGTGG - Intronic
1124805477 15:32877635-32877657 ATTATGTGGGTGGGTAGAGGAGG - Intronic
1124869276 15:33524114-33524136 TGTGTGTATGTGTGTGTAGGGGG - Intronic
1124892253 15:33744117-33744139 AGAATGTGTGTGAGTACAGGCGG - Intronic
1124990126 15:34664925-34664947 AGTATGTATGTGGTAATGGTGGG + Intergenic
1126047173 15:44653005-44653027 AGTATGTATGTGGGTATAGGTGG + Intronic
1127640065 15:60908038-60908060 AGTGTGTATCTGGGTGGAGGCGG - Intronic
1128091052 15:64919145-64919167 ACTATGTATGTGGGGAAAGCTGG + Intronic
1128560088 15:68658977-68658999 TGTATGCATGTGGATATTGGTGG - Intronic
1129142383 15:73611833-73611855 TGTATGTGTGTGGGGACAGGGGG + Intronic
1129270378 15:74416391-74416413 TGTCTGTGTGTGGGTAAAGGTGG - Intronic
1129933517 15:79431498-79431520 AGTATGTGTGTGTGTGTGGGGGG + Intergenic
1130125040 15:81086143-81086165 AGGAAGTATGTGGGTACTGGTGG + Intronic
1131686533 15:94773855-94773877 AATATGAATGTGTGTATAGATGG - Intergenic
1131744124 15:95427372-95427394 AGCATGTGTGTGTGTATATGGGG - Intergenic
1131757366 15:95579808-95579830 AGTTTGTAAGTGTGTATAGGAGG + Intergenic
1131981830 15:98001997-98002019 TGTGTGTATGTGTGTATATGTGG + Intergenic
1132379170 15:101354240-101354262 GATATGTATGTGTGTATATGTGG - Intronic
1133463740 16:6009821-6009843 TGTGTGTGTGTGTGTATAGGGGG + Intergenic
1133810944 16:9160622-9160644 AGTACGTATGTGTTTATAGAGGG + Intergenic
1134920944 16:18115794-18115816 AGTATGTATGTGGCCCAAGGTGG + Intergenic
1137766445 16:50981170-50981192 AATTTGTATGTGGGTAAAGCAGG + Intergenic
1138152650 16:54672971-54672993 AGTATGTGTGTGTGTATGGAGGG + Intergenic
1138976665 16:62215850-62215872 AATATGTGTGTGTGTATATGTGG + Intergenic
1140036665 16:71376499-71376521 TGGATGTATGTGGGTATATGTGG - Intronic
1141265495 16:82493471-82493493 AGTGTGTATGTGTGTAGAGTGGG + Intergenic
1142909536 17:3076215-3076237 AGTAGGTATGTGTATATATGAGG + Intergenic
1142956110 17:3523888-3523910 TGTATGTGTGTGTGTGTAGGTGG - Intronic
1144227046 17:13159407-13159429 AGTGTGTATGTGAGCTTAGGGGG - Intergenic
1144263903 17:13549688-13549710 AGTCTGTATGGGGGTTTAGGGGG - Intronic
1144460434 17:15454315-15454337 TGTATGTATGTGGCTGCAGGTGG - Intronic
1146050373 17:29546723-29546745 TGTCTGTATGTGTGTATAGATGG + Exonic
1146223231 17:31044526-31044548 AATATGTATGTAGGTAAATGGGG + Intergenic
1146341766 17:32025460-32025482 AATATGTATGTAGGTAAATGGGG - Intronic
1146351038 17:32094171-32094193 AATATGTATGTAGGTAAATGGGG + Intergenic
1148173563 17:45544912-45544934 AATATGTATGTAGGTAAATGAGG + Intergenic
1148275707 17:46300537-46300559 AATATGTATGTAGGTAAATGAGG - Intronic
1148297817 17:46518113-46518135 AATATGTATGTAGGTAAATGAGG - Intronic
1148362365 17:47022594-47022616 AATATGTATGTAGGTAAATGGGG - Intronic
1149400145 17:56287628-56287650 ATTCTGCATCTGGGTATAGGTGG + Intronic
1149633685 17:58148773-58148795 AGTATGTATGTGGGAGGCGGGGG - Intergenic
1150404769 17:64891827-64891849 AATATGTATGTAGGTAAATGAGG + Intronic
1152426902 17:80222956-80222978 TGTATGTGTGTGTGTGTAGGTGG + Intronic
1153492958 18:5668806-5668828 GGTATGTGTGTGAGTGTAGGTGG + Intergenic
1155101513 18:22614977-22614999 AGTCTGTATGTGTGTCGAGGAGG - Intergenic
1155317008 18:24582026-24582048 TGTATGTATGTGGATATGGCAGG + Intergenic
1156870549 18:41940318-41940340 TGTATGTATGTGGGTTTGGGTGG + Intergenic
1158503222 18:58022287-58022309 AGAATGTATGGGGGTGTATGTGG + Intergenic
1159443903 18:68516418-68516440 TGTGTGTGTGTGTGTATAGGTGG - Intergenic
1166781208 19:45344644-45344666 AGTGTGTTTGTGTGTATATGAGG + Intronic
1167116128 19:47490008-47490030 TGTGTGTGTGTGGGTATGGGGGG + Intronic
1168060296 19:53888234-53888256 AATATATATTTGGGTAGAGGAGG - Intronic
925029741 2:640948-640970 AGTATGTATGTGTGTTTATATGG - Intergenic
925988745 2:9236666-9236688 TGTATGTATGTATGTGTAGGTGG + Intronic
926165197 2:10518482-10518504 GGTATGTATGTGGGTCTGTGTGG - Intergenic
926581019 2:14633064-14633086 TGTATGTGTGTGGGTGTGGGTGG - Intronic
926719008 2:15944975-15944997 TGTATGTATGTATGTATGGGGGG + Intronic
928783337 2:34851307-34851329 AGTATGTAAGTGAGAATATGAGG - Intergenic
929011337 2:37447937-37447959 AGTAGGTGTGTGGGTATGGGTGG + Intergenic
929021151 2:37554560-37554582 AGTAAGTATGTGTGTATGGGGGG + Intergenic
930374063 2:50541701-50541723 AGTGTGTGTGTGGGTGTGGGTGG - Intronic
931503135 2:62893703-62893725 GGTTTGGAGGTGGGTATAGGTGG + Intronic
931937356 2:67214030-67214052 GGTGTGTATGTGTGTGTAGGGGG - Intergenic
932372206 2:71199871-71199893 TGTATGTGTGTGGGTGTTGGAGG + Intronic
932568305 2:72923470-72923492 AGTGTGTGTGTTGGGATAGGGGG + Intronic
933253708 2:80057237-80057259 AGTATCTATTTGGGTATGGCAGG - Intronic
933359394 2:81259657-81259679 AGTACATATGTGGGTAGAGGAGG - Intergenic
933851655 2:86372276-86372298 TGTGTGTGTGTGAGTATAGGGGG - Intergenic
934550622 2:95259302-95259324 AGTGTGTATGTGTGTATTTGGGG + Intronic
934748008 2:96772200-96772222 AGTGTGTGTGTGAGCATAGGTGG - Intronic
935199242 2:100841661-100841683 TGTATGTATGTGTGTGTAGATGG - Intronic
935716740 2:105945918-105945940 TGTGTGTGTGTGGGTGTAGGGGG + Intergenic
935837729 2:107073780-107073802 AATATGTATGTGAGTATTTGAGG - Intergenic
939164366 2:138624406-138624428 AGTATGTATATGCATATAGGTGG + Intergenic
939606409 2:144260324-144260346 TGTATGTGTGTGGGTATTTGTGG + Intronic
939996818 2:148927497-148927519 TGTGTGTGTGTGTGTATAGGGGG + Intronic
940072999 2:149710543-149710565 AATATTTAAGTGGATATAGGTGG - Intergenic
940536622 2:154953667-154953689 ACTGTCTATGTGGGTATAGGGGG + Intergenic
941285955 2:163612104-163612126 ATTGTGTATGTGCGTATAGTAGG - Intronic
942022168 2:171876677-171876699 AGTGTGTATGTGTGTGTGGGGGG - Intronic
943706101 2:191036381-191036403 AGTATGTGTGTGGGGAGAGGGGG - Intronic
945004842 2:205393854-205393876 CGTATGTATGGGAGTCTAGGAGG + Intronic
945644705 2:212476113-212476135 AGTATGTATGTGTGTTTGGTGGG - Intronic
946381905 2:219354615-219354637 AGTATGTGTGTGGGGGTGGGAGG + Intergenic
947003804 2:225487824-225487846 AATCTGTATGTGGGTGTGGGTGG - Intronic
948544092 2:238713976-238713998 GGTGTGTATGTGTGTATATGTGG - Intergenic
948569475 2:238908717-238908739 AGTGTGTGTGTGGGTATGTGGGG + Intronic
948985474 2:241520018-241520040 AGTGAGTATGTGGGAATAGGAGG - Intergenic
1169780480 20:9304222-9304244 TGTATGTATGTGTGTGTGGGGGG + Intronic
1170082133 20:12488175-12488197 TGTATGTATGTGAGTATGTGTGG + Intergenic
1171390330 20:24797665-24797687 TGCATGTATCTGGGTATAGCTGG + Intergenic
1173547847 20:43913383-43913405 AGTATGTGTGTGTGTGTAGGGGG + Intergenic
1174498849 20:50969449-50969471 AGTATGTGTGTGGGAAAGGGTGG - Intergenic
1175050036 20:56146698-56146720 TGTATGTATGTGTGTGTGGGGGG - Intergenic
1178134191 21:29608204-29608226 AGAATGTATGTGTCTCTAGGGGG + Intronic
1178347263 21:31841112-31841134 AGTATATATGTGGGTTGGGGAGG - Intergenic
1178734702 21:35138401-35138423 TGTGTGTGTGTGTGTATAGGAGG + Intronic
1184966888 22:47982939-47982961 ATTATGCAAGTGGGTATATGAGG - Intergenic
1185065711 22:48630871-48630893 ACTGGGTATCTGGGTATAGGGGG - Intronic
951259105 3:20485369-20485391 AGTGTGTATGTGGGGAGAGGGGG + Intergenic
953778108 3:45840706-45840728 ATTGTGTATGTGTGTTTAGGGGG + Intronic
954605724 3:51907676-51907698 AGTATGTGTGTGTGTGTTGGTGG - Intergenic
955056085 3:55457279-55457301 AGTATGTGAGTGTGTATAGAAGG + Intergenic
955362023 3:58283821-58283843 AATAGATATGTGGGTACAGGTGG + Intronic
956749974 3:72337565-72337587 GGTGTGTATGTGTGTATATGTGG + Intergenic
956978174 3:74606479-74606501 AGTATGTATGTGTGAATGGGTGG + Intergenic
957285523 3:78212671-78212693 TATATGTGTGTGTGTATAGGGGG - Intergenic
958612600 3:96446730-96446752 AGTGTGTATGTGTGTGTGGGGGG - Intergenic
959342843 3:105152499-105152521 TGTATGTATGTGTGTATAAATGG - Intergenic
963597410 3:147345848-147345870 AATATGTATGTGTGTGTTGGGGG - Intergenic
963699248 3:148603313-148603335 TGGATGTATGTGTATATAGGAGG + Intergenic
964116067 3:153137538-153137560 AGTCTGTATGTGTATACAGGAGG + Intergenic
964460335 3:156918215-156918237 AGTATGTAGATATGTATAGGAGG + Intronic
965542833 3:169887651-169887673 AGTATGTATGTGTGTGGAGAGGG - Intergenic
966759251 3:183402099-183402121 AGTAAGTTTGTGGGGATGGGGGG + Intronic
969212724 4:5700186-5700208 TGTATGTGTGTGGGCAGAGGAGG + Intronic
969575698 4:8034743-8034765 AGTAGGTAGGTGGGTGCAGGTGG + Intronic
970154248 4:13125576-13125598 AGTATGTGTGTGGGGGAAGGAGG - Intergenic
970169443 4:13275085-13275107 AGTATGTATGTGTGTATAGTGGG - Intergenic
970258919 4:14202884-14202906 AGTAAGTAGGTGGTAATAGGTGG - Intergenic
971001363 4:22326459-22326481 AGTGTGTGTGTGTGTGTAGGAGG + Intergenic
971547257 4:27901950-27901972 AGTATGTATGAGAGTATCTGAGG + Intergenic
972281377 4:37605258-37605280 TGTATATATGTGTGTACAGGGGG + Intronic
972481633 4:39502590-39502612 AGTATGTATATGGGGATAGGAGG - Intronic
972759578 4:42089865-42089887 ACTATGTGTGTGTGTGTAGGAGG - Exonic
977885397 4:102247358-102247380 CGTATGTGTGTGTGTATAGTAGG - Intergenic
978477709 4:109149977-109149999 TGTATGTATGTGTGTATGTGTGG + Intronic
979108173 4:116714708-116714730 AGTATGTATGTGTGTGTGTGTGG - Intergenic
980643525 4:135611481-135611503 AGTATGTATGGGCCTGTAGGAGG - Intergenic
981316846 4:143348976-143348998 AGTATGTCTGTGTGTACATGTGG - Intronic
981318667 4:143366623-143366645 CGTATGTATGTATGTATATGAGG - Intronic
981959895 4:150523830-150523852 AGTATGTATTTGTGTATAGATGG - Intronic
982864700 4:160495395-160495417 AGTGTGTATGTGTGTGTTGGCGG - Intergenic
983290340 4:165795292-165795314 AGTATGTGTGTGGGGAGAGATGG - Intergenic
984683288 4:182636368-182636390 ATTATGTTTGTGGGGAGAGGAGG - Intronic
987510184 5:18827425-18827447 AATATGTATCTGAGTACAGGAGG + Intergenic
988700739 5:33672119-33672141 TGTATGTATGTGGGTGTGTGTGG - Intronic
988993009 5:36689919-36689941 AGGATGAATGTGGATACAGGAGG - Intergenic
989960839 5:50413036-50413058 TGTATGTATGTGTGTATTGTTGG - Intronic
990466982 5:56079893-56079915 CATATGTGTGTGAGTATAGGAGG + Intergenic
990731909 5:58818055-58818077 GGGATGTATGTGGGAATATGAGG - Intronic
991662567 5:68965101-68965123 AGGATGTATGTGTGTATGTGAGG - Intergenic
991936233 5:71803604-71803626 GGTATGTCTTTGGGAATAGGAGG + Intergenic
994593617 5:101804668-101804690 AGTATGGAATTGGGGATAGGTGG + Intergenic
994936944 5:106266551-106266573 TGTGTGTATGTTTGTATAGGGGG + Intergenic
995722144 5:115147900-115147922 AATATGTATATGTATATAGGTGG - Intronic
996517194 5:124383584-124383606 AGTATGTAAGTTGGTATACTTGG - Intergenic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
999298990 5:150478814-150478836 AGTATGTATGTATGTAGAGACGG + Intergenic
999553243 5:152713540-152713562 TGTATATATGTGTGTATAGATGG + Intergenic
1000703186 5:164478299-164478321 ACTATGTAAGTTGGTAGAGGAGG + Intergenic
1000839231 5:166195974-166195996 AGTATTTATGTGAGTATTGGTGG + Intergenic
1001428846 5:171643891-171643913 TGTATGTGTGTGTGTGTAGGGGG + Intergenic
1001567301 5:172707761-172707783 AGTGTGTATGTGAGTGTGGGGGG + Intergenic
1004163164 6:13232451-13232473 AGTATGTATGTGTGTGTGGCAGG - Intronic
1005371376 6:25137171-25137193 TGTGTGCATGTGTGTATAGGAGG - Intergenic
1006463147 6:34175656-34175678 GGAAGGTATGTGGGTATAGAAGG + Intergenic
1007915455 6:45557270-45557292 AGAAAGTATGAGGGTTTAGGAGG - Intronic
1007972363 6:46065933-46065955 AGTATGTATGTTGCTTTATGGGG - Intronic
1009352540 6:62700159-62700181 AGTATGTATGTTTGTATTGTCGG - Intergenic
1010103391 6:72138089-72138111 TGTATGTATATGTGTATAGACGG + Intronic
1012710077 6:102588326-102588348 AGTATGTACGTGTGTATACATGG + Intergenic
1013842252 6:114411231-114411253 GGTATGTGTGTGGTTATTGGTGG - Intergenic
1014365831 6:120540549-120540571 AGTATGTATGAGAGTAGAGGTGG + Intergenic
1014915344 6:127140332-127140354 AGTGTGTGTGTGGGAATAAGTGG - Intronic
1014973985 6:127855737-127855759 AGTATCTTTGTGGCGATAGGGGG + Intronic
1015380470 6:132561510-132561532 AGTGTGTATGTGGGTGGAGGAGG + Intergenic
1016525973 6:145002046-145002068 GGTGTGTGTGTGTGTATAGGTGG - Intergenic
1020483212 7:8688386-8688408 AGTATATATCTGGGTAAATGTGG + Intronic
1021951942 7:25783571-25783593 AGTATGTACGTGTGTGTATGGGG - Intergenic
1024178321 7:46863108-46863130 AGTATGTATGTGGACATGGGAGG - Intergenic
1024524248 7:50335318-50335340 GGTGTGTATGTGTGTATGGGAGG + Intronic
1027359495 7:77393528-77393550 GGTGTGTATGTGTGTATGGGAGG - Intronic
1027765094 7:82329822-82329844 ATTATGAATGTGGGTTTAGAGGG + Intronic
1027858585 7:83545412-83545434 AGTAGGTATTTGGGGATTGGGGG - Intronic
1028590480 7:92488161-92488183 AGGATGTATGTGGATAAAGGGGG + Intronic
1029809429 7:103033063-103033085 TGTATGTGTGTGTGTATGGGGGG - Intronic
1030820817 7:114088125-114088147 AGTGTGTATGTGTGTGGAGGGGG - Intronic
1032341561 7:131078717-131078739 AGTATGTGTGTGTGTAGCGGGGG - Intergenic
1032807904 7:135375953-135375975 TGTGTGTATGTGTGTACAGGGGG + Intronic
1034144907 7:148861013-148861035 AGTATCCATGGGGGTCTAGGGGG + Intronic
1034427813 7:151023852-151023874 GGTATGTGTGTGGGTGTGGGTGG - Exonic
1034858971 7:154580195-154580217 AGTATGTGTGTGTGTGTAAGGGG - Intronic
1035295773 7:157866390-157866412 TGTATGTATGTGTGTACATGTGG - Intronic
1035877398 8:3206349-3206371 TGTGTGTATGTGTGTATTGGGGG + Intronic
1035877417 8:3206526-3206548 TGTATGTATGTGTGTGTGGGAGG + Intronic
1035928621 8:3757166-3757188 AGAGTGGATGTGGGTGTAGGTGG - Intronic
1037444597 8:18952198-18952220 AGTAGGCATGTGGGTAGGGGAGG - Intronic
1038590299 8:28831531-28831553 AGTATGAATGAGGCTAAAGGAGG - Intronic
1038908415 8:31934381-31934403 TGTGTGTATGTGTGTGTAGGGGG - Intronic
1039086394 8:33784286-33784308 AAAATGTATGTGTGTATAGAGGG - Intergenic
1039492386 8:37957757-37957779 AAAATGTATCTGGGTATTGGTGG - Intergenic
1040114659 8:43602566-43602588 AGTTTTTATCTGGGGATAGGTGG - Intergenic
1042449557 8:68928752-68928774 AGTATGTTTGTTGGGATAGATGG + Intergenic
1042740979 8:72046086-72046108 AATATGTAGGTGGATAGAGGTGG + Intronic
1045164124 8:99583787-99583809 AAAATGCATGTGGGTAAAGGGGG + Intronic
1045710945 8:104983244-104983266 TGTATGTATGTGTGTCTATGGGG + Intronic
1046416782 8:113926419-113926441 AGTATATATATGGGAATATGTGG - Intergenic
1047488685 8:125356219-125356241 TGTATGTCTGTGTGTATGGGGGG + Intronic
1047540206 8:125757637-125757659 AATATGTAATTGGCTATAGGGGG + Intergenic
1047726263 8:127686608-127686630 TATATGTATGAGGGTATAGGAGG + Intergenic
1048084711 8:131164298-131164320 AGTATTTCTGTGAGTATATGGGG + Intergenic
1050816632 9:9821150-9821172 AGTATTTTTGTGTGTATACGTGG + Intronic
1053407475 9:37890034-37890056 TGTATGTGTGTGTGTATATGAGG + Intronic
1053504384 9:38628980-38629002 GGTATGTATGTTAGTGTAGGTGG - Intergenic
1055066869 9:72127690-72127712 AGTATGTCTGTGGGTTTAGTTGG + Intronic
1055295030 9:74825482-74825504 TGTATGTGTGTGTGTATAGGTGG + Intronic
1055826781 9:80336554-80336576 AGTGCGTATGTGGGGACAGGTGG + Intergenic
1056105035 9:83338890-83338912 AGCGTGTATGTGTGTAAAGGTGG - Intronic
1056573492 9:87836412-87836434 AGTTTGTATGTGGAGAGAGGGGG - Intergenic
1056740824 9:89253678-89253700 AGTGTGTATGTGTGTTTATGCGG + Intergenic
1058844256 9:108940236-108940258 CGTATGGATTTGGGTATATGTGG + Exonic
1059328355 9:113518459-113518481 AGTAGGTATGTGTGTATTTGAGG + Intronic
1060022659 9:120145826-120145848 TGTGTGTATGTGTGTATAAGTGG + Intergenic
1062077164 9:134595941-134595963 AGTGTATATGTGTGTATATGTGG - Intergenic
1062454921 9:136631520-136631542 AGCATGTATGTGTGTATGTGTGG - Intergenic
1185494178 X:541845-541867 AATAGGTATGTGCGTCTAGGAGG + Intergenic
1185808566 X:3082895-3082917 TGTATATATGTGTGTGTAGGTGG - Intronic
1186947954 X:14590377-14590399 TTTATGTATGTGGGTAGAGTTGG - Intronic
1187001192 X:15180469-15180491 TGTATGTATGTGTATATAGATGG - Intergenic
1188590573 X:31829351-31829373 AGTAGTTTTGGGGGTATAGGTGG - Intronic
1188598093 X:31926013-31926035 AACATGCATGTGGGTGTAGGAGG - Intronic
1188867825 X:35335787-35335809 TGTATTCATGTGGGTATAGATGG - Intergenic
1189074000 X:37896952-37896974 TGTATGCATGTGTGTAGAGGAGG + Intronic
1192388952 X:70704663-70704685 GATATGTAACTGGGTATAGGAGG - Intronic
1193699790 X:84747007-84747029 AGGGTGTATGTGGGTAAAAGTGG + Intergenic
1194806311 X:98332506-98332528 TGTATGTCTGTGGGTATGTGTGG + Intergenic
1195072565 X:101294253-101294275 AGCATCTCTGTGGGTAGAGGAGG + Intergenic
1195335500 X:103849280-103849302 TGTACGTATGTGGGTGTGGGGGG + Intergenic
1197478724 X:126955783-126955805 TGTATGTATGTGTGTAGAGATGG - Intergenic
1199623239 X:149717336-149717358 AATATGTATGTGGGGGGAGGGGG - Intergenic
1201293442 Y:12443857-12443879 TGTGTGTATGTGGGGATATGTGG - Intergenic