ID: 1126049505

View in Genome Browser
Species Human (GRCh38)
Location 15:44673464-44673486
Sequence GTGAAGTTCTTGAGGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126049505_1126049511 10 Left 1126049505 15:44673464-44673486 CCTTTTCCCCTCAAGAACTTCAC 0: 1
1: 0
2: 3
3: 21
4: 237
Right 1126049511 15:44673497-44673519 GCCATCTTGTGAGTCCCTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 132
1126049505_1126049513 19 Left 1126049505 15:44673464-44673486 CCTTTTCCCCTCAAGAACTTCAC 0: 1
1: 0
2: 3
3: 21
4: 237
Right 1126049513 15:44673506-44673528 TGAGTCCCTCAAGGCAGCTTTGG 0: 1
1: 0
2: 1
3: 9
4: 148
1126049505_1126049514 20 Left 1126049505 15:44673464-44673486 CCTTTTCCCCTCAAGAACTTCAC 0: 1
1: 0
2: 3
3: 21
4: 237
Right 1126049514 15:44673507-44673529 GAGTCCCTCAAGGCAGCTTTGGG 0: 1
1: 0
2: 0
3: 15
4: 141
1126049505_1126049515 21 Left 1126049505 15:44673464-44673486 CCTTTTCCCCTCAAGAACTTCAC 0: 1
1: 0
2: 3
3: 21
4: 237
Right 1126049515 15:44673508-44673530 AGTCCCTCAAGGCAGCTTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 183
1126049505_1126049516 22 Left 1126049505 15:44673464-44673486 CCTTTTCCCCTCAAGAACTTCAC 0: 1
1: 0
2: 3
3: 21
4: 237
Right 1126049516 15:44673509-44673531 GTCCCTCAAGGCAGCTTTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126049505 Original CRISPR GTGAAGTTCTTGAGGGGAAA AGG (reversed) Intronic
903094525 1:20957216-20957238 TTAAAGTTCTTGGGGGCAAAAGG + Intronic
903284835 1:22270074-22270096 GTGAAGCTCTGGAGGGAACATGG - Intergenic
904299049 1:29542393-29542415 GTCAAGGTCATGAGGGGCAAGGG - Intergenic
904686440 1:32264231-32264253 GTCAAATTTTTGATGGGAAATGG + Intronic
904701881 1:32362593-32362615 ATGAAGTCCTTGGGGAGAAAAGG + Exonic
905394656 1:37659380-37659402 ATGAAGTTTTTAAGGGCAAATGG - Intergenic
906121293 1:43393201-43393223 GTGAAGATCTTCAGGTGAGAAGG + Intronic
906250272 1:44305735-44305757 GTGAAGCTGCTGAGGGGAGAAGG + Intronic
907809267 1:57852170-57852192 ATGAGGATCTTCAGGGGAAAAGG - Intronic
909190945 1:72550423-72550445 ATGAAGTTTTTGGGGGCAAAGGG - Intergenic
909552187 1:76910959-76910981 ATGAAATTCTAGAGGCGAAAGGG - Intronic
911897707 1:103458860-103458882 TTGAAATTGTTGAGGGGCAAAGG - Intergenic
912825976 1:112903623-112903645 GTGAACTTCTTGAGATGAGAGGG - Intergenic
914786682 1:150839490-150839512 ATGAAGTCCTTGCGGGGAACTGG - Exonic
915625963 1:157114352-157114374 GTGAAGCTCTTGAAGGCCAAGGG - Intergenic
917213180 1:172651059-172651081 GAGAAACTCTTGAGGGGAGAAGG + Intergenic
920540710 1:206775922-206775944 GTGAGCTTCTTGAGGCCAAAAGG + Intergenic
920801368 1:209190844-209190866 GTGCAGTTCTTTGTGGGAAAGGG + Intergenic
921943986 1:220873923-220873945 GCCAATTTCTTCAGGGGAAATGG - Intergenic
921950878 1:220928533-220928555 GTCATGGTCTTTAGGGGAAAAGG + Intergenic
923136304 1:231123193-231123215 GTGAAGGCCTGGAGGGGGAAGGG - Intergenic
924402142 1:243695599-243695621 GAAAAGTTGTTGAGGGGATAAGG + Exonic
924461518 1:244263692-244263714 GTGAAGTACTTAGGGGTAAAAGG + Intergenic
1064971392 10:21070747-21070769 TTGAATTTCTTCAGGGGATAAGG + Intronic
1064973394 10:21088974-21088996 GTGAAGCTCTAGAGGGGAGATGG + Intronic
1067231344 10:44413116-44413138 GTGAAGTGGATGAGGGGAGATGG + Intergenic
1067574214 10:47397826-47397848 GTGATGTTTTTGTGGGGGAAAGG - Intergenic
1067743821 10:48917734-48917756 AGGAAGTTCTTCAGGTGAAAGGG + Intronic
1068063032 10:52093521-52093543 GTGAACTTCTTTACAGGAAAAGG + Intronic
1068540956 10:58294500-58294522 GTTATGTTTTTGAAGGGAAATGG + Intergenic
1070766762 10:79061333-79061355 GTGAAGGTCTTGTGGGGGAAAGG - Intergenic
1070839826 10:79476823-79476845 CTGAAGGTGATGAGGGGAAAAGG + Intergenic
1071996954 10:91158949-91158971 GTGAAGTTCCAGGGGAGAAAGGG - Intergenic
1072402284 10:95116990-95117012 GAGAAGTTTTTGAGGTGCAAAGG - Intergenic
1074902553 10:117831495-117831517 GAGAAGTCCTGGACGGGAAAGGG - Intergenic
1077635705 11:3840510-3840532 GAGAAGTGCGTGAGGGGAGAGGG - Intronic
1077936805 11:6796755-6796777 TTGAAGTTTTTAAAGGGAAAGGG - Intergenic
1078011721 11:7577477-7577499 TTGGAGTTCTTGAGGGGGGAGGG + Intronic
1078312173 11:10255413-10255435 GTCAAGTTCTTTGGGGGAAATGG + Intronic
1079729918 11:23927658-23927680 GTGAAGTTATTGAGGGGGCTAGG - Intergenic
1080708248 11:34719952-34719974 GTGAAGTTCTTGAGTGGTGAGGG + Intergenic
1081207915 11:40295773-40295795 GTGAATTTCTCGAGGGTTAATGG + Intronic
1081552490 11:44126934-44126956 CTGAAGTTCTTGACTGGAAGAGG + Exonic
1081589600 11:44412033-44412055 GTGATGTCCTTCAGGGGAACGGG - Intergenic
1086403529 11:86480736-86480758 CTGAAGTTCCTCAGGGCAAAGGG + Intronic
1089034213 11:115368953-115368975 GTGCAGTTCTAGAGGGGAAGAGG + Intronic
1090242764 11:125195665-125195687 GTGAAGTTCTTGTGGGGCAAGGG + Intronic
1091387454 12:103842-103864 GTGGAGTTCATGAGGGGAGGCGG + Intronic
1091444161 12:534097-534119 GTGAAGCTGTTGAGGGAAAGGGG + Intronic
1091597940 12:1891241-1891263 GTGAAGTTTTTCTGGGGACAAGG - Intronic
1092742737 12:11645977-11645999 GTGAAGTTCTTGAGGCCAAAGGG + Intergenic
1093165977 12:15804733-15804755 GTGGGGTTGTTGAGGGGAAGGGG - Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1096668123 12:53180683-53180705 GGGAAGTGCTTCCGGGGAAACGG + Exonic
1100485377 12:95020623-95020645 GTGAAGTTTTTGTGGGGATGTGG - Exonic
1101148307 12:101862556-101862578 GTGTAGTTCTTGCTGGGAAGAGG - Intergenic
1102346168 12:112162679-112162701 GAGATGTTCTTGGAGGGAAAAGG + Intronic
1104171933 12:126290848-126290870 GTGGAGTTCTTCAAGGGAAGAGG - Intergenic
1105412319 13:20180917-20180939 GTCAAGTTATTTAGGGGAGAAGG - Intergenic
1108544763 13:51481785-51481807 TTGAAATTCTTAAGAGGAAAAGG + Intergenic
1109614568 13:64813964-64813986 GTGAAGTTGTTGTTGGAAAACGG + Intergenic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1111463895 13:88582281-88582303 ATGAAGATCATGAGGTGAAATGG - Intergenic
1113460106 13:110476291-110476313 GTGAAGAGCTCCAGGGGAAATGG - Intronic
1118006819 14:61570651-61570673 GTCAAATGCTTTAGGGGAAACGG + Exonic
1118042314 14:61930588-61930610 GTGAACATCTTGAGGGGATGTGG - Intergenic
1118405518 14:65419770-65419792 CTGAAATTCTTGAGGCCAAAAGG + Intronic
1120242603 14:81966647-81966669 GTGAAGATTTTGAGGGTAGAGGG + Intergenic
1121005206 14:90486121-90486143 GTGAAGAACTAGAGGGGAGAGGG + Intergenic
1122618628 14:103039571-103039593 GTTAAGTTTTTGATGTGAAAGGG - Intronic
1124063492 15:26318107-26318129 GTGAAGTCCCTGTGGGGAGATGG + Intergenic
1124948913 15:34298094-34298116 CTGAACTTCTTGAGAGCAAATGG - Intronic
1125703646 15:41711399-41711421 GCGAGGTTAGTGAGGGGAAATGG + Intronic
1125815032 15:42576558-42576580 GTTAAGTTTTGGTGGGGAAAGGG + Intronic
1126049505 15:44673464-44673486 GTGAAGTTCTTGAGGGGAAAAGG - Intronic
1127341545 15:58049996-58050018 GTGTGGGTCTTGAGGGGGAAGGG + Intronic
1128276299 15:66356594-66356616 ATGAAGTTCTTGCGGGGAGAGGG - Intronic
1129821609 15:78605941-78605963 GGCAAGTTCTTGGGGGGAATAGG - Intronic
1131123250 15:89836401-89836423 GGGAAGTTCTTAAAAGGAAAAGG + Intronic
1132057234 15:98661643-98661665 GTGAATTGTTTGAGGGGACAAGG - Intronic
1133483989 16:6200671-6200693 GTGAACTTCTTCAAGGTAAAGGG - Intronic
1137345203 16:47651277-47651299 GTGAAGTTCTGAATGGAAAAAGG - Intronic
1138503066 16:57460580-57460602 GTCAAGTTCTTGAGCTGACACGG - Exonic
1139656249 16:68388734-68388756 GAGGGGTTCCTGAGGGGAAATGG + Intronic
1139908654 16:70383087-70383109 CTGAGGTTCTGCAGGGGAAATGG + Intronic
1141567633 16:84913938-84913960 GTGAAGTTTTTATGGGGAATAGG - Intronic
1143712646 17:8744946-8744968 CAGAAGTTCCTGAGGGCAAAGGG - Intronic
1144098092 17:11919911-11919933 GTGAAATTCATGAGTGGACATGG + Intronic
1145127426 17:20313904-20313926 CTGAAGTCCTTGAGGGGAAGGGG + Intronic
1147450841 17:40502849-40502871 GTGAGTTTCTTGAGTGGAAGGGG + Intergenic
1147680772 17:42243499-42243521 GTCAAGTATTTGAGGGTAAATGG + Intronic
1147713566 17:42488416-42488438 TGGAAGTTCTTTAGGGGTAAAGG + Intronic
1148290987 17:46449207-46449229 GTGAAGTTCATCAGTGGAATGGG + Intergenic
1148313176 17:46666912-46666934 GTGAAGTTCATCAGTGGAATGGG + Intronic
1150800352 17:68276967-68276989 GTGAAGTCCTTTAGGGAAACAGG + Intronic
1152014889 17:77744185-77744207 GCGAAGTTCATGAGGGTAGAGGG + Intergenic
1152032730 17:77854088-77854110 GGGAAGTGACTGAGGGGAAAAGG + Intergenic
1152975871 18:217827-217849 GTGAAGGTCCTGACAGGAAAGGG + Intronic
1153796130 18:8623945-8623967 ATGAGGCTCTTGAGGGGAAGTGG - Intronic
1153882580 18:9434134-9434156 GAGAATTTCTGGAGTGGAAAAGG + Intergenic
1157214581 18:45772087-45772109 GTAAGGTTCTTGTGGGGAAGTGG - Intergenic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1159763480 18:72457163-72457185 GGGAAGTTGTTGAGGAGAGAAGG + Intergenic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1166881605 19:45933766-45933788 GTGAAGTCGCCGAGGGGAAAGGG + Exonic
1167180947 19:47903117-47903139 GTGCAGGGATTGAGGGGAAAGGG - Intergenic
1167700134 19:51038522-51038544 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1168271472 19:55252121-55252143 GCGAAGTTCCTGAAAGGAAAGGG + Intronic
928151314 2:28832365-28832387 ATGAAGTTGGTGAGGTGAAAAGG - Intronic
930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG + Intergenic
931225353 2:60324682-60324704 GTGAAGGCCTTGATGGGAAGTGG - Intergenic
931243763 2:60476121-60476143 GTCAAGGTCATGAGGGGAACAGG - Intronic
931517886 2:63060292-63060314 GTGAAGTGCTTTAAGGGTAAGGG + Intergenic
932592764 2:73076988-73077010 ATGGAGGTCTTGAAGGGAAAGGG - Intronic
932959715 2:76398301-76398323 GTGCAGTTCATGATGGGAAGGGG + Intergenic
933308953 2:80636963-80636985 GAGAAGTTCATGAGGGGAATAGG - Intronic
936484254 2:112913242-112913264 GAGAAATTCTGGAAGGGAAAAGG + Intronic
937770545 2:125715633-125715655 GTGAACTACTAGAGGGGAGAGGG + Intergenic
938472363 2:131576307-131576329 GTGAAGTTTTTGCAAGGAAAAGG - Intergenic
938768797 2:134482383-134482405 GTGTTGGTCTTTAGGGGAAAGGG - Intronic
939232907 2:139454176-139454198 GTGAAGTTTTTCTGGGGACAGGG + Intergenic
939450294 2:142364901-142364923 GTGAAGATCTGGAGGAGAAATGG + Intergenic
939525331 2:143287041-143287063 CTAAAGTTCTAGAGGTGAAATGG + Intronic
939940137 2:148339377-148339399 TTGAAGGACTTGAGGGCAAAGGG - Intronic
941065049 2:160892446-160892468 ATCAAGTTCTTGAGGGGAGGAGG - Intergenic
941875612 2:170429900-170429922 GAGAAGCTCTTGGGGGGAAGGGG - Intronic
942098714 2:172557024-172557046 GTGAAGGCGATGAGGGGAAAAGG + Intronic
944828635 2:203510367-203510389 TTGAGGTTCTTGAGGGTAATAGG + Intronic
944906745 2:204269489-204269511 GTGAAGTTTTGGAGGGGAAAAGG + Intergenic
946254105 2:218430710-218430732 ATGAAGTTCTGGAAGAGAAAGGG - Exonic
1168833034 20:857758-857780 GTGAAGGACGTGAGGGGAGAGGG + Intergenic
1169959642 20:11144892-11144914 GTGAAGTTTTTAAGGGGCCAAGG + Intergenic
1170718162 20:18850036-18850058 GTGAAGGTATTGACTGGAAAAGG - Intergenic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172849475 20:37950414-37950436 TTTAAGTTTTTGAGGGGACAGGG + Intergenic
1173044605 20:39497579-39497601 GCGTAGCTCTGGAGGGGAAATGG + Intergenic
1173327003 20:42043053-42043075 GCCAAGTTCTTGGGTGGAAATGG + Intergenic
1178195198 21:30337026-30337048 GTGAAGATCTGTAGGGGAGATGG - Exonic
1179394410 21:41024858-41024880 GTGAGGTTCATGTGGGGAAGAGG - Intergenic
1183830204 22:40414764-40414786 ATGAAGTTCTGGAGCGGATAGGG + Intronic
952062815 3:29530976-29530998 ATTAAGCTCTTGAGAGGAAAGGG - Intronic
952579796 3:34819357-34819379 GTGAACTACTAGAGGGGGAAGGG - Intergenic
953920009 3:46945152-46945174 GAGAGGTTCTTGAAGGGAAGGGG - Intronic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
958929146 3:100190669-100190691 GTGAAGCCTCTGAGGGGAAATGG + Intronic
959781191 3:110235434-110235456 GTTAATTTCTTGAGTGGAAGAGG + Intergenic
961532217 3:127546865-127546887 CTGAAGTTCTAGGGGGAAAAAGG + Intergenic
961706261 3:128788251-128788273 GAGAAGCTCTTGAAGTGAAAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967544620 3:190710202-190710224 GTGAAGGTCTAGAGGGGAGTTGG + Intergenic
968922596 4:3530432-3530454 GTGAAGTTCTTCGGGGGTGAGGG - Intronic
969922844 4:10557237-10557259 GGGAGGTTCTGGAGGGCAAATGG - Intronic
971190494 4:24424032-24424054 GTAAAGATCTTGAGAAGAAATGG + Intergenic
972082305 4:35168315-35168337 CGGAAGTGCTTGAGGGGGAATGG + Intergenic
973713321 4:53650707-53650729 TTGAGGTTCTTGGGGGGACACGG - Intronic
974485016 4:62493771-62493793 ATGAAGAGCTTGATGGGAAATGG + Intergenic
975880415 4:78899321-78899343 GTGAAGTTCTTTTCTGGAAAGGG + Intronic
976106955 4:81629519-81629541 GTGAGGTTCTTGAGGACAAAGGG - Intronic
976554095 4:86430722-86430744 GTGAAGGCCCTGAGAGGAAAGGG + Intronic
980515159 4:133847676-133847698 ATGAAGGTCTTCAGGGGAGAAGG + Intergenic
981434598 4:144705820-144705842 GAGAAATGCTAGAGGGGAAAGGG - Intronic
981480712 4:145236196-145236218 GTGAAGTTCTAAGGGGGAAGAGG + Intergenic
983281586 4:165687607-165687629 GTGTAGTTCTGGCTGGGAAATGG + Intergenic
984842694 4:184082810-184082832 GTGAAGTAATTGAGGGAAAATGG + Intergenic
986944312 5:12996782-12996804 GTGTATTTCTTGAGGAGAGAAGG - Intergenic
990051502 5:51507092-51507114 TTGAAATTCTTGTGGGGAAGGGG - Intergenic
990052752 5:51528246-51528268 GTGAAGTTGTTGCGGGGAGAAGG + Intergenic
992752027 5:79870637-79870659 GTCTAGGTCTTCAGGGGAAATGG + Intergenic
993683659 5:90911206-90911228 GTGAAGTTCTTCAGGAAAAGGGG + Intronic
994799084 5:104347853-104347875 GTAAAGTTCTTTTTGGGAAAAGG - Intergenic
995742656 5:115370787-115370809 GTGAAATTTCTGAGCGGAAAAGG - Intergenic
998459126 5:142296386-142296408 GAGAAGCTCTCGAGGGGAAAAGG - Intergenic
998729308 5:145056110-145056132 ATAAAGTGCTTGAGGGGAATGGG - Intergenic
999635000 5:153612722-153612744 TTGAAGTTCTTCAGTGGAATGGG - Intronic
999971315 5:156866706-156866728 TTTAAGTTCTTGAAGGGAAAAGG + Intergenic
1000212556 5:159120789-159120811 GAGAATTTCTAGTGGGGAAAAGG + Intergenic
1000477550 5:161730024-161730046 GTGATGTTCTTGAGGGTTGAGGG + Intergenic
1001292541 5:170474253-170474275 GTGGAGTTCTTGGAGGGTAAGGG - Intronic
1002045786 5:176541179-176541201 GTGAGGTTCTATGGGGGAAATGG + Intergenic
1003245638 6:4379787-4379809 GAGAAATGCTTGAGAGGAAAAGG + Intergenic
1004231415 6:13837043-13837065 GTCATGTTCTTAAAGGGAAAAGG - Intergenic
1005010302 6:21329349-21329371 ATGAGGGTCTTCAGGGGAAAAGG - Intergenic
1005392842 6:25350671-25350693 TTAAAGTTCTTGAGGAGAGAGGG + Intronic
1007209543 6:40181251-40181273 ATGAAGGTCTTCAAGGGAAATGG - Intergenic
1007246939 6:40469832-40469854 GTGCAGCTCTTGGGGGGACAAGG - Intronic
1008828952 6:55734986-55735008 GTAAAGATCTTGGGGGAAAAAGG - Intergenic
1008958592 6:57243203-57243225 AGGCAGTTATTGAGGGGAAAGGG - Intergenic
1009168463 6:60369067-60369089 TTTAAGTTCATGAGGGGATAGGG - Intergenic
1011101938 6:83731852-83731874 ATGAAGATCTTCAAGGGAAAAGG + Intergenic
1013922359 6:115422089-115422111 ATGAAGTGCTTCAGGTGAAAAGG - Intergenic
1016805214 6:148205624-148205646 GTGAAGTTCTTCTGGGGACTAGG - Intergenic
1017504809 6:155058397-155058419 GTAAAACTCTTGAGGGTAAAGGG + Intronic
1018263164 6:161990199-161990221 GTGAAGCTTTTGTGGGGACAGGG - Intronic
1018567637 6:165172319-165172341 GTGAAGATCTTCAGGAAAAATGG - Intergenic
1018857543 6:167685505-167685527 GTTAACTTCTTCAGAGGAAAGGG - Intergenic
1019641389 7:2105631-2105653 GTGAAGGTTCTGAGGGAAAATGG + Intronic
1021227263 7:18042712-18042734 GTGAGGTTTTAGTGGGGAAATGG - Intergenic
1021251548 7:18333250-18333272 GTGAAGTTGGAGAGAGGAAATGG + Intronic
1021985249 7:26091933-26091955 TTAGAGTTATTGAGGGGAAAAGG - Intergenic
1022002846 7:26242573-26242595 ATGATTTTCTTTAGGGGAAAAGG - Intergenic
1023452152 7:40298244-40298266 GTGAGGTTAGTGAGGGGAAGAGG + Intronic
1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG + Intronic
1024728341 7:52226554-52226576 TTTAAATTTTTGAGGGGAAAAGG - Intergenic
1025307399 7:57874574-57874596 GTGATGTTTCTGTGGGGAAATGG + Intergenic
1025636558 7:63325036-63325058 GTGCTGGTATTGAGGGGAAAAGG + Intergenic
1025646138 7:63423066-63423088 GTGCTGGTATTGAGGGGAAAAGG - Intergenic
1025753980 7:64316363-64316385 GTGCTGATATTGAGGGGAAAAGG + Intronic
1028100583 7:86815134-86815156 GTTAATTTCTTAGGGGGAAAAGG + Intronic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1029837549 7:103328946-103328968 GTGAACTTCATGAATGGAAATGG + Intronic
1031748062 7:125530465-125530487 TTAATTTTCTTGAGGGGAAAAGG + Intergenic
1032483041 7:132262106-132262128 GTCAAGTTCAAGAAGGGAAAGGG - Intronic
1033416059 7:141162129-141162151 CTGCAGTTCCTGTGGGGAAACGG - Intronic
1033711600 7:143951675-143951697 GTGGAGTTTTTGAGGGGAGAGGG + Intergenic
1034373209 7:150619029-150619051 TGGAAGTTCTTCAGGGGCAATGG + Intergenic
1034506360 7:151495092-151495114 ATGAAGTTATTGAGAGAAAAAGG - Intronic
1035487009 7:159233843-159233865 GTAAAGGTTTTGAGGGGATAAGG + Intergenic
1036099444 8:5761847-5761869 AGCAAGGTCTTGAGGGGAAAAGG + Intergenic
1036918363 8:12827450-12827472 CTGAAGTTCTTTAAAGGAAAAGG - Intergenic
1037303842 8:17483890-17483912 GTGTAGTTCTTGAAGTGAAATGG - Intergenic
1038275068 8:26114609-26114631 GTGGAGTTCCTGAAAGGAAAAGG - Intergenic
1043376928 8:79660134-79660156 CTGAATTGCTTGAGAGGAAAGGG - Intronic
1044827741 8:96214421-96214443 GTCAAGACTTTGAGGGGAAATGG + Intergenic
1047572414 8:126113888-126113910 GTCAAGTTATTCATGGGAAATGG - Intergenic
1048201246 8:132375773-132375795 GTGAATTTCCAGAGGTGAAAAGG - Intronic
1048427847 8:134339143-134339165 GTGAAGACCAGGAGGGGAAAAGG - Intergenic
1049450663 8:142659819-142659841 GTGAAGTTGCTGAGGGCAGAGGG - Intronic
1049702843 8:144022946-144022968 GGGTAGGTCATGAGGGGAAAGGG - Intronic
1049703012 8:144023559-144023581 GGAAAGGTCGTGAGGGGAAAGGG - Intronic
1049703349 8:144024764-144024786 GGGTAGGTCTTGAGGGGAGAGGG - Intronic
1049834731 8:144727786-144727808 GTAAAGTTCTTGAAGGAAATTGG - Intronic
1050165536 9:2761071-2761093 GTGAAATTCATGAGGGGGATGGG - Intronic
1053458655 9:38251368-38251390 GTGGAGTTCTTATGGGGGAAGGG - Intergenic
1054843505 9:69768520-69768542 GTGAGGTTCATTAGGGGTAATGG + Intergenic
1057548942 9:96038118-96038140 GTGAAGTTCTTGTGTGGAGGAGG + Intergenic
1057565788 9:96164828-96164850 ATGACGTTCTTGAGAAGAAAAGG - Intergenic
1057938942 9:99263796-99263818 GTGAAGGTGTTGATGGAAAAAGG - Intergenic
1058409453 9:104715188-104715210 GTGAGATTGTTGAGGAGAAAGGG - Intergenic
1059359014 9:113724846-113724868 TTGAAGGCCTAGAGGGGAAAAGG - Intergenic
1060694152 9:125691820-125691842 GTAAAGTCCTTGAGAGGAAAGGG + Intronic
1060834270 9:126743233-126743255 GTGAAGGTCATGGGGGGAATTGG + Intergenic
1061102233 9:128500784-128500806 GTGAAGTGCTTGGGGGCAAGTGG - Exonic
1061471470 9:130829653-130829675 TTGAAGTATTTGAGGGAAAATGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186178698 X:6951654-6951676 TTGATGCTCTTGAGTGGAAATGG + Intergenic
1186323889 X:8458308-8458330 GTGAAGTTTTGGAGGGGCTAGGG - Intergenic
1187417238 X:19103900-19103922 TACAAGGTCTTGAGGGGAAAAGG + Intronic
1189701987 X:43721256-43721278 GTGAAGGCCTTGAGGTGAGAAGG + Intronic
1191882821 X:65859651-65859673 GAGAATTTCTTCAGGAGAAAGGG - Intergenic
1192948409 X:75990173-75990195 GTGAAATACCTGAGGTGAAAAGG - Intergenic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1194792037 X:98161857-98161879 GTAAGGTTTTTGAGGGGACAGGG + Intergenic
1195508004 X:105681108-105681130 ATGAAGGTCTTCAAGGGAAAGGG + Intronic
1196045792 X:111255054-111255076 GTGAAGGTCCTGAGGGGATCTGG + Intronic
1196410461 X:115412898-115412920 GTGAAGTTCTTGCTGACAAATGG + Intergenic
1196458243 X:115904804-115904826 GTGAAGTTCTGGAGACAAAAAGG - Intergenic
1196904653 X:120419409-120419431 TTGGAGTGCTGGAGGGGAAAGGG + Intergenic
1197720994 X:129744532-129744554 GTGGAGCTAGTGAGGGGAAACGG - Intronic
1198238575 X:134761102-134761124 CTTAGGTTTTTGAGGGGAAAAGG + Intronic
1199004282 X:142676554-142676576 GTGCAGCTCTTGTGGGCAAACGG - Intergenic
1199119384 X:144033125-144033147 GTGACATTTTTGAGGGGCAAAGG + Intergenic
1199722127 X:150549532-150549554 GTGAAGTCCTTGAGTGCAAAGGG + Intergenic