ID: 1126053655

View in Genome Browser
Species Human (GRCh38)
Location 15:44710166-44710188
Sequence GCATTTTCTTAGTTTAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126053653_1126053655 -9 Left 1126053653 15:44710152-44710174 CCATGGAGAGTATTGCATTTTCT 0: 1
1: 0
2: 0
3: 18
4: 262
Right 1126053655 15:44710166-44710188 GCATTTTCTTAGTTTAGGCATGG 0: 1
1: 0
2: 0
3: 32
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126053655 Original CRISPR GCATTTTCTTAGTTTAGGCA TGG Intronic
900199220 1:1396002-1396024 GCATTTTTTTAGTAGAGACAGGG - Intronic
902898142 1:19493825-19493847 GCATTTTCTGAATTGAGGCAAGG + Intergenic
905466190 1:38155483-38155505 GCATTATATTAGTTAAGGCAAGG + Intergenic
905523534 1:38618667-38618689 TAATTTTCTTGGTTTGGGCAGGG + Intergenic
906293302 1:44633727-44633749 GCATTCCCTTGGTGTAGGCATGG + Intronic
906404440 1:45530481-45530503 GCTTTTTTTTTGTTGAGGCAGGG - Intergenic
906421281 1:45669632-45669654 TCATTTTCTCAATTTTGGCAGGG - Intronic
907118137 1:51987716-51987738 GTAATTTCTTGGTATAGGCAAGG + Intronic
907733740 1:57092075-57092097 GCACTTTCTTATTCTAGGCCAGG - Intronic
908593841 1:65663874-65663896 TTTTTTTCTTAGTTTAGCCAAGG + Intergenic
910584693 1:88866341-88866363 GCATTTGCTTACTTTAGACAGGG - Intronic
911681577 1:100722489-100722511 ACATTTTCTTATTATAGTCAGGG - Intronic
911795401 1:102069640-102069662 GCAAGTTCTTACTTTAGGCAGGG + Intergenic
912708139 1:111929976-111929998 GCATTTTCTAAATTTAGCAAAGG - Intronic
912823144 1:112883224-112883246 GTATTTTTTTAGTAGAGGCAGGG - Intergenic
913165426 1:116180547-116180569 GCATTGGCTTACTTAAGGCATGG + Intergenic
913256585 1:116959799-116959821 GCATTTTTTTAGTAGAGACAGGG - Intronic
914314500 1:146497079-146497101 GTATTTTTTTAGTAGAGGCATGG - Intergenic
914499852 1:148236309-148236331 GTATTTTTTTAGTAGAGGCATGG + Intergenic
914748796 1:150518556-150518578 GCATTTTTTTAGTAGAGACATGG + Intergenic
916007428 1:160675108-160675130 GCATTTTTTTAGTAGAGACAGGG - Intergenic
919968027 1:202548949-202548971 TTATTTTCTTGGTTTTGGCAGGG - Intronic
920041986 1:203104052-203104074 GCATTTTCTTGATGTATGCATGG - Intronic
920611523 1:207443754-207443776 GCAAGTTCTTACTTTAGGCTGGG + Intergenic
921012222 1:211153251-211153273 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
921194924 1:212746693-212746715 GCAGTTTCTTACCTTTGGCATGG - Intronic
921736677 1:218636001-218636023 GCATTTTTTTAAATTAGGCTAGG - Intergenic
922009473 1:221567316-221567338 GCATTTTATTGGTTTATACAGGG + Intergenic
924785242 1:247190406-247190428 GAATTTTCTTATGTTTGGCATGG + Intergenic
1062830943 10:605404-605426 GAATTTTATTAGCTTGGGCAAGG - Intronic
1065341033 10:24705447-24705469 ATATTTTCATAGTTTAGGCTGGG - Intronic
1066090840 10:32017786-32017808 GCATTTTCATAATTTATTCATGG - Intronic
1066304343 10:34125447-34125469 GCATTTTTTGAGTCAAGGCATGG + Intronic
1068614538 10:59098564-59098586 GGATTCTCTGAGTTTAGACATGG - Intergenic
1071130510 10:82387416-82387438 GCATTGTCTTAGGTGACGCATGG + Intronic
1071702822 10:87959781-87959803 GCATATTCTTAAATAAGGCAGGG - Intronic
1072058187 10:91781722-91781744 CCAATTTTTTAGTTTAGGAATGG - Intergenic
1072561738 10:96582904-96582926 GTATTTTTTTAGTTGAGACAGGG - Intronic
1074203702 10:111261867-111261889 GCATTTGGTGAATTTAGGCAAGG - Intergenic
1074791208 10:116889440-116889462 GCATTTTCTGAATCTAGGCATGG + Intronic
1077916705 11:6616285-6616307 GCATTGTCTAAGTTTAGGGTAGG + Intronic
1079806827 11:24942123-24942145 GCATTTTCTTGCTTTAGGTTTGG + Intronic
1079991591 11:27252259-27252281 GCATTTTCTTATTTTATATATGG - Intergenic
1080401344 11:31939142-31939164 GCATTATCTTTGTTTATACATGG + Intronic
1081378941 11:42391628-42391650 CCATTTTTTTACTTTAGGCATGG - Intergenic
1084071387 11:66738311-66738333 GGATTTTCCTATTTTAGGTATGG + Intergenic
1084552757 11:69857307-69857329 GCATTTTCTTCTTTAAGGCCTGG + Intergenic
1091200143 11:133772456-133772478 GCATTTTCTTTGTTATGGGAGGG - Intergenic
1092808517 12:12250178-12250200 GCATTTTGTAAATTTAGGCAAGG - Intronic
1093065604 12:14655017-14655039 GCATTTGCTTTATTTGGGCATGG - Intronic
1093469003 12:19481273-19481295 GTATTTTTTTAGTAGAGGCAGGG + Intronic
1094231663 12:28111793-28111815 GCATTTTCTAAGTTTGGGTTTGG - Intergenic
1094428304 12:30338759-30338781 GTATTTTTTTAGTAGAGGCAGGG - Intergenic
1097410059 12:59241056-59241078 GTATTTTCTAGGTTTAGGAAGGG - Intergenic
1097741738 12:63251390-63251412 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
1100507251 12:95234464-95234486 GTATTTTTTTAGTAGAGGCAGGG + Intronic
1101111496 12:101491008-101491030 GCATTTTCTTTGTGGGGGCATGG - Intergenic
1102280874 12:111617900-111617922 GCATTTTTTTAGTAGAGTCAGGG + Intergenic
1102537628 12:113592966-113592988 GCATTTTTTTAGTAGAGACAGGG - Intergenic
1102618478 12:114175125-114175147 GCATTTTCCTAGTATAAACAAGG - Intergenic
1102976582 12:117211129-117211151 GTATTTTCTTAGTAGAGTCAGGG + Exonic
1104401191 12:128477752-128477774 GCATTTTTTTAGTAGAGACAGGG + Intronic
1105355870 13:19659005-19659027 GCAGATTCTGAGTTTGGGCATGG + Exonic
1106378552 13:29213654-29213676 GCTTTCTCTTAGTTTCAGCATGG + Intronic
1106392549 13:29348871-29348893 GCTTTCTCTTAGTTTCAGCATGG + Intronic
1106843030 13:33707258-33707280 TCATTTTCTTTTTTGAGGCAGGG + Intergenic
1106950665 13:34880210-34880232 GCATTTGCTTAGATAAGGGATGG + Intergenic
1108354722 13:49619901-49619923 GTATTTTTTTAGTAGAGGCAGGG - Intergenic
1110357676 13:74586886-74586908 GTATTTTCTGAGTATAGTCAGGG - Intergenic
1111315304 13:86549077-86549099 GCATTTTCCTTGTTTAGATATGG + Intergenic
1111493390 13:89015566-89015588 GTATTTTCTTAATTTGGGAAAGG + Intergenic
1112240554 13:97677259-97677281 TCATTTTCTTAGGTCAGGCATGG - Intergenic
1112585220 13:100712928-100712950 GTATTTTTTTAGTAGAGGCATGG + Intergenic
1113095705 13:106661806-106661828 TCATTTTCTGGGTTTAGGGACGG + Intergenic
1114212282 14:20625604-20625626 GCATTTCTTTCGGTTAGGCAGGG + Intergenic
1114493942 14:23119768-23119790 GCATTCTCTGAGTGTAGGCCAGG + Intergenic
1115804021 14:37030826-37030848 GGATTTTCTGAGTTTAGTCAAGG + Intronic
1115811723 14:37116888-37116910 TCTTTTTCTTATTTTAAGCATGG + Intronic
1117441520 14:55764013-55764035 ACATTTTATGAGTTTAGGCCTGG + Intergenic
1118423042 14:65628786-65628808 TCATTTTATTAGTTTAGACCAGG + Intronic
1119238766 14:73041496-73041518 GCATTTCCTCAGTTGTGGCAAGG - Intergenic
1121102127 14:91256890-91256912 GCATTTTCTTAGGGAAAGCATGG - Intergenic
1123792923 15:23740602-23740624 TCATTTTCTTGGATTAGGCAAGG - Intergenic
1126053655 15:44710166-44710188 GCATTTTCTTAGTTTAGGCATGG + Intronic
1126994151 15:54420612-54420634 GCATATTCTTATTTTAGGTCAGG + Intronic
1127027044 15:54818220-54818242 ACATTTTATTAGTTTAGGTTGGG - Intergenic
1128044374 15:64604707-64604729 GGAGTTTATTAGTTTAGGCAGGG + Intronic
1128573619 15:68754303-68754325 GCATTTTCTAAATATAGGCTTGG + Intergenic
1129380539 15:75162609-75162631 GCATTTTTTTAGTAGAGACAGGG - Intergenic
1129428096 15:75479563-75479585 GCTATTTCTTAGTATTGGCAAGG - Intronic
1131044561 15:89303357-89303379 GCATTTTCTTAGCTAAGTGAAGG - Intronic
1131768373 15:95705944-95705966 GCTTTTTCTTATTTTAAGTAAGG + Intergenic
1132645647 16:998168-998190 GCATTTTCAGAGCTTAGGCTGGG - Intergenic
1133240012 16:4408598-4408620 GCAATTTCTTAGTTGAGTCCTGG - Intronic
1133328557 16:4957409-4957431 ATTTTTTTTTAGTTTAGGCAGGG - Intronic
1133606946 16:7396746-7396768 GCAGTTTCATAGTGTTGGCAAGG - Intronic
1135983543 16:27167228-27167250 CCATTTTCTTCTTTTAGCCAAGG + Intergenic
1136038055 16:27555660-27555682 GCATTTTTTTAGTAGAGACAGGG - Intronic
1141094450 16:81153186-81153208 GCATTTTCTCATTTCAGGAAGGG + Intergenic
1142331441 16:89456603-89456625 GCATTGTCTGGGTGTAGGCAGGG - Intronic
1142370895 16:89681149-89681171 GCATTTTTTTAGTAGAGACATGG + Intronic
1143213209 17:5204613-5204635 GCATTTTTTTAGTAGAGACAGGG - Intergenic
1144966727 17:19081325-19081347 GCATTTTTTTAGTAGAGACAGGG - Intergenic
1144981191 17:19170732-19170754 GCATTTTTTTAGTAGAGACAGGG + Intergenic
1144987033 17:19207507-19207529 GCATTTTTTTAGTAGAGACAGGG - Intergenic
1146001853 17:29135274-29135296 GTATTTTTTTAGTAGAGGCAGGG + Intronic
1148353221 17:46956466-46956488 GTATTTTCTTAGTAGAGGCAGGG + Intronic
1148593359 17:48833006-48833028 ACATTTTCATATTTTAGGTAAGG + Intronic
1149144974 17:53479407-53479429 GCTTTTGCTTAGGTTAGGAATGG - Intergenic
1149356864 17:55848095-55848117 GCATTTTCTTAGTAGAGACAGGG + Intergenic
1149898357 17:60449417-60449439 GTATTTTTTTAGTAGAGGCAAGG - Intronic
1153841204 18:9009471-9009493 GTATTTTCTTAGTAGAGACAGGG - Intergenic
1153993182 18:10417963-10417985 GCATTTTTCTAGGTTAGGCCTGG + Intergenic
1154169406 18:12039397-12039419 GCATATCCTTACTTTAGCCATGG - Intergenic
1156190311 18:34711760-34711782 CCATTTTCTAAGTTTAAGCAAGG + Intronic
1158950065 18:62486307-62486329 TCATTTTGTTAGTTCAGCCAAGG - Intergenic
1159426233 18:68290581-68290603 GCATTTTCTCAGTACAAGCAGGG - Intergenic
1159536639 18:69723543-69723565 GCATTTTCTATGTTTAGAGATGG - Intronic
1161020058 19:2005320-2005342 ACATTTTCTTTTTTGAGGCAGGG + Intronic
1162319878 19:9965328-9965350 GCATTTTTTTAGTAGAGACAGGG + Intronic
1162588402 19:11575548-11575570 GCATTTTTTTTGTAGAGGCAAGG - Intronic
1163154734 19:15433456-15433478 GCATATCCTTACTTAAGGCAAGG + Intronic
1165425181 19:35741454-35741476 TCATTGTCTTATTTTAGGGATGG - Intronic
1167472456 19:49683089-49683111 GTATTTTTTTAGTTGAGACATGG + Intronic
1167830402 19:52015917-52015939 GCATTTTCTTATGTTTGACAAGG + Exonic
1168218228 19:54942078-54942100 GTATTTTTTTAGTAGAGGCAGGG - Intronic
930660878 2:54051870-54051892 GTATTTTTTTAGTAAAGGCAGGG - Intronic
930677795 2:54222869-54222891 GCATTTTCTGAGTTTTGGTGAGG + Intronic
931687197 2:64804513-64804535 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
932071297 2:68623201-68623223 GCTTTTTCTTTGTTTAAGTAGGG + Intronic
932383257 2:71305570-71305592 GCATTTTATTATTTTTGGCCGGG + Intronic
933461844 2:82598267-82598289 GCATTTTCTTAGAATTGGTAAGG - Intergenic
933665430 2:84960843-84960865 GTATTTTCTTAGTAGAGACAGGG + Intergenic
935889653 2:107662446-107662468 GCATTTTTTTAGTAGAGACAGGG - Intergenic
936271380 2:111051985-111052007 GCATCTTCTCAGGTTAGGCAAGG - Intronic
936628008 2:114169475-114169497 GCATTCTCTGAGTTCAGGGAAGG - Intergenic
937045854 2:118851160-118851182 GCATTTTCTGAGGATAGGCAGGG + Intergenic
937972683 2:127562793-127562815 GCATTTTTTTAGTAGAGGCAGGG + Intronic
939085145 2:137709698-137709720 GCATTATGTTAGTTTAGGGGAGG - Intergenic
941081874 2:161071050-161071072 GCATTTACTTACTCTAGGCCAGG + Intergenic
942116089 2:172730755-172730777 GTATTTTCTTGTTTTAGTCATGG + Intergenic
942755207 2:179332762-179332784 GCATTTTCTGAGTGAAGACATGG - Intergenic
942897400 2:181073844-181073866 GCGTTTTCTTATTTAAGGCCTGG + Intronic
943561187 2:189464584-189464606 TTATTTACTTAGTATAGGCAAGG + Intronic
945685316 2:212961845-212961867 ACAGTTTATTAGTTTAGCCAAGG - Intergenic
1170915280 20:20617934-20617956 GTTTTTTCTCAGTTCAGGCAAGG + Intronic
1172472968 20:35214510-35214532 GTATTTTTTTAGTAGAGGCAGGG - Intergenic
1176807501 21:13501930-13501952 GTATTTTATAAGTATAGGCAGGG + Intergenic
1177568077 21:22848933-22848955 GCATATTCTTATTTTAGTGATGG - Intergenic
1178062143 21:28864001-28864023 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
1178081089 21:29065906-29065928 GTATTTTTTTAGTAGAGGCAGGG - Intronic
1178932630 21:36833037-36833059 CCATTTTTTTTTTTTAGGCAAGG + Intronic
1180366564 22:11944651-11944673 GTATTTTTTTAGTACAGGCAGGG - Intergenic
1182008041 22:26977842-26977864 GCATATTCTCAGTCTAGGCAAGG + Intergenic
1182501124 22:30748364-30748386 GAAGTTTTTTAGTTTAGGCCAGG - Intronic
1182723039 22:32419629-32419651 GCATTTTTTTAGTAGAGTCAGGG - Intronic
1182978267 22:34643757-34643779 CCATTCTCTTAGTTAAGGAAAGG - Intergenic
1183154211 22:36062518-36062540 GCATTTTTTTAGTAGAGACAGGG + Intergenic
1183677172 22:39306043-39306065 GTATTTTTTTAGTATAGACAGGG + Intergenic
949192405 3:1266319-1266341 GAATTTTCTTAGTCCAAGCAAGG - Intronic
949423665 3:3892674-3892696 GCATTGTCTTGTTTTAGGCTAGG + Intronic
949961900 3:9319208-9319230 GCATTATGTGACTTTAGGCAAGG - Intronic
950041020 3:9919468-9919490 GTATTTTTTTAGTGGAGGCAGGG - Intronic
951233785 3:20211062-20211084 GCATTTTTTTTGTAGAGGCAGGG + Intergenic
951468377 3:23027657-23027679 GCATTTTCTTATTTAATGCAAGG + Intergenic
953482157 3:43261062-43261084 GCAGCTTGTGAGTTTAGGCAAGG - Intergenic
954606760 3:51916953-51916975 GCATTGTTTTAGTAGAGGCAGGG + Intergenic
955821447 3:62900147-62900169 TCAGTTTCTTAGTTTTGACAAGG - Intergenic
955983785 3:64552468-64552490 GCAGTTTCTTAATTTAGGCCAGG + Intronic
956824194 3:72982592-72982614 CCATTTATTTAGTTGAGGCAGGG - Intronic
957361881 3:79170582-79170604 GTATTGCCTTAGTTTAGACAAGG - Intronic
958518523 3:95154899-95154921 GCATTTGCCTTATTTAGGCATGG - Intergenic
959780971 3:110232887-110232909 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
959933968 3:112011116-112011138 GCATCTTCTCAGTTTAGGACAGG + Intronic
960880446 3:122339678-122339700 ACATTTTCTTTGTAGAGGCAGGG - Intronic
962696910 3:137958484-137958506 TCATTTTATTAGTTTTTGCAAGG - Intergenic
963211972 3:142702824-142702846 TCAGATTCTTACTTTAGGCAGGG + Intronic
964121425 3:153188489-153188511 GTATTTTCTTAGCTTGTGCATGG + Intergenic
964913305 3:161808950-161808972 GCATTTTCATGGATCAGGCATGG + Intergenic
965001062 3:162954050-162954072 GCTATTTTTTAGTTTAAGCAGGG - Intergenic
965115225 3:164479443-164479465 GCATTTTCTCAGTTTAAAGAAGG - Intergenic
965240482 3:166190597-166190619 GCATTGTCTTTGTTTACACATGG + Intergenic
965565618 3:170113754-170113776 CTATTGTCTGAGTTTAGGCAAGG + Intronic
965689066 3:171336168-171336190 CCATTTTGTTAGTTTTGACAAGG - Intronic
967999382 3:195193303-195193325 GTATTTTATTATTTTAGGAATGG - Intronic
968173199 3:196526963-196526985 GTATTTTCTTAGTAGAGACAGGG - Intergenic
970053187 4:11939524-11939546 GCATTGTGTTAGTTTTGCCAGGG - Intergenic
970507598 4:16747151-16747173 CCATTTTCTTAAATAAGGCATGG + Intronic
970920369 4:21387070-21387092 ACATGTTCTAAGTCTAGGCATGG - Intronic
971110092 4:23575338-23575360 GCATTTTCTTAGTAGAGACGGGG - Intergenic
972714088 4:41628477-41628499 GAATTTTCTTAGTTTGAGGAAGG - Intronic
973667061 4:53171878-53171900 TCATTTTCTTAGTTTAGCTAGGG + Intronic
974314681 4:60263926-60263948 GCATATGCTTTATTTAGGCATGG - Intergenic
979629111 4:122880420-122880442 GCATTTTTTTAGTAGAGGCAGGG + Intronic
980489040 4:133501176-133501198 GAATATTCTTAGTTTAAGAATGG - Intergenic
981111945 4:140945086-140945108 GCATTTTGTTATTTAAAGCAGGG + Intronic
981990754 4:150917752-150917774 GTATTTTTTTAGTAGAGGCAGGG - Intronic
983565081 4:169141990-169142012 GTATTTTTTTAGTATAGACAGGG + Intronic
983646859 4:170000308-170000330 GCATTTGCTGAGTTTTGGAAAGG + Intronic
983807657 4:172015712-172015734 GCATTTTTTTAGTTTTGGCTTGG + Intronic
983921870 4:173354837-173354859 GCATTTTTTTTTTTTAGACAAGG - Intergenic
984828417 4:183949402-183949424 GTACTTTCTTAATTTAGGCCAGG + Intronic
986347099 5:6845844-6845866 GCATTTTCTTAGGATTTGCAGGG + Intergenic
988119590 5:26943337-26943359 GTATTTTTTTAGTAGAGGCAGGG - Intronic
989059776 5:37398967-37398989 GTATTTTCTTAGTAGAGTCAAGG - Intronic
992194593 5:74326738-74326760 GCATTTTGTTAGTGGGGGCAGGG + Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
994242454 5:97440735-97440757 GCATTTTCTCACTTGTGGCACGG + Intergenic
994587965 5:101735289-101735311 GCTTTTTGATACTTTAGGCATGG + Intergenic
995071532 5:107928061-107928083 GAATTTTCTTTGTTATGGCAGGG - Intronic
995497638 5:112764336-112764358 TTATTTTCATAGTTTAGGTAGGG + Intronic
996499271 5:124198810-124198832 GCATTTTTTTAGTAGAGACAGGG + Intergenic
996881663 5:128304158-128304180 GCATTTTCTCAGTGTAGAAAAGG - Intronic
999606336 5:153320804-153320826 GAACTTTCTTAGTCTAGGCCAGG - Intergenic
999790195 5:154932547-154932569 GAATTTTCATAGTTTTTGCAAGG + Intronic
1004416015 6:15424683-15424705 GTATTTTTTTAGTGGAGGCAGGG - Intronic
1005116844 6:22348478-22348500 GCATTTTTTTTCTCTAGGCATGG - Intergenic
1005191771 6:23231694-23231716 GCATTTTCTTACTTAACTCAAGG + Intergenic
1006582428 6:35084644-35084666 GTGTTTTCTTAGGTCAGGCAAGG + Intronic
1006671844 6:35734450-35734472 GTATTTTCTTAGGTCAGGCGTGG - Intergenic
1007109058 6:39302605-39302627 CCATTTCCCTAGTTCAGGCAGGG - Intronic
1009470024 6:64021073-64021095 GCATTTTCTTAATTGAGAAATGG + Intronic
1011540593 6:88423285-88423307 GCATTTTCTTAGGCCAGGCGCGG - Intergenic
1011785894 6:90844804-90844826 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
1016109418 6:140204027-140204049 GCATTTCCTTAGCTTGGACAGGG - Intergenic
1017108913 6:150913953-150913975 GTATTTTTTTAGTAGAGGCAGGG - Intronic
1017447633 6:154521997-154522019 GCATTTTTTTAGTAGAGACAGGG + Intergenic
1019794540 7:3040071-3040093 GCATTTTCTCATTTTATGCTTGG + Intronic
1020001292 7:4757454-4757476 GAATTTTTTTAGTAGAGGCAGGG - Intronic
1020511085 7:9057886-9057908 TCTATTTCTTAGTCTAGGCAAGG + Intergenic
1021052394 7:16004390-16004412 GCTTTTTCTTACTTAATGCATGG - Intergenic
1021923232 7:25508255-25508277 GCATTTTTTTAGTAGAGACAGGG - Intergenic
1025730632 7:64103690-64103712 GTATTTTTTTAGTAGAGGCAGGG + Intronic
1026209284 7:68289089-68289111 GTATTTTGTTAGTGGAGGCAGGG + Intergenic
1027191335 7:75997257-75997279 GCATTTTTTTAGTAGAGACAGGG - Intronic
1028216625 7:88140828-88140850 GCATTTTCTTTTTTCAGGCAGGG - Intronic
1030795652 7:113783761-113783783 ACAATTTTTTAATTTAGGCATGG + Intergenic
1031391767 7:121223665-121223687 ACTTTTTCCTAGTTTAGTCATGG + Intronic
1031984117 7:128151468-128151490 GTATTTTCTTAGTTTAAGGATGG + Intergenic
1032259213 7:130321415-130321437 CCATTTTCTTAGTTTCTGTAGGG + Intronic
1034116101 7:148585337-148585359 GCATATTCTTAATTTGGGCATGG + Intergenic
1035043432 7:155947696-155947718 GCATTTTCTGACTTTTGACAAGG + Intergenic
1036414729 8:8536510-8536532 GCATTTTCTTTGTTTGTGCATGG + Intergenic
1037637911 8:20717035-20717057 GCCTTATCTAAGTTTAGGGAAGG + Intergenic
1038803372 8:30769220-30769242 ATATTTTTTTTGTTTAGGCATGG + Intergenic
1039735530 8:40328324-40328346 GTATTTTCTTAGTAGAGACAGGG - Intergenic
1040710896 8:50187741-50187763 GCATTTTATTAGTTCATGGATGG + Intronic
1042081252 8:65054476-65054498 GCAGTTTCTTATGTTAAGCATGG - Intergenic
1042947649 8:74171138-74171160 GCATTTTTTTAGTAGAGACAGGG + Intergenic
1042983986 8:74563443-74563465 GCTTTTTTTAAGTATAGGCATGG + Intergenic
1043005776 8:74816477-74816499 GCATCTTCTTAGCTCAGGCATGG - Intronic
1043782017 8:84347998-84348020 GCATTTGCTTTTTTTGGGCATGG + Intronic
1043887397 8:85617733-85617755 TCATTTTCTTTTTTGAGGCAGGG + Intergenic
1045805360 8:106153983-106154005 GGATTTTCATAGTTTAGACATGG - Intergenic
1046767166 8:118082197-118082219 GCATTTTGTTATTTTTGGCCTGG - Intronic
1047261378 8:123263657-123263679 GTATTTTTTTAGTAGAGGCAGGG - Intronic
1047456723 8:125020787-125020809 GGCTTTTCTTAGTTGATGCAGGG - Exonic
1048097180 8:131309635-131309657 GCTTTTTCTTATTGTAGGCATGG + Intergenic
1052558599 9:30052836-30052858 GCATTTTCTTAGTTTTTGCCAGG + Intergenic
1052926002 9:34016728-34016750 GTATTTTCTTAATAGAGGCAGGG + Intronic
1053490872 9:38500921-38500943 GCATTTTCTTAGTAGAGACGGGG + Intergenic
1055357700 9:75454350-75454372 GGATTTTCTTAGTGGAGACAAGG + Intergenic
1055956511 9:81778890-81778912 GCATTTTTTTTTTTTAGACAGGG + Intergenic
1058630455 9:106981160-106981182 GCATTGTCTTAGTTTGGAAATGG + Intronic
1059191149 9:112327617-112327639 TAATTTTCTTAATTTTGGCAAGG + Intronic
1059538525 9:115107733-115107755 GAATTTTCTTAGTTCAGATAAGG + Intronic
1059737754 9:117119306-117119328 GAATTTTATTTGATTAGGCATGG + Intronic
1060808805 9:126597324-126597346 GCTTTTTTTTTGTTTAGCCAGGG - Intergenic
1203750464 Un_GL000218v1:74411-74433 GCATTTTTTTAGTAGAGACAGGG - Intergenic
1186073086 X:5843975-5843997 GGATTTTCTAAGCTTAGGGAAGG + Intronic
1186097510 X:6117850-6117872 CCATTTCCTCAGTTCAGGCATGG + Intronic
1186365850 X:8892592-8892614 GCAATTTCTTTGTTTAGCAAAGG - Intergenic
1187855128 X:23629317-23629339 GTATTTTTTTAGTAGAGGCAGGG - Intergenic
1188426192 X:30049698-30049720 TGATTTTCTCAGTTTTGGCAAGG - Intergenic
1190329959 X:49229822-49229844 GTATTTTTTTAGTAGAGGCAGGG + Intronic
1193152918 X:78143198-78143220 GTATTTTTTTAGTAGAGGCAGGG + Intergenic
1196353707 X:114763403-114763425 GCATTTTCCTAATTTATGCAAGG - Intronic
1199100712 X:143796502-143796524 GAATGTTCTGAGTTTGGGCAAGG + Intergenic
1199262753 X:145794846-145794868 GCACTTTCTTGTTTAAGGCAAGG + Intergenic
1199548256 X:149030852-149030874 GAATTTTATTCCTTTAGGCAGGG - Intergenic
1201534317 Y:15028919-15028941 GTATTTTCTCAGGTTTGGCATGG - Intergenic
1202303837 Y:23446892-23446914 TTATTTTCTTGGTTTTGGCAGGG - Intergenic
1202383902 Y:24305158-24305180 GTATTTTCTTAGTTAAGAAAAGG - Intergenic
1202486881 Y:25364962-25364984 GTATTTTCTTAGTTAAGAAAAGG + Intergenic
1202566973 Y:26223699-26223721 TTATTTTCTTGGTTTTGGCAGGG + Intergenic