ID: 1126055399

View in Genome Browser
Species Human (GRCh38)
Location 15:44725461-44725483
Sequence CTAAAGATAAAGATTTAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126055399_1126055404 24 Left 1126055399 15:44725461-44725483 CCCCTCTAAATCTTTATCTTTAG No data
Right 1126055404 15:44725508-44725530 TCTTTACCCATGTTATGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126055399 Original CRISPR CTAAAGATAAAGATTTAGAG GGG (reversed) Intergenic
No off target data available for this crispr