ID: 1126056674

View in Genome Browser
Species Human (GRCh38)
Location 15:44736248-44736270
Sequence GGTGTGATGGGATCATGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126056670_1126056674 -2 Left 1126056670 15:44736227-44736249 CCACTCAGCTGGTGTCTTGATGG 0: 1
1: 0
2: 3
3: 3
4: 157
Right 1126056674 15:44736248-44736270 GGTGTGATGGGATCATGAACAGG 0: 1
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126056674 Original CRISPR GGTGTGATGGGATCATGAAC AGG Intronic
902897868 1:19491691-19491713 GGTGGGATGTGAGCATGAAGGGG - Intergenic
904215153 1:28913532-28913554 GCTGTGCTGGGATCGTGAAGGGG + Intronic
905731235 1:40300731-40300753 AGTGAGATGGGATCAGGAACTGG + Exonic
909465995 1:75974637-75974659 AGTGTGATGGAATAATGAAGAGG + Intergenic
910121931 1:83799627-83799649 GGTGTGATGGGAGAAGGAAGGGG + Intergenic
910255226 1:85241241-85241263 GAGGTGATTGGATCATGAAGGGG + Intergenic
911521970 1:98940360-98940382 GGTTAGATGAGATCATGAAGGGG - Intronic
913377763 1:118173290-118173312 GGTGTGGTGGTATCATGGATGGG + Intronic
916031528 1:160881453-160881475 GGTGTGGTGGGATCATCGGCTGG - Intronic
916496583 1:165353331-165353353 GATGTGAAGGGATCAGGAGCGGG - Intronic
916869353 1:168895702-168895724 AGTGTGGTGTGATCATTAACAGG + Intergenic
917462237 1:175241949-175241971 GAGGTGATGGGAGCCTGAACCGG - Intergenic
920334209 1:205233376-205233398 GGTGTGACTGGAACATGAACTGG - Intronic
920984612 1:210874497-210874519 GGTCTCATGGAAACATGAACAGG + Intronic
1063338956 10:5244890-5244912 GACGTGATTGGATCATGGACTGG + Intergenic
1063344141 10:5295484-5295506 GAGGTGATTGGATCATGGACTGG - Intergenic
1064341552 10:14490094-14490116 GGTTTGATGGGTTCATGAGGAGG + Intergenic
1064403463 10:15040182-15040204 GGTGTAATGGGATTATGACTGGG - Intronic
1064924017 10:20550363-20550385 GGTGTGGTGGGATTATGATGTGG + Intergenic
1065970744 10:30804239-30804261 GATGTGTTGGCATCATCAACAGG + Intergenic
1068259167 10:54555794-54555816 GGTGTGATATGATTATGAATGGG - Intronic
1068337357 10:55652611-55652633 GGTGTCATGGTCACATGAACAGG - Intergenic
1070890402 10:79938740-79938762 TGTGTGATGGGGTGATGAAAGGG + Intronic
1071806706 10:89129979-89130001 GGTGGTATGGGATCAGGAAGTGG - Intergenic
1072615240 10:97044892-97044914 AGTGTGATGGGATCAGGATGGGG + Intronic
1072925500 10:99613256-99613278 GGTGAGTTGGGATCCTGAAAAGG + Intronic
1073991185 10:109263871-109263893 GGAGTGATGGGAATGTGAACTGG - Intergenic
1074551889 10:114451392-114451414 GGTTTGATGGGCTCAGCAACAGG + Intronic
1075475715 10:122731829-122731851 GGTGGAATGGGATAATGAACAGG - Intergenic
1076867418 10:133174927-133174949 GGGTGGATGGGATTATGAACAGG + Intronic
1079090835 11:17479074-17479096 GGTGTTAAGGGAGCATCAACTGG + Intergenic
1080275518 11:30499212-30499234 GGTGTGATGGGAAAGTGAAAAGG - Intronic
1087290649 11:96316822-96316844 GGGGAGAGGGGATCCTGAACTGG + Intronic
1088119349 11:106349876-106349898 GGTGTGTTGGGTTAATGAATGGG + Intergenic
1089358449 11:117870827-117870849 GGTGTGATGGGGGCATACACTGG - Intronic
1092075562 12:5670632-5670654 GGTGTGGTGGGAGGATTAACTGG - Intronic
1102220729 12:111192618-111192640 GGTGGGCTGCGATGATGAACTGG - Intronic
1102584455 12:113913382-113913404 GGCGAGATGGGGTCATGACCTGG - Intronic
1102740058 12:115199107-115199129 GGTGTGATGGGGTCTTAAACGGG + Intergenic
1104119949 12:125789555-125789577 AGTGTGATGGTATGAGGAACTGG + Intergenic
1106788769 13:33133155-33133177 GGTGTGCTGGCATCATAACCAGG - Intronic
1108377406 13:49826336-49826358 GCTGTGAGGGGCTCATGAAGGGG + Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1119298553 14:73552735-73552757 GGTGTTGTGGGATCAGGAAGTGG - Intronic
1119302850 14:73584922-73584944 GGTGTTACGGGATCAGGAAGTGG - Intergenic
1119877441 14:78072917-78072939 GGTGTGCTAGGACCAGGAACAGG - Intergenic
1120832534 14:89010411-89010433 GGGCTGATTGGATCATGAAAGGG - Intergenic
1126056674 15:44736248-44736270 GGTGTGATGGGATCATGAACAGG + Intronic
1126834206 15:52643003-52643025 GGTGTGATGGGAGCATAAAAGGG - Intronic
1127969473 15:63947109-63947131 GGTGGGATGGGGTGATGAAGAGG - Intronic
1129902163 15:79159392-79159414 AATGTGATGGTATCAAGAACTGG + Intergenic
1131391549 15:92053150-92053172 GGTGGGATGGGATGATGAGCAGG + Intronic
1131637147 15:94248065-94248087 GGTGTGATGAGATTATGACATGG + Intronic
1132714448 16:1283848-1283870 AGTGTGATGGGATCAGGAGGTGG - Intergenic
1138427667 16:56947008-56947030 GGTGTGATGAGTTCAAGGACAGG + Intergenic
1139163084 16:64534856-64534878 GAGGTGATTGGATCATGAGCTGG + Intergenic
1139597155 16:67964710-67964732 GGTGTGATTGGGCCATGCACTGG + Intronic
1140567706 16:76063784-76063806 GGTGTTATGAGTTCATGACCTGG + Intergenic
1140913999 16:79478718-79478740 GGTATGCTGGGATGATGCACTGG - Intergenic
1143642564 17:8207520-8207542 GGGGTGAGGGGACAATGAACAGG - Intronic
1149120371 17:53156282-53156304 GGTTTGATGGGAGGTTGAACAGG - Intergenic
1151843130 17:76631851-76631873 GGGGTTATTGGTTCATGAACTGG + Intronic
1152624559 17:81382289-81382311 TGTGTGATGGGGACAGGAACAGG - Intergenic
1155813694 18:30274863-30274885 TGTGTGATGGGATAAGGATCAGG - Intergenic
1157463198 18:47920272-47920294 GCTGTGATGGCATCAGGAAATGG - Intronic
1160031914 18:75269448-75269470 GGTGTGGGGGAATCATGAGCTGG + Intronic
1160693204 19:469720-469742 GGGGCGATGGGATTATGACCAGG - Intronic
1162082241 19:8225118-8225140 GGTGTGAGGGGATCCAGGACTGG + Intronic
1164496154 19:28764265-28764287 GATGTGCTGGGTTCATGAATAGG - Intergenic
1166321955 19:42024109-42024131 GGTGTGATGGGAGCCTGGAACGG - Intronic
925265176 2:2561967-2561989 GCTGTGATGGGATGATGGACAGG - Intergenic
926275898 2:11402965-11402987 GCTGTGCTGGGATCCAGAACTGG + Intergenic
929392423 2:41485545-41485567 GTTGTTTTGGGATCATGAAAAGG + Intergenic
935059199 2:99593317-99593339 GGTGTTCTGGGATCCTGGACAGG + Exonic
935444969 2:103146541-103146563 GGTGTGGTGGGAACAGGAAATGG - Intergenic
937356201 2:121199638-121199660 GGTGTGATGGGGGCATGCAGTGG - Intergenic
937610485 2:123855615-123855637 GGTGGCATGGGCTCATGAGCGGG - Intergenic
939643044 2:144663718-144663740 GCTGTGATGGGAACGTGTACAGG - Intergenic
941716791 2:168772545-168772567 GGTGTGTGGGGAACATGAACAGG - Exonic
1169341037 20:4796491-4796513 GGTGTCAAGTGATCATGAGCTGG + Intronic
1170291277 20:14771915-14771937 GGTGTGAGGTGATAATGAATTGG - Intronic
1170673107 20:18453356-18453378 GGTGTGAAGGGATCAGCATCAGG - Intronic
1177194765 21:17892088-17892110 GGTGTGATGGGGAGGTGAACGGG + Intergenic
1181689858 22:24553119-24553141 GCTGTGAGGGGTTCTTGAACAGG - Intronic
1181844366 22:25694730-25694752 GGAGTGAACGGATGATGAACAGG - Intronic
1182542043 22:31048872-31048894 GGGGTGATGGGGGCCTGAACAGG + Intergenic
1184631919 22:45788333-45788355 TGTGTGGTGGGATCATTTACTGG - Intronic
953477798 3:43220869-43220891 GATGTGATGGGACCCTTAACAGG - Intergenic
954794015 3:53152311-53152333 GGTCTGATGGGAGGATGGACAGG - Intergenic
964645402 3:158953414-158953436 ACTGTGATGGGAGCATGAGCTGG - Intergenic
966113652 3:176433998-176434020 GAGGTGATCGGATCATGAAGCGG + Intergenic
971263048 4:25074588-25074610 GAGGTGATTGGATCATGAGCCGG - Intergenic
972425331 4:38927474-38927496 GGTGTGATTAGATCATGAAGTGG - Intronic
973000163 4:44937845-44937867 GGTCTGATGGGAATTTGAACTGG - Intergenic
974805299 4:66871981-66872003 GGTTAGATGGGATCATGAGGTGG - Intergenic
982429891 4:155310796-155310818 GGAGTGATGGGAACAAAAACTGG + Intergenic
984627278 4:182021367-182021389 GCTGTGATGTGATCAGAAACTGG - Intergenic
986039947 5:3983706-3983728 GGTGGGAAGGGACCAGGAACAGG - Intergenic
992951494 5:81862439-81862461 GCTGTGATGGGATCAAGACTTGG - Intergenic
993922275 5:93820254-93820276 GGTGTGCTGAGATCAATAACTGG + Intronic
997351722 5:133235952-133235974 GGTGAGATGGCATCCTGAAATGG + Intronic
999773327 5:154791876-154791898 GGTTAGATGAGATGATGAACAGG - Intronic
1001514995 5:172349452-172349474 GGTGTGTTGGGAACATTAAATGG + Intronic
1001763757 5:174228454-174228476 GGTCTGATGGGATCAGACACTGG - Intronic
1002462917 5:179385012-179385034 GCTGTGATGGGATTAGGAAGTGG - Intergenic
1007687890 6:43678023-43678045 TGTGGGATGGAATCATGATCTGG - Intronic
1010356294 6:74937722-74937744 AATGTGCTGGGATTATGAACAGG - Intergenic
1017957571 6:159191176-159191198 GGGGTGATGAGATCATGGAGTGG - Intronic
1021543839 7:21790790-21790812 AGTATGAGGGAATCATGAACAGG + Intronic
1021585120 7:22199444-22199466 GGCCTGATGGGCTCAAGAACTGG + Intronic
1023991733 7:45132719-45132741 GTTGTGATAGGATCATGCCCAGG - Intergenic
1025801971 7:64794883-64794905 GGGGTGCTGGGTTCATGAATGGG + Intronic
1025942299 7:66083210-66083232 GGTGTGATGGAAGCCTGAACAGG + Intronic
1041324546 8:56651036-56651058 GAGGTGATGGGATCAGGAAAAGG - Intergenic
1045643017 8:104272696-104272718 GATGTTGTGGGATCATGAAGAGG + Intergenic
1050199472 9:3128296-3128318 GGTGTTATGGGAACATGACAAGG - Intergenic
1050769126 9:9174901-9174923 AGTGTGATGGAATTATGAAGTGG + Intronic
1057585283 9:96323373-96323395 TGTGTGGTGAGATCATGAGCTGG - Intronic
1058242269 9:102579545-102579567 GGTGAGATGTGATGCTGAACTGG + Intergenic
1059957773 9:119536071-119536093 GGTGGGATGGGATGATGAGCTGG + Intergenic
1187533143 X:20114579-20114601 GGGGTAATGGGAACATGCACAGG + Intronic
1192916315 X:75654955-75654977 GGCTTGCTGGGATTATGAACAGG + Intergenic
1194745166 X:97620415-97620437 GTGGTGATGGGGTCATGAAGTGG - Intergenic
1195177078 X:102322108-102322130 GGTGTGATGGGAACAATCACAGG + Intronic
1195181786 X:102364985-102365007 GGTGTGATGGGAACAATCACAGG - Intronic
1195200964 X:102549842-102549864 GGTGTGATGGGAGCAATCACAGG + Intergenic
1200768823 Y:7104886-7104908 GCTGAGGTGGGAGCATGAACTGG + Intergenic
1202282505 Y:23204726-23204748 GGGGTGATGGTATCAGGAAGCGG + Intergenic
1202283385 Y:23213793-23213815 GGGGTGATGGTATCAGGAAGCGG - Intergenic
1202434177 Y:24819111-24819133 GGGGTGATGGTATCAGGAAGCGG + Intergenic
1202435062 Y:24828179-24828201 GGGGTGATGGTATCAGGAAGCGG - Intergenic