ID: 1126062131

View in Genome Browser
Species Human (GRCh38)
Location 15:44792879-44792901
Sequence TGCCCCAGTTATCAATGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126062129_1126062131 17 Left 1126062129 15:44792839-44792861 CCTCATCTGTCACTCTTGACATC No data
Right 1126062131 15:44792879-44792901 TGCCCCAGTTATCAATGAACAGG No data
1126062128_1126062131 23 Left 1126062128 15:44792833-44792855 CCAAGTCCTCATCTGTCACTCTT No data
Right 1126062131 15:44792879-44792901 TGCCCCAGTTATCAATGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126062131 Original CRISPR TGCCCCAGTTATCAATGAAC AGG Intergenic
No off target data available for this crispr