ID: 1126063058

View in Genome Browser
Species Human (GRCh38)
Location 15:44802521-44802543
Sequence TGTACCTTCTGCTTCCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126063058_1126063060 11 Left 1126063058 15:44802521-44802543 CCAAACAGGAAGCAGAAGGTACA No data
Right 1126063060 15:44802555-44802577 ACTGACAAATGTCTCACAACTGG No data
1126063058_1126063061 30 Left 1126063058 15:44802521-44802543 CCAAACAGGAAGCAGAAGGTACA No data
Right 1126063061 15:44802574-44802596 CTGGCTTTCCACTGAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126063058 Original CRISPR TGTACCTTCTGCTTCCTGTT TGG (reversed) Intergenic
No off target data available for this crispr