ID: 1126063060

View in Genome Browser
Species Human (GRCh38)
Location 15:44802555-44802577
Sequence ACTGACAAATGTCTCACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126063058_1126063060 11 Left 1126063058 15:44802521-44802543 CCAAACAGGAAGCAGAAGGTACA No data
Right 1126063060 15:44802555-44802577 ACTGACAAATGTCTCACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126063060 Original CRISPR ACTGACAAATGTCTCACAAC TGG Intergenic
No off target data available for this crispr