ID: 1126063061

View in Genome Browser
Species Human (GRCh38)
Location 15:44802574-44802596
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126063058_1126063061 30 Left 1126063058 15:44802521-44802543 CCAAACAGGAAGCAGAAGGTACA No data
Right 1126063061 15:44802574-44802596 CTGGCTTTCCACTGAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126063061 Original CRISPR CTGGCTTTCCACTGAGATGC AGG Intergenic