ID: 1126063061 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:44802574-44802596 |
Sequence | CTGGCTTTCCACTGAGATGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1126063058_1126063061 | 30 | Left | 1126063058 | 15:44802521-44802543 | CCAAACAGGAAGCAGAAGGTACA | No data | ||
Right | 1126063061 | 15:44802574-44802596 | CTGGCTTTCCACTGAGATGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1126063061 | Original CRISPR | CTGGCTTTCCACTGAGATGC AGG | Intergenic | ||